32003D0466



Úradný vestník L 156 , 25/06/2003 S. 0061 - 0073


Rozhodnutie Komisie

z 13. júna 2003,

ktorým sa stanovujú kritériá na vymedzenie pásiem a úradný dozor pri podozrení na výskyt nákazlivej chudokrvnosti lososov (ISA) alebo pri jeho potvrdení

(oznámené pod dokumentom číslo C(2003) 1831)

(Text s významom pre EHP)

(2003/466/ES)

KOMISIA EURÓPSKYCH SPOLOČENSTIEV,

so zreteľom na Zmluvu o založení Európskeho spoločenstva,

so zreteľom na smernicu Rady 91/67/EHS z 28. januára 1991, ktorá sa týka zdravotných podmienok upravujúcich uvádzanie živočíchov a produktov akvakultúry na trh [1], naposledy zmenenú a doplnenú nariadením (ES) č. 806/2003 [2], a najmä na jej článok 15,

so zreteľom na smernicu Rady 93/53/ES z 24. júna 1993, ktorou sa zavádzajú minimálne opatrenia Spoločenstva na kontrolu určitých chorôb rýb [3], naposledy zmenenú a doplnenú rozhodnutím Komisie 2001/288/ES [4], a najmä na jej článok 5 ods. 2 a článok 6,

keďže:

(1) Smernica 93/53/EHS stanovuje, že odber vzoriek a laboratórne testovanie na výskyt chorôb uvedených v zoznamoch I a II (ktoré sú uvedené v prílohe A k smernici 91/67/EHS) sa vykonávajú použitím metód stanovených v súlade s článkom 15 smernice 91/67/EHS.

(2) Plány odberu vzoriek a diagnostické metódy na zisťovanie a potvrdzovanie chorôb rýb uvedených v zozname II, vírovej hemoragénnej septikémie (VHS) a infekčnej nekrózy krvotvorného tkaniva (IHN), sú stanovené v rozhodnutí Komisie 2001/183/ES [5].

(3) Podľa článku 5 ods. 2 a článku 6 smernice 93/53/EHS, všetky hospodárstva nachádzajúce sa v rovnakom povodí alebo v rovnakej pobrežnej oblasti, ako sa nachádza hospodárstvo, ktoré je podozrivé z infekcie nákazlivou chudokrvnosťou lososov (ISA) alebo kde je infekcia potvrdená, sa dostanú pod úradný dozor. Potrebné je stanoviť kritériá na vymedzenie pásiem a úradný dozor.

(4) Na účely definovania plánov odberu vzoriek a diagnostických metód na zisťovanie a potvrdzovanie ISA a stanovenia kritérií pre vymedzenie pásiem a úradný dozor pri podozrení na ISA alebo jeho potvrdení, sa konzultovalo s odborníkmi na zdravie rýb a laboratórnymi odborníkmi. Ďalej sa musia zohľadniť pokyny pre diagnostikovanie ISA, stanovené v súčasnom vydaní Diagnostickej príručky pre choroby vodných živočíchov Medzinárodného úradu pre nákazy zvierat (OIE).

(5) Potrebné je stanoviť dostatočne dlhú dobu na vykonanie týchto nových požiadaviek.

(6) Opatrenia ustanovené v tomto rozhodnutí sú v súlade so stanoviskom Stáleho výboru pre potravinový reťazec a zdravie zvierat,

PRIJALA TOTO ROZHODNUTIE:

Článok 1

Plány odberu vzoriek a diagnostické metódy na zisťovanie a potvrdzovanie nákazlivej chudokrvnosti lososov (ISA), ako aj kritériá na vymedzenie pásiem a úradný dozor pri podozrení na ISA alebo jeho potvrdení, sa stanovujú v prílohe k tomuto rozhodnutiu.

Článok 2

Toto rozhodnutie sa uplatňuje od 23. októbra 2003.

Článok 3

Toto rozhodnutie je adresované členským štátom.

V Bruseli 13. júna 2003

Za Komisiu

David Byrne

člen Komisie

[1] Ú. v. ES L 46, 19.2.1991, s. 1.

[2] Ú. v. EÚ L 122, 16.5.2003, s. 1.

[3] Ú. v. ES L 175, 19.7.1993, s. 23.

[4] Ú. v. ES L 99, 10.4.2001, s. 11.

[5] Ú. v. ES L 67, 9.3.2001, s. 65.

--------------------------------------------------

PRÍLOHA

Plány odberu vzoriek a diagnostické metódy na zisťovanie a potvrdzovanie nákazlivej chudokrvnosti lososov (ISA) a kritériá na vymedzenie pásiem a úradný dozor pri podozrení na ISA alebo jej potvrdení

ÚVOD A DEFINÍCIE

Táto príloha:

a) ustanovuje pokyny a minimálne požiadavky na plány odberu vzoriek a diagnostické metódy zisťovania a potvrdzovania výskytu ISA;

b) začleňuje ustanovenia a definície stanovené v smernici 91/67/EHS a smernici 93/53/EHS;

c) vysvetľuje ustanovenia určené na správne diagnostikovanie, kontrolu a dohľad nad ISA v prípade podozrenia alebo potvrdenia ISA;

d) je určená orgánom zodpovedným za kontrolu ISA, ako aj laboratórnemu personálu, ktorý vykonáva testy na túto chorobu. Dôraz sa kladie na postupy odberu vzoriek, zásady a používania laboratórnych testov a hodnotenia ich výsledkov, ako aj na podrobné laboratórne techniky. Avšak v prípade potreby laboratóriá môžu zmeniť testy opísané v tejto prílohe alebo použiť iné testy pod podmienkou, že sa môže preukázať, že majú rovnakú alebo vyššiu citlivosť a špecifickosť. Okrem toho stanovujú kritériá na vymedzenie pásiem a úradný dozor pri podozrení na ISA alebo jeho potvrdení.

Na účely tejto prílohy sa uplatňujú nasledovné doplnkové definície.

"Povodím" sa rozumie celé povodie vodného zdroja od prameňa až k ústiu alebo časť povodia od prameňa vodného zdroja po prírodnú alebo umelú prekážku, ktorá bráni rybám v pohybe za túto prekážku.

"Pobrežnou oblasťou" sa rozumie časť riečneho alebo morského brehu alebo ústia s presným zemepisným vymedzením, ktoré pozostáva z homogénneho hydrodynamického systému alebo skupín takýchto systémov.

Časť I stanovuje všeobecné zásady a kritériá na diagnostikovanie a potvrdenie ISA a kritériá na vymedzenie pásiem a úradný dozor, ktoré sa majú vykonať pri podozrení na ISA alebo jej potvrdení.

Časť II vysvetľuje inšpekcie a odbery vzoriek, ktoré sa majú vykonať na účely zistenia výskytu ISA.

Časť III stanovuje metódy, ktoré sa majú použiť pre virologické vyšetrenie.

Časť IV naznačuje postup vyšetrenia vzoriek pomocou RT-PCR na zisťovanie ISA.

Časť V popisuje protokol, ktorý sa má použiť na vyšetrenie vzoriek ľadvín pomocou IFAT (testu na nepriamu fluorescenčnú látku), pokiaľ ide o ISA.

