32003D0466

2003/466/CE: Décision de la Commission du 13 juin 2003 établissant les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de l'anémie infectieuse du saumon (AIS) (Texte présentant de l'intérêt pour l'EEE) [notifiée sous le numéro C(2003) 1831]

Journal officiel n° L 156 du 25/06/2003 p. 0061 - 0073


Décision de la Commission

du 13 juin 2003

établissant les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de l'anémie infectieuse du saumon (AIS)

[notifiée sous le numéro C(2003) 1831]

(Texte présentant de l'intérêt pour l'EEE)

(2003/466/CE)

LA COMMISSION DES COMMUNAUTÉS EUROPÉENNES,

vu le traité instituant la Communauté européenne,

vu la directive 91/67/CEE du Conseil du 28 janvier 1991 relative aux conditions de police sanitaire régissant la mise sur le marché d'animaux et de produits d'aquaculture(1), modifiée en dernier lieu par le règlement (CE) n° 806/2003(2),et notamment son article 15,

vu la directive 93/53/CEE du Conseil du 24 juin 1993 établissant des mesures communautaires minimales de lutte contre certaines maladies des poissons(3), modifiée en dernier lieu par la décision 2001/288/CE de la Commission(4),et notamment son article 5, paragraphe 2, et son article 6,

considérant ce qui suit:

(1) La directive 93/53/CEE dispose que l'échantillonnage et l'analyse en laboratoire destinés à détecter la présence de maladies des listes I et II - qui figurent à l'annexe A de la directive 91/67/CEE - sont effectués selon les méthodes définies conformément à l'article 15 de la directive 91/67/CEE.

(2) Les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation des maladies des poissons figurant sur la liste II, la septicémie hémorragique virale (SHV) et la nécrose hématopoïétique infectieuse (NHI), sont établis par la décision 2001/183/CE de la Commission(5).

(3) Selon les articles 5, paragraphe 2, et 6 de la directive 93/53/CEE, toutes les exploitations situées dans le même bassin versant ou la même zone côtière qu'une exploitation suspectée d'être infectée par le virus de l'anémie infectieuse du saumon (AIS) ou dont l'infection est confirmée sont placées sous surveillance officielle. Il y a lieu d'établir les critères de zonage et les mesures de surveillance officielle à appliquer.

(4) Afin de définir les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de l'AIS et d'établir les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de l'AIS, des experts en matière d'état sanitaire des poissons et des experts de laboratoire ont été consultés. En outre, les orientations pour le diagnostic de l'AIS énoncées dans l'édition actuelle du Manuel pour le diagnostic des maladies des animaux aquatiques de l'Office international des épizooties (OIE) doivent être prises en considération.

(5) Il y a lieu de prévoir une période suffisamment longue pour la mise en oeuvre de ces nouvelles exigences.

(6) Les mesures prévues par la présente décision sont conformes à l'avis du comité permanent de la chaîne alimentaire et de la santé animale,

A ARRÊTÉ LA PRÉSENTE DÉCISION:

Article premier

Les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de l'anémie infectieuse de saumon (AIS), ainsi que les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de l'AIS sont établis à l'annexe de la présente décision.

Article 2

La présente décision s'applique à compter du 23 octobre 2003.

Article 3

Les États membres sont destinataires de la présente décision.

Fait à Bruxelles, le 13 juin 2003.

Par la Commission

David Byrne

Membre de la Commission

(1) JO L 46 du 19.2.1991, p. 1.

(2) JO L 122 du 16.5.2003, p. 1.

(3) JO L 175 du 19.7.1993, p. 23.

(4) JO L 99 du 10.4.2001, p. 11.

(5) JO L 67 du 9.3.2001, p. 65.

ANNEXE

Plans d'échantillonnage et méthodes de diagnostic pour la détection et la confirmation de l'anémie infectieuse du saumon (AIS) ainsi que critères de zonage et mesures de surveillance officielle à adopter après suspicion ou confirmation de l'AIS

INTRODUCTION ET DÉFINITIONS

La présente annexe:

a) prévoit les orientations et les exigences minimales concernant les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de la présence de l'AIS;

b) intègre les dispositions et les définitions figurant dans les directives 91/67/CEE et 93/53/CEE;

c) énonce les dispositions appropriées à prendre pour le diagnostic, le contrôle et la surveillance de l'AIS en cas de suspicion ou de confirmation de la maladie;

d) s'adresse aussi bien aux autorités de contrôle de l'AIS qu'au personnel de laboratoire qui réalise les tests concernant cette maladie. Elle met l'accent sur les procédures d'échantillonnage, les principes et l'application des tests de laboratoire et l'évaluation de leurs résultats, ainsi que sur les techniques détaillées de laboratoire. Néanmoins, si nécessaire, les laboratoires peuvent modifier les tests décrits dans la présente annexe, ou avoir recours à des tests différents, à condition de pouvoir prouver que ceux-ci sont d'une sensibilité et d'une spécificité égales ou supérieures. En outre, elle énonce les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de l'AIS.

Aux fins de la présente annexe, on entend par:

"Bassin versant": tout le bassin versant, de la source des voies d'eau à l'estuaire, ou une partie d'un bassin versant allant de la source de la voie d'eau à un barrage naturel ou artificiel qui empêche les poissons de migrer au-delà de ce barrage;

"Zone côtière": une partie des eaux côtières ou maritimes ou un estuaire répondant à une délimitation géographique précise, qui consiste en un système hydrodynamique homogène ou une série de tels systèmes.

La partie I établit les principes généraux et les critères pour le diagnostic et la confirmation de l'AIS, ainsi que les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de l'AIS.

La partie II indique les inspections et les prélèvements à effectuer afin de détecter la présence de l'AIS.

La partie III énonce les méthodes de l'examen virologique.

La partie IV décrit la procédure d'examen des échantillons par RT-PCR pour la détection de l'AIS.

La partie V décrit le protocole à suivre pour l'examen des calques de rein par IFAT en ce qui concerne l'AIS.

La partie VI décrit la méthode d'histologie.

La partie VII énumère les acronymes et les abréviations utilisés.

