Accept Refuse

EUR-Lex Access to European Union law

This document is an excerpt from the EUR-Lex website

Document 32015D1554

Décision d'exécution (UE) 2015/1554 de la Commission du 11 septembre 2015 portant modalités d'application de la directive 2006/88/CE en ce qui concerne les exigences relatives à la surveillance et aux méthodes de diagnostic [notifiée sous le numéro C(2015) 6188] (Texte présentant de l'intérêt pour l'EEE)

OJ L 247, 23.9.2015, p. 1–62 (BG, ES, CS, DA, DE, ET, EL, EN, FR, HR, IT, LV, LT, HU, MT, NL, PL, PT, RO, SK, SL, FI, SV)

In force

ELI: http://data.europa.eu/eli/dec_impl/2015/1554/oj

23.9.2015   

FR

Journal officiel de l'Union européenne

L 247/1


DÉCISION D'EXÉCUTION (UE) 2015/1554 DE LA COMMISSION

du 11 septembre 2015

portant modalités d'application de la directive 2006/88/CE en ce qui concerne les exigences relatives à la surveillance et aux méthodes de diagnostic

[notifiée sous le numéro C(2015) 6188]

(Texte présentant de l'intérêt pour l'EEE)

LA COMMISSION EUROPÉENNE,

vu le traité sur le fonctionnement de l'Union européenne,

vu la directive 2006/88/CE du Conseil du 24 octobre 2006 relative aux conditions de police sanitaire applicables aux animaux et aux produits d'aquaculture, et relative à la prévention de certaines maladies chez les animaux aquatiques et aux mesures de lutte contre ces maladies (1), et notamment son article 49, paragraphe 3, son article 50, paragraphe 4, son article 57, point b) et son article 61, paragraphe 3,

considérant ce qui suit:

(1)

La directive 2006/88/CE établit les mesures préventives minimales pour la surveillance et la détection précoce, chez les animaux aquatiques, des maladies énumérées à son annexe IV (ci-après les «maladies répertoriées»), ainsi que les mesures de lutte à mettre en œuvre en cas de présence suspectée ou avérée d'un foyer de ces maladies répertoriées. Elle définit également les exigences requises pour l'obtention du statut «indemne de maladie» par des États membres ou des zones ou compartiments de ceux-ci.

(2)

L'éradication des maladies répertoriées et l'obtention du statut «indemne de maladie» par un État membre, une zone ou un compartiment devraient reposer sur des principes et une démarche scientifique identiques dans toute l'Union. En conséquence, il est nécessaire de définir au niveau de l'Union des exigences spécifiques applicables aux programmes de surveillance et d'éradication, ainsi que les méthodes d'échantillonnage et de diagnostic à utiliser par les États membres pour obtenir le statut «indemne de maladie» à l'échelle de l'État membre ou d'une zone ou compartiment de celui-ci.

(3)

Les examens de laboratoire à effectuer en cas de suspicion d'une maladie répertoriée ou pour confirmer la présence d'une telle maladie devraient être identiques dans toute l'Union et respecter les mêmes normes et protocoles scientifiques. Conformément à la directive 2006/88/CE, il est nécessaire d'établir les méthodes et procédures de diagnostic spécifiques à utiliser par les laboratoires désignés à cet effet par l'autorité compétente de chaque État membre.

(4)

Le Code sanitaire pour les animaux aquatiques adopté par l'Organisation mondiale de la santé animale (OIE) (ci-après le «code aquatique») établit des normes pour l'amélioration de la santé des animaux aquatiques et le bien-être des poissons d'élevage dans le monde, y compris des normes de sécurité sanitaire applicables aux échanges internationaux d'animaux aquatiques et des produits qui en sont issus. Un certain nombre de chapitres du code aquatique énoncent des recommandations concernant l'utilisation de certains tests de diagnostic. Ces tests, proposés par l'OIE, sont décrits dans le Manuel des tests de diagnostic pour les animaux aquatiques de l'OIE (ci-après le «manuel aquatique»). Pour garantir la cohérence entre les normes internationales et les exigences de l'Union relatives aux méthodes de diagnostic des maladies des animaux aquatiques, il convient que les règles énoncées dans la présente décision tiennent compte des normes et recommandations figurant dans le code aquatique.