Časť VI obsahuje metodológiu pre histológiu.

Časť VII uvádza zoznam akroným a použitých skratiek.

I. Kritériá na diagnostikovanie ISA a pre stanovenie pásiem, niektoré kontrolné opatrenia a úradný dohľad

I.1. Hlavné zásady pre diagnostikovanie ISA

Primerané dôvody pre podozrenie, že ryby sú infikované vírusom ISA, sú uvedené v časti 1.2 tejto prílohy. Členské štáty zaisťujú, aby sa pri podozrení, že ryby v hospodárstve boli infikované vírusom ISA, vykonalo čo najrýchlejšie úradné vyšetrenie na potvrdenie alebo vylúčenie výskytu choroby, pričom sa použijú inšpekcie a klinické vyšetrenia, ako aj zber a výber vzoriek a metódy pre laboratórne vyšetrenie stanovené v časti III – VI tejto prílohy. Výskyt ISA sa považuje za úradne zistený, ak je splnená jedna z troch skupín kritérií stanovených v časti I.3 tejto prílohy.

I.2. Podozrenie na infekciu ISA

I.2.1. Podozrenie na výskyt ISA existuje, ak je splnené aspoň jedno z týchto kritérií:

a) prítomnosť postmortálnych nálezov zlučiteľných s ISA, či už s klinickými príznakmi choroby alebo bez nich. Postmortálne nálezy a klinické príznaky choroby sú v súlade s príznakmi stanovenými v novom vydaní Diagnostickej príručky pre choroby vodných živočíchov OIE;

b) izolovanie a identifikácia vírusu ISA v bunkovej kultúre zo samostatnej vzorky odobratej akejkoľvek rybe na hospodárstve, ako je opísané v časti III;

c) dostatočné preukázanie prítomnosti vírusu ISA v dvoch nezávislých laboratórnych testoch, ako je test RT-PCR (časť IV) a test IFAT (časť V);

d) presun živých rýb do hospodárstva, kde existujú dostatočné dôvody domnievať sa, že v dobe presunu tu bol výskyt ISA;

e) pokiaľ vyšetrenie odhalí iné závažné epidemiologické väzby s hospodárstvami, v ktorých existuje podozrenie na ISA alebo kde bola infekcia ISA potvrdená.

I.2.2. Podozrenie na ISA sa môže vylúčiť, ak trvalé vyšetrenia, ktoré zahŕňajú aspoň jednu klinickú inšpekciu mesačne počas doby šiestich mesiacov neposkytujú žiadny ďalší významný dôkaz o výskyte ISA.

I.3. Potvrdenie ISA

Výskyt ISA sa považuje za potvrdený, ak sú splnené kritériá opísané v písmenách a) alebo b) alebo c):

a) boli pozorované klinické príznaky a postmortálne nálezy zlučiteľné s ISA, v súlade s najnovším vydaním Príručky pre diagnostikovanie chorôb vodných živočíchov OIE vrátane uhynutých rýb, slabých rýb alebo vykazujúcich nenormálne správanie sa, príznaky chudokrvnosti, iné postmortálne nálezy a patologické zmeny a vírus ISA bol zistený jednou alebo viacerými nižšie uvedenými metódami:

i) izolácia a identifikácia vírusu ISA v bunkovej kultúre aspoň z jednej odobratej vzorky z akejkoľvek ryby v hospodárstve, ako je opísané v časti III;

ii) zistenie vírusu ISA pomocou testu RT-PCR podľa metód opísaných v časti IV;

iii) zistenie vírusu ISA v tkanivách alebo prípravkoch z tkaniva prostredníctvom protilátok vírusu ISA (napr. test IFAT na vzorkách ľadvín, ako je opísané v časti V);

b) izolácia a identifikácia vírusu ISA v dvoch vzorkách odobratých z jednej alebo viacerých rýb v hospodárstve testovaných pri rôznych príležitostiach použitím metódy opísanej v časti III;

c) izolácia a identifikácia vírusu ISA aspoň z jednej vzorky odobratej z akejkoľvek ryby v hospodárstve použitím metódy opísanej v časti III, s potvrdením zistenia vírusu ISA v prípravkoch z tkaniva odobratého z akejkoľvek ryby v hospodárstve použitím testu RT – PCR (časť IV) alebo testu IFAT (časť V).

I.4. Kritériá na stanovenie a zrušenie pásiem kontroly a úradného dozoru pri podozrení na ISA a jej potvrdení

I.4.1. Na účely vytvorenia programu úradného dozoru založeného na riziku, členské štáty zavedú v blízkosti hospodárstva, kde je infekcia vírusom ISA úradne zisťovaná alebo potvrdená, vhodné pásma kontroly a dozoru.

I.4.2. Pásma, ktoré sa majú stanoviť, sú definované na základe analýzy nebezpečenstiev ďalšieho rozširovania choroby v konkrétnych prípadoch. V súlade s epizootickou situáciou príslušné povodie alebo pobrežné pásmo:

- je definované ako pásmo kontroly alebo

- ak ide o rozsiahle povodie alebo pobrežné oblasti, môže byť rozdelené na pásmo kontroly a pásmo dozoru, ak nie je ohrozená prevencia rozširovaniu vírusu ISA.

Okrem toho v prípade potreby môžu byť stanovené ďalšie pásma dozoru mimo povodia alebo pobrežnej oblasti.

I.4.3. Hlavné faktory, ktoré sa zohľadňujú pre vymedzenie vyššie uvedených pásiem, sú faktory, ktoré majú vplyv na riziká rozširovania choroby na chovné i voľne žijúce ryby, to znamená: počet, miera a rozdelenie úmrtí rýb v hospodárstve, kde je zistená alebo potvrdená infekcia vírusom ISA; príčina úmrtí v dotknutom hospodárstve; vzdialenosť k susedným hospodárstvam a hustota týchto susedných hospodárstiev; hospodárstva, ktoré sú v styku; druhy prítomné v hospodárstvach; riadenie použité v zasiahnutých hospodárstvach a v susedných hospodárstvach; hydrodynamické podmienky a iné faktory epidemiologického významu identifikované v rámci epizootického vyšetrenia vykonaného v súlade s článkom 5 ods. 2 a s článkom 8 smernice 93/53/EHS.

I.4.4. Na stanovenie pásiem sa použijú tieto minimálne kritériá

I.4.4.1. "Pásmo kontroly" zavádza členský štát v bezprostrednej blízkosti hospodárstva, v ktorom je potvrdená infekcia vírusom ISA takto:

- v pobrežných oblastiach: oblasť zahŕňajúca kruh s priemerom aspoň jedného posunu prílivu alebo aspoň 5 km, ktorého stredom je hospodárstvo, v ktorom je infekcia vírusom ISA potvrdená alebo porovnateľná oblasť určená na základe príslušných hydrodynamických alebo epizootických údajov, alebo

- vo vnútrozemí: celé povodie hospodárstva, v ktorom je potvrdená infekcia vírusom ISA: členský štát môže v rozsiahlych povodiach obmedziť rozsah pásma na časť povodia pod podmienkou, že nie je ohrozená prevencia rozširovania ISA.