I. Critères pour le diagnostic de l'AIS, pour l'établissement de zones et l'adoption de certaines mesures de contrôle et de surveillance officielle

I.1. Principes généraux du diagnostic de l'AIS

La partie I.2 de la présente annexe indique de bonnes raisons de suspecter que des poissons sont infectés par le virus de l'AIS. Les États membres veillent à ce que, lorsque les poissons d'une exploitation sont suspectés d'être infectés par le virus de l'AIS, une enquête officielle soit réalisée aussi rapidement que possible pour confirmer ou exclure la présence de la maladie, enquête fondée sur les inspections et examens cliniques, la collecte et la sélection d'échantillons et les méthodes de laboratoire prévus dans les parties III à VI de la présente annexe. La présence de l'AIS est officiellement confirmée si l'une des trois séries de critères énoncées dans la partie I.3 de la présente annexe est remplie.

I.2. Suspicion d'infection par l'AIS

I.2.1. La présence de l'AIS est suspectée si au moins un des critères suivants est rempli:

a) établissement de constatations post mortem compatibles avec l'AIS, avec ou sans signes cliniques de la maladie. Les constatations post mortem et les signes cliniques de la maladie sont conformes à ceux énoncés dans l'édition actuelle du Manuel pour le diagnostic des maladies des animaux aquatiques de l'Office international des épizooties (OIE);

b) isolement et identification du virus de l'AIS dans une culture cellulaire d'un échantillon unique prélevé sur tout poisson issu de l'exploitation conformément à la partie III;

c) preuve raisonnable de la présence du virus de l'AIS dans deux tests de laboratoires indépendants tels que le test RT-PCR (partie IV) et le test IFAT (partie V);

d) transfert de poissons vivants dans une exploitation où il y a de bonnes raisons de suspecter que l'AIS était présente au moment du transfert;

e) lorsqu'une enquête révèle d'autres liens épidémiologiques importants avec des exploitations dont la contamination par l'AIS est suspectée ou confirmée.

I.2.2. La suspicion d'AIS peut être exclue lorsque des enquêtes continues impliquant au moins une inspection clinique par mois pendant une période de six mois ne fournissent aucune autre preuve significative de la présence de l'AIS.

I.3. Confirmation de l'AIS

La présence de l'AIS est considérée comme confirmée si les critères décrits sous a), b) ou c) sont remplis:

a) observation de signes cliniques et constatations post mortem compatibles avec l'AIS conformément à l'édition actuelle du Manuel pour le diagnostic des maladies des animaux aquatiques de l'OIE, y compris des poissons morts, faibles ou ayant un comportement anormal, des signes d'anémie, d'autres constatations post mortem et modifications pathologiques; détection du virus de l'AIS par une ou plusieurs des méthodes suivantes:

i) isolement et identification du virus de l'AIS dans une culture cellulaire d'au moins un échantillon prélevé sur tout poisson issu de l'exploitation conformément à la partie III;

ii) détection du virus de l'AIS par le test RT-PCR selon les méthodes décrites dans la partie IV;

iii) détection du virus de l'AIS dans des tissus ou préparations de tissus au moyen des anticorps spécifiques contre le virus de l'AIS (par exemple test IFAT sur des calques de rein tel que décrit dans la partie V);

b) isolement et identification du virus de l'AIS dans deux échantillons prélevés sur un ou plusieurs poissons de l'exploitation contrôlée à différentes reprises selon la méthode décrite dans la partie III;

c) isolement et identification du virus de l'AIS dans au moins un échantillon prélevé sur tout poisson de l'exploitation selon la méthode décrite dans la partie III, avec confirmation de la preuve de ce virus dans des préparations de tissus prélevés sur tout poisson de l'exploitation par le test RT-PCR (partie IV) ou le test IFAT (partie V).

I.4. Critères pour l'établissement et la suppression de zones de contrôle et de surveillance officielle après suspicion et confirmation de l'AIS

I.4.1. Afin d'établir un programme officiel de surveillance basé sur le risque, les États membres procèdent, à proximité d'une exploitation dont la contamination par l'AIS est officiellement suspectée ou confirmée, à l'établissement de zones appropriées de contrôle et de surveillance.

I.4.2. Les zones à établir sont définies sur la base d'une analyse au cas par cas des risques de propagation ultérieure de la maladie. Conformément à la situation épizootiologique, le bassin versant ou la zone côtière concerné(e):

- est défini(e) comme zone de contrôle, ou

- peut, s'il s'agit d'un bassin versant ou d'une région côtière étendu(e), être divisé(e) en une zone de contrôle et une zone de surveillance si la prévention de la propagation de l'AIS n'est pas compromise.

En outre, des zones de surveillance supplémentaires peuvent être établies, si nécessaire, en dehors du bassin versant ou de la zone côtière.

I.4.3. Les principaux facteurs à prendre en compte pour établir les zones précitées sont ceux qui ont une incidence sur les risques de propagation de la maladie aux poissons d'élevage et sauvages, à savoir: le nombre, le taux et la répartition des cas de mortalité de poissons dans l'exploitation dont la contamination par le virus de l'AIS est officiellement suspectée ou confirmée, la cause des décès dans l'exploitation concernée, la distance par rapport aux exploitations voisines et la densité de ces dernières, les exploitations en contact, les espèces présentes dans les exploitations, la gestion appliquée dans les exploitations infectées et voisines, les conditions hydrodynamiques et autres facteurs présentant une importance épidémiologique identifiés dans le cadre de l'enquête épizootique effectuée conformément à l'article 5, paragraphe 2, et à l'article 8, de la directive 93/53/CEE.

I.4.4. Les critères minimaux suivants sont applicables pour l'établissement des zones:

I.4.4.1. Une "zone de contrôle" est établie par l'État membre à proximité immédiate d'une exploitation dont la contamination par le virus de l'AIS est confirmée de la manière suivante:

- dans les zones côtières: la zone comprise dans un cercle d'un rayon d'au moins un déplacement de la marée ou d'au moins 5 kilomètres (km), centrée autour de l'exploitation dont la contamination par le virus de l'AIS est confirmée, ou une zone équivalente déterminée selon des données hydrodynamiques ou épidémiologiques appropriées, ou

- à l'intérieur des terres: tout le bassin versant de l'exploitation dont la contamination par le virus de l'AIS est confirmée; dans les bassins versants étendus, l'État membre peut limiter l'extension de la zone à des parties du bassin versant, à condition que la prévention de la propagation de l'AIS ne soit pas compromise.