(5)

À cet égard, le manuel aquatique énumère, pour un grand nombre des maladies répertoriées, plusieurs tests et procédures à utiliser aux fins des examens de laboratoire. Afin d'uniformiser, à l'échelle de l'Union, la base scientifique utilisée pour le diagnostic des maladies répertoriées, il est nécessaire de désigner, parmi les tests et procédures de diagnostic recommandés par l'OIE, ceux qui devraient être obligatoires aux fins des examens de laboratoire à réaliser dans le cadre des programmes de surveillance ainsi que pour écarter une suspicion de maladie répertoriée ou confirmer la présence d'une telle maladie. Comme il sera également nécessaire, dans certains cas, de disposer de méthodes et de procédures de substitution, il convient que des descriptions et des explications scientifiques sur les conditions et les modalités d'application de ces méthodes de substitution soient fournies, surtout en ce qui concerne les procédures de diagnostic détaillées.

(6)

Aux fins de l'obtention de diagnostics précis et reproductibles, il importe que les procédures et protocoles détaillés à utiliser soient validés conformément aux normes de qualité pertinentes visées à l'annexe VI, partie I, de la directive 2006/88/CE. Dans un grand nombre des méthodes de diagnostic établies par la présente décision, l'utilisation de kits de diagnostic disponibles dans le commerce est une composante nécessaire des protocoles, et ces kits de diagnostic ont été validés lors d'essais menés dans le cadre de l'accréditation par les laboratoires de référence de l'Union pour les différentes maladies. Pour des raisons de sécurité juridique, la dénomination commerciale des kits de diagnostic qui ont été validés devrait être utilisée dans la présente décision.

(7)

Il se peut que certains États membres éprouvent des difficultés à obtenir, pour une ou plusieurs des maladies répertoriées, le statut «indemne de maladie» à l'échelle de l'État membre ou pour une zone ou un compartiment de celui-ci. En pareille situation, l'État membre peut souhaiter ne pas obtenir ou ne pas retrouver le statut «indemne» pour ces maladies répertoriées. Les mesures minimales de lutte à appliquer dans les cas où l'État membre concerné ne souhaite pas obtenir ou retrouver le statut «indemne» devraient être identiques dans toute l'Union et respecter les mêmes critères. Il est donc nécessaire, conformément à la directive 2006/88/CE, de fixer des modalités de confinement pour empêcher la propagation de ces maladies répertoriées, et de définir les conditions minimales requises pour la levée de ces mesures de confinement.

(8)

La décision 2001/183/CE de la Commission (2) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection et la confirmation de la nécrose hématopoïétique infectieuse et de la septicémie hémorragique virale, qui font partie des maladies répertoriées. La décision 2003/466/CE de la Commission (3) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection de l'anémie infectieuse du saumon, ainsi que les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de cette maladie. La décision 2002/878/CE de la Commission (4) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection et la confirmation de la bonamiose et de la marteiliose, qui sont des maladies des mollusques. Afin d'actualiser ces exigences, ces trois décisions devraient être remplacées par la présente décision. Les décisions 2001/183/CE, 2002/878/CE et 2003/466/CE devraient dès lors être abrogées.

(9)

Certains États membres ayant besoin de temps pour permettre à leurs laboratoires nationaux de référence de s'adapter afin de se conformer aux exigences de la présente décision, celle-ci devrait être applicable à partir du 1er avril 2016.

(10)

Les mesures prévues à la présente décision sont conformes à l'avis du comité permanent des végétaux, des animaux, des denrées alimentaires et des aliments pour animaux,

A ADOPTÉ LA PRÉSENTE DÉCISION:

Article premier

Objet

La présente décision établit des règles concernant:

a)

la surveillance, les zones tampons, les méthodes d'échantillonnage et de diagnostic à utiliser par les États membres en rapport avec leur statut sanitaire ou celui de zones ou compartiments de ceux-ci en ce qui concerne les maladies non exotiques des animaux aquatiques énumérées à l'annexe IV, partie II, de la directive 2006/88/CE (ci-après dénommées les «maladies répertoriées»);

b)

les méthodes de diagnostic à utiliser pour les examens de laboratoire en cas de suspicion ou de confirmation de la présence de maladies répertoriées et

c)

les mesures minimales de lutte à mettre en œuvre en cas de présence suspectée ou confirmée d'une maladie répertoriée dans un État membre, une zone ou un compartiment non déclarés indemnes de cette maladie.