I.4.4.2. "Dočasné pásmo kontroly" sa zavádza v prípade podozrenia na výskyt vírusu ISA, toto pásmo je založené na rovnakých kritériách ako "pásmo kontroly".

I.4.4.3. "Pásmo dozoru" zavádza členský štát v prípade potreby mimo pásma kontroly v oblastiach, kde sa považuje za dostatočný menej prísny dozor, pričom toto pásmo odpovedá:

- v pobrežných oblastiach: ploche, ktorá okolo pásma kontroly presahuje pásma posunu prílivu, ploche, ktorá okolo pásma kontroly tvorí kruh s priemerom 10 km od stredu pásma kontroly alebo rovnocennej ploche určenej podľa primeraných hydrodynamických alebo epidemiologických údajov alebo

- vo vnútrozemí: v prípade potreby rozsiahlej ploche ležiacej mimo stanoveného pásma kontroly.

I.5. Zastavenie prevádzky a zrušenie stanovených pásiem

I.5.1. Príslušný orgán členského štátu zaisťuje, aby vo všetkých hospodárstvach ležiacich v pásme kontroly bola na primeranú dobu pozastavená prevádzka potom, ako boli z nich odstránené ryby, a po dezinfekcii v prípade potreby. Doba zastavenia prevádzky v hospodárstvach s potvrdenou infekciou vírusom ISA je minimálne šesť mesiacov. Dĺžku doby zastavenia prevádzky v hospodárstvach v pásmach kontroly určuje príslušný orgán na základe posúdenia rizika v jednotlivých konkrétnych prípadoch. Po vyprázdnení všetkých hospodárstiev ležiacich v pásme kontroly sa zavedie minimálne šesťtýždenné synchronizované obdobie zastavenia prevádzky.

Okrem toho príslušný orgán môže rozhodnúť o zastavení prevádzky v hospodárstvach nachádzajúcich sa v zavedených pásmach dozoru.

I.5.2. Zavedené pásma kontroly nesmú byť zrušené a znova zarybnené, pokiaľ sa všetky hospodárstva nachádzajúce sa v týchto pásmach nezbavia všetkých rýb, prípadne sa nedezinfikujú a neuplynie obdobie zastavenia prevádzky podľa bodu I.5.1. Pri novom zarybnení sa pásma kontroly premenia na pásma dozoru tak, ako je stanovené v bode 1.4.4.3.

I.5.3. Zavedené dočasné pásma kontroly nesmú byť zrušené, pokiaľ sa nevylúči podozrenie na infekciu vírusom ISA v súlade s časťou I.2.2. V prípade potvrdenia ISA v súlade s časťou I.3 sa dočasné pásmo kontroly premení na pásmo kontroly.

I.5.4. Zavedené pásma dozoru sa smú zrušiť až po dvoch rokoch po zrušení pásma kontroly.

I.6. Úradný dozor pri podozrení na ISA alebo jej potvrdení

I.6.1. S odkazom na článok 5 ods. 2 a na článok 6 smernice 93/53/EHS a na účely stanovenia rozdelenia a vývoja choroby pri podozrení na ISA alebo po potvrdení choroby v hospodárstve musí príslušný orgán alebo kvalifikovaný hygienický útvar v oblasti zdravotného stavu rýb po konzultácii s príslušným orgánom a za jeho dozoru vykonať program úradného dozoru založený na riziku vo všetkých hospodárstvach nachádzajúcich sa v zavedených pásmach.

I.6.2. Na účely použitia programu úradného dozoru musí príslušný orgán, v prípade potreby pomocou kontrol na mieste, identifikovať všetky hospodárstva v zavedených pásmach a vykonať úradný súpis druhov, skupín a množstiev rýb chovaných v hospodárstvach, vrátane miery úmrtnosti.

I.6.3. Po prvom úradnom súpise musia hospodárstva v zavedených dočasných pásmach kontroly, ktoré chovajú lososa obecného (Salmo salar) alebo akékoľvek iné druhy uvedené v najnovšom vydaní Veterinárneho kódexu vodných živočíchov OIE ako druhy citlivé na ISA alebo označené za potenciálneho nositeľa ISA, hlásiť všetky prípady uhynutia príslušnému orgánu každých štrnásť dní. Zvýšená úmrtnosť musí byť hlásená za každý deň a sádku. Príslušný orgán vyšetrí akékoľvek výrazné zvýšenie úmrtnosti v hospodárstve.

V prípade potvrdenia podozrenia všetky hospodárstva v zavedenom pásme kontroly hlásia príslušnému orgánu prípady uhynutia každý týždeň za jednotlivé sádky.

Hospodárstva v pásmach dozoru hlásia úmrtnosť príslušnému orgánu každých 14 dní.

Okrem toho v zavedených pásmach sa pravidelne počas celého roka vykonávajú inšpekcie s frekvenciou uvedenou v tabuľke I. Ak však klimatické podmienky znemožnia vykonanie takýchto inšpekcií v určitej časti roka, môžu členské štáty stanoviť inú frekvenciu inšpekcií v pohotovostnom pláne.

Tabulka I

P r o g r a m ú r a d n é h o d o z o r u

Umiestnenie hospodárstva | Minimálny počet inšpekcií za rok | Minimálny počet inšpekcií za rok po zrušení pásma kontroly |

Pásmo kontroly | 12 | |

Pásmo dozoru | 6 | 6 |

Dočasné pásmo kontroly | 6 | |

Program dozoru sa vykonáva až do zrušenia pásiem.

I.6.4. Inšpekcia, ako aj výber, zber, príprava a odoslanie vzoriek sa vykonáva spôsobom definovaným v častiach II.1 až II.4. Vyšetrenie vzoriek prebieha v súlade s časťami III až VI.

II. Inšpekcia a odber vzoriek

II.1. II. Inšpekcia, výber a zber vzoriek v hospodárstve s podozrením na výskyt ISA

II.1.1. Pri pravidelných inšpekciách vykonávaných v rámci programu úradného dozoru opísaného v časti I.6 a v hospodárstvach podozrivých na infekciu vírusom ISA sa vyšetruje celé vybavenie hospodárstva (sádky, nádrže a bazény), aby sa odhalila prítomnosť uhynutých a slabých rýb alebo rýb s neobvyklým správaním sa. Ak je to možné, nedávno uhynuté ryby (nerozložené) a slabé ryby alebo ryby s neobvyklým správaním sa, sa vyšetria na účely zistenia klinických príznakov alebo postmortálnych nálezov ISA, ako je opísané v novom vydaní Diagnostickej príručky pre choroby vodných živočíchov OIE.

II.1.2. Ak sú pozorované aktuálne klinické príznaky zlučiteľné s ISA alebo pokiaľ inšpektor alebo veterinárny lekár má akýkoľvek iný dôvod predpokladať, že ryby môžu byť infikované, vykoná sa odber vzoriek aspoň u 10 rýb. Ak je to možné, vzorku tvoria ryby, ktoré uhynuli nedávno, sú slabé alebo vykazujú neobvyklé správanie sa. Ak nie je dostatok rýb vykazujúcich klinické príznaky, potom sa vzorka doplní zdravými rybami odobratými zo sádok, nádrží alebo bazénov, v ktorých sú najvyššie počty úmrtnosti alebo najväčší počet rýb vykazujúcich klinické príznaky choroby.