I.4.4.2. Une "zone de contrôle temporaire" est établie en cas de suspicion de la présence de l'AIS, fondée sur les mêmes critères que la "zone de contrôle".

I.4.4.3. Une "zone de surveillance" est établie si nécessaire par l'État membre en dehors de la zone de contrôle dans les secteurs où une surveillance moins poussée est jugée suffisante; elle correspond:

- dans les zones côtières: à la superficie qui, autour de la zone de contrôle, chevauche les zones de déplacement de la marée; ou à la superficie qui, autour de la zone de contrôle, est comprise dans un cercle d'un rayon de 10 km à partir du centre de la zone de contrôle, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées, ou

- à l'intérieur des terres: si nécessaire, à une zone étendue située à l'extérieur de la zone de contrôle établie.

I.5. Vide sanitaire et suppression des zones établies

I.5.1. L'autorité compétente de l'État membre veille à ce que toutes les exploitations situées dans la zone de contrôle soient soumises à une période appropriée de vide sanitaire après avoir été vidées de leurs poissons et, le cas échéant, désinfectées. La période de vide sanitaire des exploitations confirmées comme contaminées par le virus de l'AIS est d'au moins six mois. Pour les autres exploitations situées dans des zones de contrôle, cette période est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas. Lorsque toutes les exploitations situées dans la zone de contrôle sont vidées, un vide sanitaire synchronisé d'au moins six semaines est établi.

En outre, l'autorité compétente peut décider d'instaurer un vide sanitaire dans les exploitations situées dans les zones de surveillance établies.

I.5.2. Les zones de contrôle établies ne peuvent pas être supprimées et repeuplées avant que toutes les exploitations qui s'y trouvent aient été vidées de leurs poissons, désinfectées le cas échéant, et qu'elles aient été soumises à un vide sanitaire conformément à la partie I.5.1. Lors de leur repeuplement, les zones de contrôle sont converties en zones de surveillance conformément à la partie I.4.4.3.

I.5.3. Les zones de contrôle temporaire établies ne peuvent pas être supprimées avant que la suspicion de contamination par le virus de l'AIS ait été exclue conformément à la partie I.2.2. En cas de confirmation de l'AIS conformément à la partie I.3, la zone de contrôle temporaire est convertie en zone de contrôle.

I.5.4. Les zones de surveillance établies ne peuvent pas être supprimées moins de deux ans après la suppression de la zone de contrôle.

I.6. Surveillance officielle après suspicion ou confirmation de l'AIS

I.6.1. En référence à l'article 5, paragraphe 2, et à l'article 6, de la directive 93/53/CEE et afin de déterminer la répartition et l'évolution de la maladie après suspicion ou confirmation de l'AIS dans une exploitation, un programme officiel de surveillance fondé sur le risque doit être appliqué par l'autorité compétente ou par des services sanitaires qualifiés en matière d'état sanitaire des poissons, en consultation avec l'autorité compétente et sous son contrôle, dans toutes les exploitations situées dans les zones établies.

I.6.2. Aux fins de l'application de ce programme officiel de surveillance, l'autorité compétente doit, si nécessaire en procédant à une inspection sur place, identifier toutes les exploitations situées dans les zones établies et procéder au recensement officiel des espèces, catégories et quantités de poissons élevés dans les exploitations, y compris les taux de mortalité.

I.6.3. À la suite du recensement officiel initial, les exploitations situées dans les zones de contrôle temporaire établies qui élèvent le saumon de l'Atlantique (Salmo salar) - ou toute autre espèce qualifiée, d'après la dernière édition du Code sanitaire international pour les animaux aquatiques de l'OIE, de sensible à l'AIS ou de vecteur potentiel de cette maladie - sont tenues de notifier les cas de mortalité à l'autorité compétente tous les quatorze jours. L'augmentation de la mortalité doit être notifiée par jour et par cage. L'autorité compétente procède à une enquête pour toute augmentation sensible de la mortalité dans une exploitation.

Si la suspicion de contamination est confirmée, toutes les exploitations dans la zone de contrôle établie notifient les cas de mortalité chaque semaine à l'autorité compétente, par cage et par jour.

Les exploitations situées dans les zones de surveillance notifient les cas de mortalité tous les quatorze jours à l'autorité compétente.

En outre, les inspections sont pratiquées à intervalles réguliers tout au long de l'année dans les zones établies, selon la fréquence prévue au tableau 1. Néanmoins, lorsque les conditions climatiques rendent ces inspections impossibles pendant une partie de l'année, les États membres peuvent fixer d'autres fréquences d'inspection dans le plan d'urgence.

Tableau 1

Programme de surveillance officiel

>TABLE>

Le programme de surveillance est appliqué jusqu'à ce que les zones soient supprimées.

I.6.4. Les inspections ainsi que la sélection, la collecte, la préparation et l'envoi des échantillons se déroulent comme prévu dans les parties II.1 à II.4. L'examen des échantillons a lieu conformément aux parties III à VI.

II. Inspections et échantillonnage

II.1. Inspection, sélection et collecte des échantillons dans une exploitation où la présence de l'AIS est suspectée

II.1.1. Lors des inspections régulières effectuées dans le cadre du programme officiel de surveillance décrit dans la partie I.6 ainsi que dans les exploitations suspectées d'être infectées par l'AIS, tous les équipements des exploitations (cages, cuves et bassins) font l'objet d'une inspection destinée à détecter la présence de poissons morts, faibles ou ayant un comportement anormal. Dans la mesure du possible, les poissons qui viennent de mourir (non décomposés), faibles ou ayant un comportement anormal font l'objet d'un examen destiné à détecter les signes cliniques de l'AIS ou à faire les constatations post mortem de la maladie, comme décrit dans l'édition actuelle du Manuel pour le diagnostic des maladies des animaux aquatiques de l'OIE.