II.1.3. Pokiaľ sa spozorujú čerstvo uhynuté ryby, slabé ryby alebo ryby vykazujúce neobvyklé správanie sa, avšak, ak klinické príznaky a postmortálne nálezy nepotvrdzujú ISA, nie je povinný odber vzoriek, avšak inšpektor alebo veterinárny lekár môže požadovať odber vzoriek na zistenie inej diagnózy.

II.1.4. Ak existuje podozrenie, že voľne žijúce ryby sú infikované ISA, členské štáty zaistia, aby boli odobraté príslušné vzorky a vyšetrené vhodnými klinickými a laboratórnymi metódami, ako je stanovené v častiach II až VI, aby sa vylúčila alebo potvrdila prítomnosť ISA, a aby sa posúdilo, či predstavuje vážnu hrozbu pre chovné ryby.

II.2. Príprava vzoriek rýb

II.2.1. Vzorky na histologické vyšetrenie sa odoberajú iba z čerstvo zabitých rýb, ktoré vykazujú klinické príznaky choroby alebo ich postmortálne nálezy vykazujú výskyt choroby. Z akýchkoľvek vonkajších alebo vnútorných poranení sa odoberú vzorky, v každom prípade však z pečene, zo stredu ľadviny, zo srdca a zo sleziny sa odoberú vzorky u každej ryby pomocou skalpela a prenesú sa do slaného tlmiaceho roztoku 8 až 10 % (vol/vol) formalínu. Pomer medzi fixatívom a tkanivom musí byť aspoň 20:1, aby sa zaručila spoľahlivá konzervácia tkanív.

II.2.2. Tkanivá pre virologické vyšetrenie sa odoberajú zo všetkých vzoriek rýb. Duplicitné vzorky sa odoberú na účely potvrdenia výsledku. Časti pečene, prednej ľadviny, srdca a sleziny sa odoberajú z rýb pomocou sterilného nástroja a prenesú sa do plastových skúmaviek obsahujúcich 9 ml prepravného roztoku, t. j. prostredie bunkovej kultúry s antibiotikami. Vhodná je kombinácia 12,5 μg ml-1 fungizónu, 200 IU ml-1 polymixínu B a 200 μg ml-1 kanamycínu, avšak môžu sa použiť aj iné kombinácie s preukázanou účinnosťou. Tkanivá maximálne z piatich rýb sa môžu zbierať do jednej skúmavky, ktorá obsahuje prepravný roztok a predstavuje to jednu súhrnnú vzorku. Hmotnosť tkaniva v jednej vzorke je 1,0 ± 0,5 g.

II.2.3. Vzorky ľadvín sa odoberú na vyšetrenie testom IFAT z čerstvo zabitých rýb to znamená do dvoch hodín po smrti. Pomocou sterilných nástrojov sa odoberie časť zo stredu ľadviny. Tkanivo sa osuší do sacieho papiera, aby sa odstránila prebytočná krv, potom sa niekoľkokrát stlačí na sklenenú doštičku potiahnutú poly-L-lysinom. Vedľa seba sa nachádzajú rôzne vzorky, ale neprekrývajú sa, takže vzniká neprerušená jednotná vrstva buniek. Krv a tkanivový mok nie sú vhodným materiálom pre tento test. Treba zabrániť, aby vzorka ľadviny "nevytiekla" na sací papier, pretože to by mohlo viesť k zrážaniu krvi spôsobujúcom, že by sa na testovacej doštičke ukladalo veľké množstvo sérových bielkovín. Vzorky sa osušia na vzduchu, potom sa držia v chlade a suchu, pokiaľ nemajú byť okamžite fixované. Fixácia vzoriek sa vykonáva do 72 hodín po odbere vzorky z ryby. Alebo sa vzorky zmrazia po osušení na vzduchu a potom sa skladujú až do jedného mesiaca pri teplote – 20 °C pred fixáciou.

II.2.4. Ryby vykazujúce príznaky chudokrvnosti môžu byť omráčené a vzorky heparinizovanej krvi sa okamžite odoberú na hematologické vyšetrenie, ako je meranie hematokritu.

II.2.5. Tkanivo pre analýzu RT-PCR sa odoberie zo všetkých vzoriek rýb. Časť prednej alebo strednej ľadviny sa odstráni z ryby použitím sterilného nástroja a prenesie sa do mikroskúmavky, ktorá obsahuje 1 ml konzervačného roztoku RNA preukázanej účinnosti. Tkanivá maximálne z piatich rýb sa môžu zbierať do jednej skúmavky, ktorá obsahuje prepravný roztok a predstavuje to jednu súhrnnú vzorku. Hmotnosť tkaniva v jednej vzorke je približne 0,5 g. Ak sú ryby príliš malé na to, aby sa získala vzorka požadovanej hmotnosti, môžu byť odobraté časti ľadviny, srdca, sleziny, pečene alebo pylorického slepého čreva v tomto poradí tak, aby ich hmotnosť bola 0,5 g.

II.3. Odosielanie vzoriek rýb

II.3.1. Vzorky krvi a skúmavky, ktoré obsahujú tkanivá rýb určené na virologické vyšetrenie alebo analýzu RT-PCR sa umiestnia do izolovaných nádob (napríklad polystyrénových krabíc s hrubými stenami) spolu s dostatočným množstvom ľadu alebo "mraziacimi blokmi" na účely zaistenia chladenia vzoriek počas prepravy do laboratória. Nesmie dôjsť k zmrazeniu a v prepravnej nádobe musí byť stále ľad v čase prijatia alebo jeden alebo viac "mraziacich blokov" musí byť čiastočne alebo úplne zmrazených. Za mimoriadnych okolností môžu byť vzorky RT-PCR a vzorky na virologické vyšetrenie rýchlo zmrazené a prepravované do laboratória pri teplote – 20 °C alebo nižšej.

II.3.2. Doštičky pre test IFAT sa odosielajú s držiakmi doštičiek s dostatočným množstvom vysúšacej látky na účely uchovania vzoriek suchých a chladených, ako je uvedené vyššie.

II.3.3. Ak sú tkanivá rýb prepravované vo fixatíve na histologické vyšetrenie, odosielajú sa v utesnených skúmavkách umiestnených do nádob odolných voči nárazom, ako sú polystyrénové krabice s hrubými stenami.

II.3.4. Pokiaľ vzorky neboli zmrazené, virologické vyšetrenie sa musí začať čo možno najskôr a najneskôr 72 hodín po odbere vzoriek. Vzorka pre porovnávajúcu analýzu sa skladuje pri teplote – 20 °C alebo nižšej po príchode do laboratória.

II.3.5. Do laboratória sa môžu prepravovať tiež celé ryby, ak môžu byť splnené teplotné požiadavky počas dopravy, ako je opísané v II.3.1. Celá ryba sa zabalí do sacieho papiera a odošle sa v plastovom vreci, chladená, ako je uvedené vyššie.

II.3.6. Živé ryby sa môžu tiež odosielať, ale iba za dozoru úradných služieb.

II.3.7. Pre analýzu RT-PCR tkanív konzervovaných v RNAlater, musí sa extrakcia RNA vykonať v určitej lehote pre vzorky skladované pri rôznych teplotách. Tieto lehoty sú uvedené nižšie:

—–37 oC | jeden deň |

—25 oC | jeden týždeň |

—4 oC | jeden mesiac |

—– 20 oC | bez stanovenia lehoty |

II.3.8. Všetky balenia a označenia sa musia vykonávať v súlade s platnými vnútroštátnymi a medzinárodnými nariadeniami pre prepravu, ako je vhodné.

II.4. Zber doplnkového diagnostického materiálu

Po dohode s diagnostickým laboratóriom, môžu sa zbierať iné tkanivá rýb a pripravovať pre doplnkové vyšetrenie.

III. Virologické vyšetrenie

III.1. Príprava vzoriek

III.1.1. Tam, kde vznikajú praktické ťažkosti, ktoré spôsobujú, že nie je možné naočkovanie buniek do 72 hodín po zbere vzoriek tkaniva, pripúšťa sa zmrazenie tkaniva pri teplote – 80 °C až do maximálnej doby 28 dní. Tkanivá musia byť zmrazené a rozmrazené iba pred vyšetrením.

III.1.2. Každá vzorka (zmes tkaniva v prepravnom roztoku) sa úplne homogenizuje použitím drviča, miešacieho zariadenia alebo trecej misky (mažiaru) a paličky, odstredí sa pri 2000 až 4000 x g počas 15 minút pri teplote 0 až 6 °C a plávajúca vrstva sa filtruje (0,45 μm) a inkubuje sa rovnakým objemom zmesi vhodne zriedeného antiséra proti indigénnym sérotypom vírusu IPN. Titer antiséra musí byť aspoň 1:2000 v 50 % neutralizačnom teste na nákazu. Zmes sa inkubuje počas jednej hodiny pri teplote 15 °C. To prestavuje látku inokulum (očkovacia látka).

Ošetrenie všetkých očkovacích látok antisérom na IPN vírus (vírus, ktorý sa vyskytuje v niektorých častiach Európy u 50 % vzoriek rýb) je určené na zabránenie tomu, aby sa v naočkovaných bunkových kultúrach objavil CPE spôsobený vírom IPN. Tým sa zníži doba virologických vyšetrení, ako aj počet prípadov, v ktorých by sa výskyt CPE mohol považovať za možný indikátor vírusu ISA.

Ak vzorky pochádzajú z výrobných závodov, ktoré sú považované za také, kde sa nevyskytuje vírus IPN, potom sa môže upustiť od ošetrenia očkovacou látkou s antisérom na vírus IPN.

III.2. Naočkovanie bunkových kultúr

III.2.1. Bunky SHK-1 (prechod 80 alebo nižšie) alebo bunky TO sa kultivujú v prostredí L-15 obsahujúcom 5 % séra zo zárodku hovädzieho dobytka, 2 % (v/v) 200 mM L-glutamínu a 0,08 % (v/v) 50 mM 2-merkaptoetanolu na doštičkách s 12 alebo 24 jamkami. Môžu byť použité aj iné bunkové reťazce s preukázanou účinnosťou a citlivosťou na izolovanie vírusu ISA, pričom sa zohľadňuje variabilita kmeňa a schopnosť rôznych kmeňov rozmnožovať sa v rôznych bunkových reťazcoch. Roztok orgánov ošetrených antisérom sa naočkuje do mladých bunkových kultúr v čase aktívneho rastu, aby sa dosiahol konečný roztok tkanivového materiálu v kultivačnom prostredí v pomere 1:1000. Pre každú suspenziu orgánov sa pridá 40 μl očkovacej látky do jednej jamky obsahujúcej 2 ml kultivačnej pôdy. Na účely minimalizácie nebezpečia krížovej kontaminácie, odporúča sa použitie doštičiek so samostatnými 12 alebo 24 jamkami pre vzorky pochádzajúce z rôznych hospodárstiev chovu rýb.

III.2.2. Jedna doštička zostane nenaočkovaná, aby slúžila ako negatívna kontrola. Osobitná doštička sa naočkuje referenčným izolátom ISA ako pozitívna kontrola nasledovne. Sto μl zásobného prípravku vírusu ISA (minimálny titer 107 TCID50 ml-1) sa naočkuje v prvej jamke a dobre sa premieša. Objem tohto materiálu sa prenesie z prvej jamky do druhej, aby sa získal roztok v pomere 1:10 a dobre sa premieša. Tento postup sa opakuje v celej doštičke, aby sa získalo šesť roztokov v pomere 1:10. Zásoba vírusu ISA sa môže uchovávať pri teplote – 80 °C počas doby minimálne dvoch rokov, ale po rozmrazení musí byť do troch dní použitá. Poznámka: treba dbať na to, aby sa zabránilo krížovej kontaminácii testovacích doštičiek s pozitívnym kontrolným materiálom. Aby sa zabránilo tomuto nebezpečenstvu, potrebné je stanovovať pozitívne kontroly, a aby sa s nimi pracovalo oddelene od testovacích doštičiek.

III.2.3. Vzorky sa inkubujú pri teplote 14 ± 2 °C počas doby maximálne 15 dní.

III.3. Mikroskopia

Použitím mikroskopu sa dvakrát vyšetrujú bunkové kultúry na zistenie CPE, najskôr v období medzi piatym a siedmym dňom, a potom medzi dvanástym a štrnástym dňom po naočkovaní. Pokiaľ zmes obsahuje CPE, je potrebné okamžite začať s identifikáciou vírusu (III.6). Ak sa nepozoruje žiaden CPE do 14 dní, vykoná sa hemadsorpčný test (III.4).

III.4. Hemadsorpcia

Rozmnoženie vírusu ISA v bunkových kultúrach nemusí vždy viesť k výskytu CPE. Preto sa každá jamka podrobuje hemadsorpčnému testu, ako je opísané nižšie, alebo sa každá jamka podrobuje testu IF, ako je opísané v bode III.6.1.

III.4.1. Z každej jamky sa odoberie prostredie bunkovej kultúry, vrátane tých, ktoré sú s pozitívnymi a negatívnymi kontrolami a umiestnia sa do označených sterilných skúmaviek. Do každej jamky sa pridá 500 μl 0,2 % (v/v) roztoku umytých červených krviniek zajaca alebo koňa alebo 0,05 % (v/v) roztoku umytých červených krviniek pstruha dúhového alebo lososa obecného a inkubuje sa pri izbovej teplote počas 45 minút. Červené krvinky sa odstránia a každá jamka sa dvakrát opláchne pomocou roztoku L-15. Každá jamka sa vyšetrí použitím mikroskopu.

III.4.2. Prítomnosť zhlukov červených krviniek pripojených k povrchu buniek SHK-1 alebo TO indikuje podozrenie na infekciu orthomyxovírusom. Ak je hemadsorpčný test pozitívny, okamžite sa vykoná test na identifikáciu vírusu (III.6).