II.1.2. Si des signes cliniques récents compatibles avec l'AIS sont observés, ou si un inspecteur ou un vétérinaire a toute autre raison de suspecter que des poissons peuvent être infectés, un prélèvement d'au moins dix poissons est effectué. Si possible, l'échantillon se compose de poissons qui viennent de mourir, sont faibles ou ont un comportement anormal. S'il n'y a pas assez de poissons présentant des signes cliniques, l'échantillon est complété avec des poissons sains prélevés dans les cages, cuves ou bassins où sont constatés les taux les plus élevés de mortalité ou les plus grands nombres de poissons présentant des signes cliniques de la maladie.

II.1.3. Si des poissons qui viennent de mourir, faibles ou ayant un comportement anormal sont observés, mais que les signes cliniques et les constatations post mortem ne sont pas compatibles avec l'AIS, le prélèvement d'échantillons n'est pas obligatoire, mais de tels échantillons, qui peuvent être nécessaires à un diagnostic différentiel, peuvent être prélevés à la demande de l'inspecteur ou du vétérinaire.

II.1.4. Lorsque des poissons sauvages sont suspectés d'être infectés par l'AIS, les États membres veillent à ce que des échantillons appropriés soient prélevés et examinés selon les méthodes cliniques et de laboratoire requises, conformément aux parties II et III-VI, afin d'exclure ou de confirmer la présence de l'AIS et d'estimer si cela constitue une menace importante pour les poissons d'élevage.

II.2. Préparation des échantillons de poissons

II.2.1. Les échantillons destinés à un examen histologique ne sont prélevés que sur des poissons fraîchement abattus, qui présentent des signes cliniques ou ont fait l'objet de constatations post mortem compatibles avec la présence de la maladie. Toute lésion externe ou interne est prélevée; dans tous les cas, des échantillons de foie, de rein médian, de coeur et de rate sont prélevés sur chaque poisson à l'aide d'un scalpel et transférés dans une solution saline tamponnée à 8-10 % (vol/vol) de formol. Le rapport entre le fixatif et le tissu doit être d'au moins 20:1 pour garantir une conservation satisfaisante des tissus.

II.2.2. Les tissus utilisés dans l'examen virologique sont prélevés sur tous les poissons de l'échantillon. Des duplicats d'échantillons sont prélevés à des fins de confirmation. Des morceaux de foie, de rein antérieur, de coeur et de rate sont prélevés sur les poissons à l'aide d'un instrument stérile et transférés dans des tubes en plastique contenant 9 ml de solution de transport, c'est-à-dire un milieu de culture cellulaire avec antibiotiques. Une combinaison de 12,5 μg par ml-1 de fungizone, 200 UI de polymixine B par ml-1 et 200 μg de kanamycine par ml-1 convient, mais d'autres combinaisons dont l'efficacité est prouvée peuvent aussi être utilisées. Des tissus prélevés sur cinq poissons au maximum peuvent être rassemblés dans un tube contenant une solution de transport: ils constituent un échantillon global. Le poids du tissu d'un échantillon est de 1,0 ± 0,5 gramme (g).

II.2.3. Les calques de rein destinés au test IFAT doivent être pris sur le poisson fraîchement abattu dans un délai de deux heures après la mort. Un morceau de rein médian est prélevé à l'aide d'instruments stériles. Le tissu est épongé sur du papier absorbant pour enlever l'excédent de sang, puis il est pressé à plusieurs reprises sur une lame en verre enduite de poly-L-lysine. Les différentes impressions sont placées côte à cote, mais sans se chevaucher, de manière à donner une couche unique continue de cellules. Le sang et le liquide tissulaire ne conviennent pas pour ce test. Il faut éviter de laisser l'échantillon de rein "s'égoutter" sur le papier absorbant, car cela peut entraîner la coagulation du sang et le dépôt de grandes quantités de protéines sériques sur la lame. Les calques sont séchés à l'air, puis conservés au frais s'ils ne doivent pas être fixés immédiatement. Ils sont fixés dans un délai de 72 heures après avoir été prélevés. Ils peuvent aussi être congelés après le séchage à l'air, puis stockés pendant un mois au maximum à - 20 °C avant fixation.

II.2.4. Les poissons qui présentent des signes d'anémie peuvent être étourdis; des échantillons de sang hépariné sont prélevés immédiatement en vue d'un examen hématologique tel que la mesure de l'hématocrite.

II.2.5. Prélever du tissu sur tous les poissons de l'échantillon en vue d'un examen RT-PCR. Prélever un morceau de rein antérieur ou médian sur les poissons à l'aide d'un instrument stérile et le transférer dans un microtube contenant 1 ml de solution de conservation de l'ARN d'une efficacité prouvée. Le tissu de cinq poissons au maximum peut être rassemblé dans un tube de solution de conservation; cela constitue un échantillon global. Le poids du tissu d'un échantillon est d'environ 0,5 g. Quand les poissons sont trop petits pour donner un échantillon du poids voulu, des morceaux peuvent être prélevés sur le rein, le coeur, la rate, le foie ou les caecums pyloriques, dans cet ordre, pour donner 0,5 g.

II.3. Envoi des échantillons de poissons

II.3.1. Placer les échantillons de sang et les tubes contenant les tissus de poisson destinés à l'examen virologique ou à l'analyse RT-PCR dans des récipients isolés (par exemple des boîtes en polystyrène à parois épaisses), avec une quantité suffisante de glace ou de blocs réfrigérants pour garantir la réfrigération des échantillons pendant le transport vers le laboratoire. La congélation doit être évitée et le récipient de transport doit contenir encore de la glace lors de sa réception, ou bien un ou plusieurs des blocs réfrigérants doivent être encore partiellement ou totalement congelés. Exceptionnellement, les échantillons destinés à l'analyse RT-PCR et ceux destinés à l'examen virologique peuvent être surgelés et transportés vers le laboratoire à - 20 °C ou moins.

II.3.2. Les lames pour le test IFAT sont expédiées dans des supports de lames avec une quantité suffisante de dessiccateur pour que les calques demeurent secs et réfrigérés comme indiqué ci-dessus.

II.3.3. Si les tissus de poissons sont transportés dans un fixatif pour l'examen histologique, ils sont expédiés dans des tubes étanches placés dans des récipients qui résistent aux chocs tels que des boîtes en polystyrène à parois épaisses.

II.3.4. À moins que les échantillons n'aient été congelés, l'examen virologique doit commencer le plus tôt possible, en tout cas au plus tard soixante-douze heures après la collecte des échantillons. Stocker l'échantillon destiné à l'analyse de confirmation à - 20 °C ou moins dès son arrivée au laboratoire.

II.3.5. Les poissons entiers peuvent être transportés au laboratoire si les conditions de température pendant le transport prévues dans la partie II.3.1 peuvent être remplies. Les poissons entiers sont enveloppés dans du papier absorbant et expédiés dans un sac en plastique, réfrigérés comme indiqué ci-dessus.

II.3.6. Des poissons vivants peuvent être également expédiés, mais uniquement sous la surveillance du service officiel.

II.3.7. Pour l'analyse RT-PCR de tissus conservés dans du RNAlater, l'extraction de l'ARN doit être réalisée dans un délai qui varie en fonction de la température. Les délais à respecter sont indiqués ci-après:

>TABLE>

II.3.8. Toutes les opérations de conditionnement et d'étiquetage doivent être réalisées conformément aux réglementations nationales et internationales en vigueur en matière de transport, selon le cas.

II.4. Collecte de matériel de diagnostic supplémentaire

En accord avec le laboratoire de diagnostic, d'autres tissus de poissons peuvent être collectés et préparés en vue d'un examen supplémentaire.

III. EXAMEN VIROLOGIQUE

III.1. Préparation des échantillons

III.1.1. Lorsque surgissent des difficultés pratiques qui empêchent d'inoculer des cellules dans les 72 heures suivant la collecte des échantillons de tissus, il est admis que ces échantillons soient congelés à - 80 °C pendant vingt-huit jours au maximum. Toutefois, les tissus ne peuvent être congelés et décongelés qu'une fois avant leur examen.

III.1.2. Chaque échantillon (mélange de tissus dans une solution de transport) est entièrement homogénéisé à l'aide d'un broyeur stomacher, d'un mixeur ou d'un ensemble mortier-pilon, centrifugé à 2000 à 4000 x g pendant 15 minutes à 0-6 °C, puis le surnageant est filtré (0,45 μm) et incubé avec un volume égal d'un mélange convenablement dilué d'antisérums contre les sérotypes indigènes du virus de la NPI. Le titre de l'antisérum doit être d'au moins 1:2000 dans un test de neutralisation sur lame à 50 %. Le mélange est incubé pendant 1 heure à 15 °C. Cela constitue l'inoculum.

Le traitement de tous les inoculums par un sérum antivirus IPN (virus qui, dans certaines régions d'Europe, est présent dans 50 % des échantillons de poissons) vise à empêcher l'apparition, dans des cultures cellulaires inoculées, d'un effet cytopathique (ECP) résultant du virus NPI. Ce traitement permet de réduire la durée des examens virologiques ainsi que le nombre de cas où l'apparition d'un ECP devrait être considérée comme une indication potentielle du virus de l'AIS.

Lorsque des échantillons proviennent d'unités de production considérées comme indemnes de NPI, le traitement des inoculums par le sérum antivirus NPI n'est pas nécessaire.

III.2. Inoculation des cultures cellulaires

III.2.1. Des cellules SHK-1 (passage 80 ou moins) ou des cellules TO sont cultivées dans un milieu L-15 contenant 5 % de sérum de foetus de bovin, 2 % (v/v) mM de L-glutamine et 0,08 % (v/v) de 2-mercaptoéthanol à 50 mM sur des lames de culture à douze ou vingt-quatre cupules. D'autres lignées cellulaires d'une efficacité et d'une sensibilité prouvées pour l'isolement du virus de l'AIS peuvent être utilisées, compte tenu de la variabilité de la souche et de l'aptitude des différentes souches à se reproduire dans différentes lignées cellulaires. Inoculer une suspension d'organes traitée à l'antisérum dans de jeunes cultures cellulaires en phase de croissance active pour donner une dilution finale du matériel tissulaire dans un milieu de culture au 1:1000. Pour chaque suspension d'organes, ajouter 40 μl d'inoculum à une cupule contenant 2 ml de milieu de culture. Pour minimiser le risque de contamination croisée, il est recommandé d'utiliser des lames séparées à douze ou vingt-quatre cupules pour les échantillons provenant de différents sites d'aquaculture.

III.2.2. Conserver une lame non inoculée qui servira de témoin négatif. Inoculer une autre lame avec un isolat de référence du virus de l'AIS à titre de témoin positif, en procédant de la manière suivante: inoculer 100 μl d'une préparation mère du virus de l'AIS (titre minimum: 107 TCID50 par ml) dans la première cupule et bien mélanger. Transférer un volume de cette matière de la première cupule dans la deuxième afin d'obtenir une dilution au 1:10 et bien mélanger. Reproduire l'opération sur toute la lame pour obtenir six dilutions au 1:10. La préparation mère du virus de l'AIS peut être stockée à - 80 °C pendant au moins deux ans; cependant, une fois décongelée, elle doit être utilisée dans les trois jours. À noter: il convient d'empêcher la contamination croisée des lames de test avec la matière du témoin positif. Pour éviter ce risque, constituer et traiter séparément les témoins positifs et les lames de test.

III.2.3. Incuber les échantillons à 14 ± 2 °C pendant quinze jours au maximum.

III.3. Microscopie

Examiner les cultures de cellules deux fois au microscope pour déceler un ECP, d'abord entre le cinquième et le septième jour, puis entre le douzième et le quatorzième jour après inoculation. Si un mélange présente un ECP, procéder immédiatement à l'identification du virus (III.6). Si aucun ECP n'est observé au quatorzième jour, réaliser un test d'hémadsorption (III.4).

III.4. Hémadsorption

La reproduction du virus de l'AIS dans des cultures cellulaires n'aboutit pas toujours à l'apparition d'un ECP. En conséquence, chaque cupule est soumise à un test d'hémadsorption comme décrit ci-dessous, ou bien à un test IF (voir partie III.6.1).

III.4.1. Prélever du milieu de culture cellulaire sur chaque cupule, y compris sur les cupules des témoins positifs et négatifs, et mettre chaque prélèvement dans un tube stérile étiqueté. Ajouter à chacune cupule 500 μl d'une suspension à 0,2 % (v/v) de globules rouges de lapin ou de cheval lavés ou d'une suspension à 0,05 % (v/v) de globules rouges de truite arc-en-ciel ou de saumon de l'Atlantique lavés et laisser incuber à température ambiante pendant 45 minutes. Éliminer les globules rouges et laver chacune cupule deux fois avec le milieu L-15. Examiner chaque cupule au microscope.