III.5. Subkultivácia alebo prechod

III.5.1. Subkultivácia sa vykonáva v období medzi 13. až 15. dňom. Dvesto dvadsaťpäť μl kultúry plávajúcej na povrchu sa pridá do jamiek, ktoré obsahujú čerstvé bunky SHK-1 v etape aktívneho rastu na 12-jamkových doštičkách a inkubuje sa pri teplote 14 ± 2 °C maximálne počas doby 18 dní. Bunkové kultúry sa dvakrát preskúmajú použitím mikroskopu na zistenie CPE, a to medzi piatym a siedmym dňom a medzi štrnástym a osemnástym dňom po naočkovaní. Ak niektorá vzorka vykazuje CPE, okamžite sa začne postup identifikácie vírusu (III.6). Ak sa nespozoruje žiaden CPE medzi 14. až 18. dňom, vykoná sa hemadsorpčný test (III.4).

III.5.2. Ak sa zistí cytotoxicita počas prvých siedmich dní po inkubácii, vykoná sa subkultivácia v tejto etape a bunky sa musia inkubovať počas doby 14 až 18 dní, a potom sú znova subkultivované ďalších 14 až 18 dní po inkubácii. Ak sa vyskytne cytotoxicita po siedmich dňoch, vykoná sa subkultivácia a bunky sú inkubované tak, aby sa dosiahol celkový počet 28 až 36 dní inkubácie od prvého naočkovania.

III.5.3. Ak sa v prvotnej kultúre vyskytne bakteriálna kontaminácia, musí sa test zopakovať použitím homogenátu tkaniva skladovaného pri teplote – 80 °C. Pred naočkovaním sa homogenát tkaniva odstredí pri 4000 x g počas 30 minút pri 0 až 6 °C a na povrchu plávajúca vrstva sa filtruje na 0,22 μm. Ak sa vyskytuje bakteriálna kontaminácia počas subkultivačného stupňa, na povrchu plávajúca vrstva sa filtruje na 0,22 μm, naočkovaná do čerstvých buniek a je inkubovaná na dobu ďalších 14 až 18 dní.

III.6. Testy na identifikáciu vírusu

Ak sa preukáže výskyt CPE v akomkoľvek štádiu alebo ak je pozitívny hemadsorpčný test, vykoná sa identifikácia vírusu. Metódy, ktoré sa môžu zvoliť na identifikáciu vírusu ISA, sú IF (III.6.1) a RT-PCR (časť IV). Ak sa predpokladá možná prítomnosť aj iných vírusov, odporúča sa vykonať doplňujúce testy k identifikácii vírusov. Ak tieto testy neumožnia definitívnu identifikáciu vírusu do jedného týždňa, musí sa na povrchu plávajúca vrstva odoslať do národného referenčného laboratória alebo referenčného laboratória EÚ pre choroby rýb na okamžitú identifikáciu.

III.6.1. IF

III.6.1.1. Bunky SHK-1 (prechod 80 alebo nižší) alebo bunky TO sa kultivujú v živnej pôde L-15 obsahujúcej 5 % sérum zo zárodku hovädzieho dobytka, 2 % (v/v) 200 mM L-glutamínu a 0,08 % (v/v) 50 mM 2-merkaptoetanolu na doštičkách s 24 alebo 96 jamkami a pri použití hustoty vyvolávajúcej viac ako 50 % spájania. Môžu sa použiť tiež iné bunkové reťazce alebo kultivačné pôdy s preukázanou účinnosťou. Dvesto dvadsaťpäť μl plávajúcej vrstvy kultúry infikovanej vírusom sa pridá do každej z dvoch jamiek, premieša sa a prenesie sa 225 μl do dvoch ďalších jamiek s riedením 1:5. Dve ďalšie jamky, ktoré zostali nenaočkované, poslúžia ako kontrolné vzorky. Vzorky z každého rybného hospodárstva sa umiestnia na samostatné doštičky, ako aj kontrolné vzorky vírusu. Kontrola vírusu sa vykoná použitím referenčného izolátu vírusu ISA.

III.6.1.2. Doštičky sa inkubujú pri teplote 14 ± 2 °C a vyšetrujú sa pod mikroskopom počas doby maximálne siedmich dní. Ak sa zistí predčasný CPE alebo ak sa nezistil žiaden CPE do siedmich dní, potom je ďalším krokom fixácia. Jamky sa opláchnu PBS a fixujú sa inkubáciou s 80 % acetónom počas doby 20 minút pri izbovej teplote. Doštičky sa usušia na vzduchu a okamžite sa zafarbia alebo sa skladujú pri teplote 0 – 6 °C maximálne 24 hodín pred zafarbením.

III.6.1.3. Duplicitné jamky sa zafarbia monoklonálnou protilátkou vírusu ISA 3H6F8 alebo inou monoklonálnou protilátkou s preukázanou účinnosťou a špecifickosťou, rozriedia sa v PBS a inkubujú pri teplote 37 ± 4 °C počas doby 30 minút. Monoklonálna protilátka sa odstráni a doštičky sa trikrát opláchnu 0,05 % Tween 20 v PBS. Konjagulát obsahujúci myšiu protilátku IgG FITC, rozriedený v PBS sa pridá do každej jamky a inkubuje sa pri teplote 37 ± 4 °C počas doby 30 minút. Poznámka: zriedenia rôznych šarží monoklonálnej protilátky a konjagulátu FITC sa optimalizujú v každom laboratóriu. Protilátka sa odstráni a doštičky sa trikrát opláchnu 0,05 % Tween 20 v PBS.

III.6.1.4. Jamky sa okamžite vyšetria použitím inverzného mikroskopu, ktorý je vybavený fluorescenčným mikroskopom s filtrom upraveným pre excitáciu FITC. Test sa považuje za pozitívny, ak sú pozorované fluorescenčné bunky. K tomu, aby sa test platný, musia mať kontrolné vzorky tiež pozitívny výsledok a negatívne vzorky výsledok negatívny.