III.4.2. La présence de groupes de globules rouges adhérant à la surface des cellules SHK-1 ou TO révèle l'infection présumée par un orthomyxovirus. Si un test d'hémadsorption est positif, procéder immédiatement à un test d'identification du virus (III.6).

III.5. Sous-culture ou passage

III.5.1. Réaliser une sous-culture entre le treizième et le quinzième jour. Ajouter 225 μl de surnageant de culture aux cupules contenant des cellules SHK-1 en phase active de croissance sur des lames à douze cupules, puis laisser incuber à 14 ± 2 °C pendant dix-huit jours au maximum. Examiner les cellules de culture deux fois au microscope pour la recherche d'un ECP, d'abord entre le cinquième et le septième jour puis entre le quatorzième et le dix-huitième jour après inoculation. Si un échantillon de cellules présente un ECP, procéder immédiatement à l'identification du virus (III.6). Si aucun ECP n'est observé entre le quatorzième et le dix-huitième jour, procéder à un test d'hémadsorption (III.4).

III.5.2. Si un effet cytotoxique est observé au cours des sept jours suivant l'incubation, réaliser une sous-culture, laisser les cellules incuber pendant quatorze à dix-huit jours puis réaliser une nouvelle sous-culture assortie d'une nouvelle période d'incubation de quatorze à dix-huit jours. Si l'effet cytotoxique apparaît au bout de sept jours, procéder à une seule sous-culture et laisser les cellules incuber de manière à parvenir à un nombre total de vingt-huit à trente-six jours d'incubation à partir de l'inoculation primaire.

III.5.3. En cas de contamination bactérienne de la culture primaire, reprendre le test à partir d'un homogénat de tissus stocké à - 80 °C. Avant l'inoculation, centrifuger cet homogénat à 4000 x g pendant 30 minutes à 0-6 °C et filtrer le surnageant à 0,22 μm. Si la contamination bactérienne se produit pendant la phase de sous-culture, filtrer le surnageant à 0,22 μm, l'inoculer à des cellules fraîches et laisser incuber pendant une nouvelle période de quatorze à dix-huit jours.

III.6. Tests d'identification du virus

En cas de preuve d'un ECP à quelque stade que ce soit, ou en cas de test d'hémadsorption positif, procéder à l'identification du virus. Les méthodes d'identification du virus de l'AIS disponibles sont l'immunofluorescence (IF) (voir partie III.6.1) et la RT-PCR (partie IV). Si l'on soupçonne la présence d'autres virus, il est recommandé de procéder à des tests supplémentaires pour identifier le virus. Si ces tests ne permettent pas d'identifier définitivement le virus dans un délai d'une semaine, le surnageant doit être envoyé à un laboratoire national de référence ou à un laboratoire de référence de l'Union européenne spécialisé dans les maladies des poissons en vue d'une identification immédiate du virus.

III.6.1. Immunofluorescence

III.6.1.1. Cultiver des cellules de rein antérieur de saumon SHK-1 (passage 80 ou inférieur) ou des cellules TO dans un milieu L-15 contenant 5 % de sérum de foetus de bovin, 2 % (v/v) de L-glutamine à 200 mM et 0,08 % (v/v) de 2-mercaptoéthanol à 50 mM sur des lames à vingt-quatre ou quatre-vingt seize cupules, à une densité engendrant une confluence supérieure à 50 %. D'autres lignées cellulaires ou un milieu de culture d'une efficacité prouvée peuvent également être utilisés. Ajouter 225 μl de surnageant de culture présumé infecté par le virus à chacune de deux cupules, mélanger et transférer 225 μl dans deux autres cupules à une dilution de 1:5. Deux autres cupules non inoculées serviront de témoins. Les échantillons des différentes exploitations sont traités sur des lames séparées, de même que les témoins. Le virus est contrôlé sur un isolat de référence du virus de l'AIS.

III.6.1.2. Incuber les lames à 14 ± 2 °C et les examiner au microscope pendant sept jours au maximum. Si un ECP précoce est observé ou si aucun ECP n'est observé dans un délai de sept jours, l'étape suivante est la fixation. À cet effet, laver les cupules avec du PBS et les fixer par incubation avec 80 % d'acétone pendant 20 minutes à température ambiante. Laisser les lames sécher à l'air et les colorer immédiatement, ou bien les stocker à 0-6 °C pendant 24 heures au maximum avant de les colorer.

III.6.1.3. Marquer des duplicats de cupules par l'anticorps monoclonal antivirus AIS 3H6F8 ou par un autre anticorps monoclonal d'une efficacité et d'une spécificité prouvées, diluer dans du PBS et laisser incuber à 37 ± 4 °C pendant 30 minutes. Éliminer l'anticorps monoclonal et laver les lames trois fois avec 0,05 % de Tween 20 dans du PBS. Ajouter du conjugué anti-IgG de souris marqué FITC dilué dans du PBS à chaque cupule et incuber à 37 ± 4 °C pendant 30 minutes. À noter: les dilutions des différents lots d'anticorps monoclonal et le conjugué FITC sont optimisés dans chaque laboratoire. Éliminer l'anticorps et laver les lames trois fois avec 0,05 % de Tween 20 dans du PBS.

III.6.1.4. Examiner immédiatement les cupules au microscope inversé équipé pour la fluorescence avec un filtre adapté pour exciter le FITC. Un test est considéré comme positif si des cellules fluorescentes sont observées. Pour qu'un test soit valable, les témoins positifs doivent donner un résultat positif et les témoins négatifs un résultat négatif.