IV. Vyšetrenie vzoriek pomocou RT-PCR

IV.1. Tento oddiel opisuje postupy požadované pre zväčšenie časti segmentu 8 genómu ISA pomocou PCR, ktoré môže byť vykonané na tkanive rýb alebo v kultúre vírusu ISA

IV.1.1. E x t r a k c i a R N A

a) RNAlater sa odstráni z každej vzorky. Do každej skúmavky sa pridá 1 ml destilovanej vody ošetrenej DEPC a skúmavky sa potom odstredia pri 13000 rpm počas doby piatich minút pri teplote 0 až 6 °C.

b) Plávajúca vrstva sa odstráni z každej vzorky a 800 μl TRIzolu (Invitrogen) alebo alternatívneho činidla, u ktorého sa preukázalo, že má účinnosť porovnateľnú alebo vyššiu, sa pridá do každej vzorky a do kontrolnej skúmavky, ktorá obsahuje vhodný kontrolný materiál (400 μl destilovanej vody alebo homogenát ľadvín odobratý z rýb bez špecifikovaných patogénnych organizmov). V prípade potreby sa tkanivá môžu opakovane oddeliť pomocou opakovaného pipetovania. Skúmavky sa inkubujú pri izbovej teplote počas doby piatich minút. Do každej skúmavky sa pridá 160 μl chloroformu a skúmavky sa silne pretrepú počas doby troch minút, potom sa odstredia pri 13000 rpm počas doby 15 minút pri teplote 0 až 6 °C.

c) Odstráni sa vrchná vodná vrstva do označenej mikroskúmavky s obsahom 1,5 ml obsahujúcej 500 μl izopropanolu, a potom sa skúmavky inkubujú počas doby 10 minút pri izbovej teplote, potom sa odstredia pri 6500 rpm počas doby 15 minút pri teplote 0 až 6 °C.

d) Odstráni sa na povrchu plávajúca vrstva a pridá sa 1 ml 75 % etanolu k pelete RNA. Skúmavky sa odstredia pri 6500 rpm počas doby piatich minút pri teplote 0 až 6 °C.

e) Na povrchu plávajúca vrstva sa odstráni a skúmavky sa nechajú otvorené počas doby asi tri minúty, aby sa vyparil zvyšný etanol. K peletu sa pridá 15 μl destilovanej vody ošetrenej DEPC na účely premeny suspenzie a v prípade potreby, rýchlo sa rozvíri.

f) Na vypočítanie koncentrácie RNA a čistoty vzoriek sa použije spektrofotometer. Optické hustoty sa zmerajú pri 260 a 280 nm.

g) RNA, ktorá musí byť okamžite použitá (v ten istý deň), sa môže dočasne skladovať pri teplote 0 až 6 °C. Nepoužitá RNA sa skladuje pri teplote – 80 °C.

IV.1.2. RT

a) Dva μg RNA sa rozriedia v destilovanej vode ošetrenej DEPC v mikroskúmavkách s objemom 1,5 ml. Ak je koncentrácia vzoriek RNA príliš slabá na to, aby sa mohli použiť 2 μg pri reakcii RT, použije sa čo najväčšie množstvo RNA. Rozriedená RNA sa inkubuje pri teplote 55 až 60 °C počas doby 10 minút.

b) Skúmavky obsahujúce RNA sa umiestnia do ľadu a pridajú sa činidlá RT, aby sa získali konečné koncentrácie 1 x tlmič, 1mM dNTPs, 100 ng náhodných hexamérov, 20 U RNase inhibítora a 200 U MMLV-RT v celkovom objeme 20 μl.

c) Skúmavky sa inkubujú pri teplote 37 °C počas doby jednej hodiny.

d) cDNA sa skladuje pri teplote 0 až 6 °C podľa potreby a použije sa čo najskôr v PCR.

IV.1.3. PCR

a) Do zmesi 45 μl PCR sa pridá 5 μl cDNA s cieľom získania konečných koncentrácií 1 x tlmič, 1,5 mM MgCl2, 02 mM každé dNTP, 25 pmol každého priméru a 1 U Taq polymerázy. Priméry sú ISA+ (5'-GGC-TAT-CTA-CCA-TGA-ACG-AAT-C-3') (primér v smere) a ISA- (5'-GCC-AAG-TGT-AAG-TAG-CAC-TCC-3') (primér v protismere). Musia sa vykonať negatívne kontroly pre extrakciu, zahrnú sa etapy RT a PCR.

b) Skúmavky sa umiestnia do termocykleru naprogramovaného na 94 °C na dobu piatich minút, potom nasleduje 35 cyklov pri 94 °C počas doby jednej minúty, 55 °C počas jednej minúty a 72 °C počas jednej minúty s konečnou inkubáciou pri 72 °C počas doby piatich minút.

c) Výsledky PCR sa posúdia po elektroforéze použitím 2 % agarozového gelu zafarbeného etidiumbromidom a obsahujúcim veľkostné markery súčasne so vzorkami a zahŕňajúcim negatívne kontroly pre etapu RT a PCR. Samostatný produkt PCR o 15 5bp sa považuje za ukazovateľ prítomnosti RNA vírusu ISA. Vzorky, ktoré obsahujú doplňujúci produkt o 310 bp, sa tiež považujú za obsahujúce RNA vírusu ISA. Vzorky, ktorých výsledky násobia produkty PCR, vrátane aspoň jedného s približne 155 bp, môžu obsahovať RNA vírusu ISA. Môžu byť ďalej vyšetrené sondami DNA alebo nukleotidovým sekvenovaním.

IV.1.4. P o t v r d e n i e v í r u s u I S A i z o l o v a n é h o z t k a n i v o v e j k u l t ú r y p o m o c o u P C R

Ak došlo k úplného CPE počas virologického vyšetrenia vzoriek tkaniva v bunkách SHK-1, odstráni sa z jamky 400 μl na povrchu plávajúcej vrstvy a umiestni sa do sterilnej skúmavky s objemom 1,5 ml. RNA sa extrahuje z tejto vzorky rovnako ako v bode III.1 a vykoná sa test RT-PCR. Ak sa použijú kultúry, u ktorých nie je úplný CPE, odstráni sa na povrchu plávajúca vrstva, bunky sa oškrabú z povrchu jamky alebo banky a vložia sa do sterilnej skúmavky s objemom 1,5 ml na extrakciu RNA a test RT-PCR.

IV.1.5. P o t v r d e n i e v í r u s u PC R s o n d o u D N A

a) Špecifickosť produktu PCR o 155 bp môže byť posúdená sondážou s oligonukleotidom, ktorý sa kríži v oblasti produktu PCR, vlastnou pre priméry. Produkty PCR sa podrobujú elektroforéze v 1 % agarózovom géle súčasne s veľkostnými markermi a s pozitívnou kontrolou a negatívnymi kontrolami v etapách RT a PCR.

b) DNA sa podrobí reakcii Southern-blot na membráne a označený oligonukleotid (5'- CGGGAGTTGATCAGACATGCACTGA AGGTG-3') sa inkubuje s membránou po príslušných prehybridizačných etapách.

c) Neviazané a osobitne neviazané sondy sa opláchnu a viazané sondy sa vizualizujú.

d) Sondy viazané na fragment 155 bp (a 310 bp, ak je prítomný) predstavujú dôkaz špecifickosti PCR a naznačujú, že RNA vírusu ISA bola prítomná vo vzorke.

IV.1.6. N u k l e o t i d o v é s e k v e n o v a n i e p r o d u k t o v P C R

Špecifickosť PCR môže byť posúdená vyšetrením nukleotidového sekvenovania 155 bp produktu PCR.

a) Produkt PCR sa očistí od agarózového gélu alebo roztoku.

b) Fragment sa sekvenuje pomocou rovnakých primérov, ako boli použité pri PCR alebo vektore primérov pri klonovaní vo vektore pred sekvenovaním.

c) Nukleotidová sekvencia sa porovná so sekvenciami segmentu 8 vírusu ISA dostupného v databáze nukleotidovej sekvencie EMBL (čísla prístupu Y10404, AJ012285, AJ242016).

d) Prítomnosť sekvencie, ktorá zodpovedá sekvencii segmentu 8 vírusu ISA je dôkazom, že vzorka obsahovala RNA vírusu ISA.

V. Vyšetrenie vzoriek ľadvín pomocou IFAT

V.1. Dolu uvedený protokol bol vypracovaný pre vyšetrenie vzoriek ľadvín pomocou testu IFAT

V.2. Príprava a zafarbenie vzoriek

V.2.1. Doštičky sa fixujú v acetóne alebo metanole/acetóne (1:1) počas doby troch minút a nechajú sa uschnúť na vzduchu. Pred zafarbením sa každá doštička vyšetrí a obkreslia sa vhodné pásma perom ImmEdgeTM alebo jemu podobným perom a doštička sa usuší na vzduchu. Potom sa doštičky vložia do blokujúceho roztoku (6 % odstredené mlieko v PBS obsahujúce 0,2 % Tween 20) a inkubujú sa za mierneho pretrepania počas doby 30 minút pri izbovej teplote. Každá doštička sa nechá odkvapkať a umiestni sa vodorovne v prepravke na doštičky, ktorý obsahuje vlhkú utierku na uchovanie vlhkého prostredia.

V.2.2. Každá vzorka sa pokryje roztokom monoklonálnej protilátky 3H6F8 na vírus ISA (alebo inou protilátkou s preukázanou špecifickosťou a účinnosťou) a prepravka na doštičky sa uzavrie a inkubuje sa pri pretrepaní počas 60 minút pri izbovej teplote. Protilátka sa normálne riedi v pomere 1:10 až 1:100 v 1 % odstredenom mlieku, avšak skutočné zriedenie sa musí určiť pre každú šaržu. Doštičky sa trikrát opláchnu počas doby dvoch minút v PBS obsahujúcom 0,1 % Tween 20. Každá vzorka sa pokryje roztokom obsahujúcim konjugát FITC (goat anti mouse), zriedeným v pomere 1:1000 v 1 % odstredenom mlieku a inkubuje sa vo vlhkom prostredí počas doby 60 minút pri izbovej teplote. Doštičky sa trikrát opláchnu počas dvoch minút v PBS obsahujúcom 0,1 % Tween 20. Každá doštička sa pokryje roztokom CITIFLOURTM (500 μl CITIFLOURTM zmiešaného s 1,5 ml Tween 20 v 0,1 % (v/v) v PBS) alebo v inej vhodnej stavebnej živnej pôde počas doby 10 minút. Doštičky sa trikrát opláchnu v PBS obsahujúcom 0,1 % Tween 20. Ak je potrebné dofarbovanie, každá vzorka sa pokryje propidiumjodidom (0,01 mg/ml) v PBS obsahujúcom 0,1 % Tween 20 a inkubuje sa počas doby troch minút pri izbovej teplote. Doštička sa trikrát omyje počas doby 2 minút v PBS obsahujúcom 0,1 % Tween 20. Doštičky sa osušia a vložia sa do CITIFLOURUTM alebo inej vhodnej stavebnej živnej pôdy. Doštičky sa skladujú na tmavom mieste pri teplote 4 oC pred mikroskopickým vyšetrením.

V.3. Vyšetrenie pomocou fluorescenčného mikroskopu

Každá doštička sa vyšetrí pod mikroskopom vhodným pre epifluorescenčné osvetlenie použitím príslušného filtra, ktorý vyvolá FITC a spôsobí, že sa objaví charakteristická zelená fluorescencia. Všetky polia ležiace v pásmach označených perom ImmEdgeTM sa vyšetria objektívmi x 10 a x 20 a podozrivé pásma (tie, ktoré vykazujú zelenú fluorescenciu) sa znova vyšetria objektívom x 40 a fázovým/fluorescenčným osvetlením, aby sa zaručilo, že fluorescencia je v bunke dobre spojená. Zaznamenajú sa koordináty v etapách pre podozrivé pásma tak, aby druhý laborant neskôr mohol potvrdiť povahu fluorescencie. Po vyšetrení prvým laborantom sa podozrivé alebo pozitívne doštičky znova vyšetria druhým laborantom a potvrdia sa výsledky.

V.4. Kontroly

V.4.1. Každá šarža sfarbených doštičiek pre test IFAT musí obsahovať tri typy kontrol:

- vzorku ľadviny z neinfikovaného lososa obecného (negatívna kontrola),

- neinfikovaná bunková kultúra SHK-1 alebo iná citlivá bunková kultúra (negatívna kontrola),

- bunková kultúra SHK-1 infikovaná vírusom ISA alebo iná citlivá bunková kultúra (pozitívna kontrola).

V.4.2. Ak je to možné, odporúča sa vzorka ľadviny lososa obecného infikovaného vírusom ISA ako doplňujúca pozitívna kontrola.

V.4.3. Ak sa z negatívnych kontrol dospeje k pozitívnemu výsledku, test sa považuje za neplatný pre všetky doštičky danej šarže. Ak sú negatívne všetky doštičky šarže, vrátane pozitívnych kontrol, test sa považuje za neplatný pre všetky doštičky tejto šarže. V prípade, ak chybné kontroly spôsobia neplatnosť šarže doštičiek, všetky tieto doštičky sa zničia a vykoná sa nové testovanie pomocou použitia duplikátov vzoriek.

V.5. Vyšetrenie iných tkanív

Táto technika sa môže použiť na iné rybie tkanivá, ako na pečeň, slezinu a srdce pod podmienkou, že na doštičku sa môže uložiť dostatočné množstvo endotelových buniek, leukocytov a lymfocytov. Farbenie je rovnaké pre všetky tkanivá, ale u niektorých tkanív sa odporúča nepoužívať značenie propidiumjodidom a uprednostniť fázové osvetlenie, aby sa identifikovali druhy buniek prítomné vo vzorke.

VI. HISTOLÓGIA

Vzorky napustené do parafínu sa nakrájajú na kúsky veľkosti 5 μm a zafarbia sa použitím hematoxylínu a eosínu. Histologické zmeny súvisiace s ISA sú opísané v novom vydaní Diagnostickej príručky pre choroby vodných živočíchov OIE.

VII. VI. Akronymá a skratky

cDNA | Doplňujúca deoxyribonukleová kyselina |

CPE | Cytopatický efekt |

DEPC | Diehylpyrouhličitan |

dNTP | Deoxinukleotid triofosfát |

FITC | Izotiokyanát fluoresceinu |

IF | Imunofluorescencia |

IFAT | Nepriamy test na fluorescenčnú protilátku |

OIE | Medzinárodný úrad pre nákazy zvierat ("Office international des epizooties") |

IPN(V) | Infekčná nekróza slinivky (vírus) |

ISA(V) | Nákazlivá chudokrvnosť lososov (vírus) |

PBS | Slaný tlmivý fosfátový roztok |

RNA | Kyselina ribonukleová |

RT-(PCR) | Obrátená transkripcia (polymerázová reťazová reakcia) |

SHK-1 | Hlavné ľadvinové bunky lososa |

TCID50 | Dávka, ktorá infikuje 50 % tkanivových kultúr |

--------------------------------------------------