IV. Examen des échantillons par RT-PCR

IV.1. La présente section décrit les procédures requises pour l'amplification par PCR d'une partie du segment 8 du génome du virus de l'AIS, qui peut être réalisée sur des tissus de poissons ou dans une culture du virus

IV.1.1. Extraction de l'ARN

a) Éliminer le RNAlater de chaque échantillon. Ajouter un 1 ml d'eau distillée traitée au DEPC à chaque tube et centrifuger les tubes à 13000 tpm pendant 5 minutes à 0-6 °C;

b) éliminer le surnageant de chaque échantillon, puis ajouter 800 μl de TRIzol (Invitrogen), ou d'un autre réactif dont l'efficacité est prouvée égale ou supérieure, à chaque échantillon et à un tube témoin contenant une substance de contrôle appropriée (400 μl d'eau distillée ou d'un homogénat de rein prélevé sur des poissons indemnes d'organismes pathogènes). Si nécessaire, dissocier les tissus pas des pipetages répétés. Laisser les tubes incuber à température ambiante pendant 5 minutes. Ajouter 160 μm de chloroforme à chaque tube et secouer énergiquement les tubes pendant 3 minutes, puis les centrifuger à 13000 tpm pendant 15 minutes à 0-6 °C;

c) éliminer la couche supérieure aqueuse et la transférer dans un microtube marqué de 1,5 ml contenant 500 μl d'isopropanol; laisser les tubes incuber pendant 10 minutes à température ambiante, puis les centrifuger à 6500 tpm pendant 15 minutes à 0-6 °C;

d) éliminer le surnageant et ajouter 1 ml d'éthanol à 75 % au culot d'ARN. Centrifuger les tubes à 6500 tpm pendant 5 minutes à 0-6 °C;

e) éliminer le surnageant et laisser les tubes ouverts pendant environ 3 minutes de manière à ce que l'éthanol résiduel s'évapore. Ajouter 15 μl d'eau distillée traitée au DEPC au culot remis en suspension, puis passer rapidement au vortex si nécessaire;

f) utiliser un spectrophotomètre pour calculer la concentration de l'ARN et la pureté des échantillons. Mesurer les densités optiques à 260 et 280 nm;

g) l'ARN, qui doit être utilisé immédiatement (le jour même), peut cependant être provisoirement stocké à 0-6 °C. L'ARN qui n'est pas utilisé immédiatement est stocké à - 80 °C.

IV.1.2. Transcription inverse (RT)

a) Diluer 2 μg d'ARN dans de l'eau distillée traitée au DEPC dans des microtubes de 1,5 ml. Lorsque la concentration d'un échantillon en ARN est trop faible pour pouvoir utiliser 2 μg dans la réaction RT, utiliser la plus grande quantité possible d'ARN. Laisser l'ARN dilué incuber à 55-60 °C pendant 10 minutes.

b) Placer les tubes contenant l'ARN dans de la glace et ajouter les réactifs pour la RT afin d'obtenir des concentrations finales de tampon 1 x, 1 mM de dNTP, 100 ng d'hexamères aléatoires, vingt unités d'inhibiteur de la RNase et deux cents unités de MMLV-RT dans un volume total de 20 μl.

c) Laisser les tubes incuber à 37 °C pendant une heure.

d) Stocker l'ADNc à 0-6 °C aussi longtemps que nécessaire et procéder à la PCR aussi rapidement que possible.

IV.1.3. PCR

a) Ajouter 5 μl de ADNc à 45 μl de mélange PCR pour obtenir des concentrations finales de tampon 1 x, 1,5 mM de MgCl2, 0,2 mM de chaque dNTP, 25 pmol de chaque amorce et une unité de Taq polymérase. Les amorces sont ISA+ (amorce sens) et ISA- (5'-GCC-AAG-TGT-AAG-TAG-CAC-TCC-3') (amorce antisens). Des contrôles négatifs en vue de l'extraction pour la RT et la PCR doivent être réalisés.

b) Placer les tubes dans un thermocycler programmé à 94 °C pendant 5 minutes, suivi de trente-cinq cycles à 94 °C pendant 1 minute, 55 °C pendant 1 minute et 72 °C pendant 1 minute avec une incubation finale à 72 °C pendant 5 minutes.

c) Évaluer les résultats de la PCR après électrophorèse au moyen d'un gel à 2 % d'agarose coloré au bromure d'éthidium et comprenant des marqueurs de taille parallèlement aux échantillons et incluant des contrôles négatifs pour les étapes RT et PCR. Un seul produit PCR de 155 pb est considéré comme une indication de la présence de l'ARN du virus de l'AIS. Les échantillons qui contiennent un produit supplémentaire de 310 pb sont également considérés comme contenant de l'ARN du virus de l'AIS. Les échantillons qui donnent de nombreux produits PCR, y compris au moins un produit d'environ 155 pb, peuvent contenir l'ARN du virus de l'AIS. Ils peuvent être soumis à un examen supplémentaire pratiqué avec des sondes ADN ou un séquençage.

IV.1.4. Confirmation par PCR du virus de l'AIS isolé sur culture tissulaire

Si un effet cytopathique (ECP) complet s'est produit au cours de l'examen virologique des échantillons de tissu dans les cellules SHK-1, retirer 400 μl de surnageant de la cupule et les mettre dans un tube stérile de 1,5 ml. Extraire l'ARN de cet échantillon comme décrit dans la partie III.1 et procéder au test RT-PCR. En cas d'utilisation de cultures dans lesquelles l'ECP n'est pas complet, éliminer le surnageant, récupérer les cellules par grattage de la surface de la cupule ou du flacon, les mettre dans un tube stérile de 1,5 ml pour en extraire l'ARN et procéder au test RT-PCR.

IV.1.5. Confirmation des produits de la PCR par sonde ADN

a) La spécificité d'un produit PCR de 155 pb peut être évaluée par sondage avec un oligonucléotide qui s'hybride dans une région du produit PCR excluant les régions des amorces. Les produits PCR sont soumis à une électrophorèse dans un gel à 1 % d'agarose, parallèlement à des marqueurs de taille et à un contrôle positif et un contrôle négatif pour les étapes RT et PCR.

b) Soumettre l'ADN à une réaction de Southern-blot sur une membrane et laisser incuber l'oligonucléotide marqué (5'- GGGAGTTGATCAGACATGCACTGA AGGTG-3') avec la membrane après les étapes de la préhybridation.

c) Éliminer par lavage de la membrane les sondes non fixées et fixées non spécifiquement et visualiser la sonde fixée.

d) La sonde fixée a un fragment de 155 pb (et de 310 pb si elle est présente) constitue une preuve de la spécificité des PCR et indique que l'ARN du virus de l'AIS était présent dans l'échantillon.

IV.1.6. Séquençage nucléotidique des produits PCR

La spécificité du produit PCR peut être évaluée par un examen de la séquence nucléotidique du produit PCR de 155 pb.

a) Purifier le produit PCR à partir du gel d'agarose ou de la solution;

b) le fragment est séquencé à l'aide des mêmes amorces que celles utilisées pour la réaction PCR, ou d'amorces spécifiques du vecteur si le fragment a été cloné dans un vecteur avant le séquençage;

c) comparer la séquence nucléotidique à celles du segment 8 du virus de l'AIS disponible dans la base de données de la séquence nucléotidique EMBR (numéros d'accès Y10404, AJ012285, AJ242016);

d) la présence d'une séquence correspondant à celle du segment 8 du virus de l'AIS est la preuve que l'échantillon contenait l'ARN du virus de l'AIS.

V. Examen des calques de rein par le test IFAT

V.1. Le protocole suivant a été établi pour l'examen des calques de rein par le test IFAT

V.2. Préparation et marquage des calques

V.2.1. Fixer des lames dans de l'acétone ou dans un mélange méthanol/acétone (1:1) pendant 3 minutes et les laisser sécher à l'air. Avant d'être colorée, chaque lame est examinée et les zones appropriées sont entourées à l'aide d'un crayon ImmEdgeTM, ou équivalent, et la lame est séchée à l'air. Placer ensuite les lames dans une solution de blocage (lait écrémé à 6 % dans du PBS contenant 0,2 % de Tween 20) et les laisser incuber en les agitant légèrement pendant 30 minutes à température ambiante. Égoutter chaque lame et la placer horizontalement dans une boîte à lames contenant du papier essuie-tout humide pour maintenir une atmosphère humide.

V.2.2. Couvrir chaque calque avec une solution d'anticorps monoclonal 3H6F8 au virus de l'AIS (ou un autre anticorps d'une spécificité et d'une efficacité prouvées), fermer la boîte et laisser incuber en agitant pendant 60 minutes à température ambiante. Normalement, l'anticorps est dilué entre 1:10 et 1:100 dans du lait écrémé à 1 %, mais la dilution réelle doit être déterminée pour chaque lot. Laver les lames trois fois pendant 2 minutes dans du PBS contenant 0,1 % de Tween 20. Couvrir chaque calque d'une solution contenant du conjugué de chèvre antisouris marqué FITC, dilué au 1:1000 dans du lait écrémé à 1 %, et laisser incuber dans une atmosphère humide pendant 60 minutes à température ambiante. Laver les lames trois fois pendant 2 minutes dans du PBS contenant 0,1 % de Tween 20. Couvrir chaque lame d'une solution de CitifluorTM [500 μl de CitifluorTM mélangé à 1,5 ml de Tween 20 à 0,1 % (v/v) dans du PBS] ou à un autre milieu de montage approprié pendant 10 minutes. Laver les lames trois fois dans du PBS contenant 0,1 % de Tween 20. Si un contre-marquage est nécessaire, couvrir chaque calque avec du iodure de propidium (0,01 mg/ml) dans du PBS contenant 0,1 % de Tween 20 et laisser incuber pendant 3 minutes à température ambiante. Laver les lames trois fois pendant 2 minutes dans du PBS contenant 0,1 % de Tween 20. Égoutter les lames et les monter dans du CitifluorTM ou dans un autre milieu de montage approprié. Les stocker dans l'obscurité à 4 °C avant de les examiner au microscope.

V.3. Examen au microscope à fluorescence

Examiner chaque lame avec un microscope convenant pour l'épifluorescence en utilisant un filtre approprié qui excitera le FITC, lui faisant émettre sa fluorescence verte caractéristique. Examiner tous les champs situés dans les zones définies au crayon ImmEdgeTM avec des objectifs x 10 et x 20; procéder à un nouvel examen des zones suspectes (celles qui présentent une fluorescence verte) avec un objectif x 40 et une illumination phase/fluorescence garantissant que la fluorescence est bien localisée dans la cellule. Enregistrer les coordonnées des zones suspectes pour une confirmation ultérieure de la nature de la fluorescence par un second examinateur. Après l'examen par le premier lecteur, les lames qui sont positives ou suspectes sont réexaminées par un second lecteur et les résultats sont confirmés.

V.4. Contrôles

V.4.1. Il faut prévoir trois types de contrôle pour chaque lot de lames colorées pour le test IFAT:

- calque de rein d'un saumon de l'Atlantique non affecté (contrôle négatif),

- culture cellulaire SHK-1 non affectée ou autre culture cellulaire sensible (contrôle négatif),

- culture cellulaire SHK-1 affectée par le virus de l'AIS ou autre culture cellulaire sensible (contrôle positif).

V.4.2. Si possible, un calque de rein d'un saumon de l'Atlantique affecté par le virus de l'AIS est recommandé à titre de contrôle positif supplémentaire.

V.4.3. Si des contrôles négatifs donnent un résultat positif, le test est considéré comme invalidé pour toutes les lames du lot. Si toutes les lames d'un lot, y compris les contrôles positifs, sont négatives, le test est considéré comme invalidé pour toutes les lames de ce lot. Lorsque l'échec des contrôles invalide un lot de lames, celles-ci sont détruites et un nouveau test est réalisé sur des duplicats des calques.

V.5. Examen d'autres tissus

Cette technique peut être appliquée à d'autres tissus de poissons tels que le foie, la rate et le coeur, à condition qu'une quantité suffisante de cellules endothéliales, de leucocytes et de lymphocytes puissent être déposée sur la lame. La procédure du marquage est la même pour tous les tissus, même s'il peut être préférable pour certains de renoncer au marquage par l'iodure de propidium et d'avoir recours à l'illumination en phase pour identifier les types de cellules présentes dans le calque.

VI. Histologie

Couper des échantillons inclus dans la paraffine à 5 μm et les colorer à l'aide d'hématoxyline et d'éosine. Les modifications histologiques liées à l'AIS sont décrites dans l'édition actuelle du Manuel pour le diagnostique des maladies des animaux aquatiques de l'OIE.

VII. Acronymes et abréviations

>TABLE>