Article 2

Définitions

Aux fins de la présente décision, on entend par:

a)

«septicémie hémorragique virale (SHV)», une maladie causée par le virus de la septicémie hémorragique virale (VSHV), également dénommé virus d'Egtved, qui appartient au genre Novirhabdovirus et à la famille des Rhabdoviridae;

b)

«nécrose hématopoïétique infectieuse (NHI)», une maladie causée par le virus de la nécrose hématopoïétique infectieuse (VNHI), qui appartient au genre Novirhabdovirus et à la famille des Rhabdoviridae;

c)

«herpèsvirose de la carpe koï (HVCK)», une maladie causée par l'herpèsvirus koï (HVK), qui appartient à la famille des Alloherpesviridae et dont le nom scientifique est «herpèsvirus cyprin 3» (CyHV-3);

d)

«anémie infectieuse du saumon (AIS)», une maladie causée par une infection par des variants délétés dans la région hautement polymorphe (RHP) du virus de l'AIS (VAIS), qui appartient au genre Isavirus et à la famille des Orthomyxoviridae;

e)

«infection à Marteilia refringens», une infection causée par le protozoaire Marteilia refringens, qui appartient au phylum des Paramyxea;

f)

«infection à Bonamia ostreae», une infection causée par le protozoaire Bonamia ostreae, qui appartient au phylum des Haplosporidia;

g)

«maladie des points blancs (MPB)», une maladie causée par le virus du syndrome des points blancs (VSPB), qui est un virus à ADN double brin qui appartient au genre Whispovirus et à la famille des Nimaviridae.

Article 3

Exigences minimales relatives aux programmes d'éradication et de surveillance

Les États membres veillent à ce que les règles relatives aux programmes de surveillance et d'éradication, aux zones tampons, aux méthodes d'échantillonnage et de diagnostic énoncées à l'annexe I, ainsi qu'aux méthodes spécifiques et aux procédures détaillées énoncées à l'annexe II soient respectées en cas d'octroi, de retrait ou de rétablissement, pour une ou plusieurs des maladies répertoriées, du statut «indemne de maladie» pour un État membre ou une zone ou compartiment de celui-ci.

Article 4

Exigences minimales relatives aux méthodes et aux procédures spécifiques de diagnostic

Les États membres veillent à ce que les méthodes de lutte figurant à l'annexe I, ainsi que les méthodes spécifiques et procédures détaillées de diagnostic énoncées à l'annexe II soient respectées lors des examens de laboratoire réalisés en vue de confirmer ou d'exclure la présence d'une maladie répertoriée.

Article 5

Mesures minimales de lutte contre les maladies répertoriées et exigences minimales pour la levée des mesures de confinement dans des État membres, des zones ou des compartiments non déclarés indemnes de maladies répertoriées

Les États membres veillent à ce que les mesures minimales de lutte et les exigences minimales pour la levée des mesures de confinement énoncées à l'annexe I soient respectées lors de la mise en œuvre de mesures de lutte et de la levée des mesures de confinement à l'égard d'une ou plusieurs maladies répertoriées dans un État membre ou dans une zone ou un compartiment non déclarés indemnes de ces maladies.

Article 6

Abrogations

Les décisions 2001/183/CE, 2002/878/CE et 2003/466/CE sont abrogées.

Article 7

Date de mise en application

La présente décision est applicable à partir du 1er avril 2016.

Article 8

Destinataires

Les États membres sont destinataires de la présente décision.

Fait à Bruxelles, le 11 septembre 2015.

Par la Commission

Vytenis ANDRIUKAITIS

Membre de la Commission


(1)  JO L 328 du 24.11.2006, p. 14.

(2)  Décision 2001/183/CE de la Commission du 22 février 2001 fixant les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de certaines maladies des poissons et abrogeant la décision 92/532/CEE (JO L 67 du 9.3.2001, p. 65).

(3)  Décision 2003/466/CE de la Commission du 13 juin 2003 établissant les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de l'anémie infectieuse du saumon (AIS) (JO L 156 du 25.6.2003, p. 61).

(4)  Décision 2002/878/CE de la Commission du 6 novembre 2002 établissant les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de la présence de deux maladies des mollusques, la bonamiose (Bonamia ostreae) et la marteiliose (Marteilia refringens) (JO L 305 du 7.11.2002, p. 57).


ANNEXE I

SURVEILLANCE ET MÉTHODES DE LUTTE

I.   Introduction

La présente annexe établit:

a)

les exigences relatives aux programmes d'éradication et de surveillance prévus à l'article 44 de la directive 2006/88/CE, ainsi que les méthodes d'échantillonnage et de diagnostic à utiliser pour déclarer «indemnes de maladie» des États membres ou des zones ou compartiments de ceux-ci, conformément aux dispositions du chapitre VII de ladite directive;

b)

les méthodes d'échantillonnage et de diagnostic à utiliser pour les examens de laboratoire en cas de suspicion d'une ou plusieurs des maladies non exotiques répertoriées à l'annexe IV, partie II, de la directive 2006/88/CE (ci-après les «maladies répertoriées») ou pour confirmer la présence de telles maladies, conformément à l'article 28, point a), et à l'article 57, point b), de ladite directive;

c)

les mesures de confinement à prendre en cas de confirmation de la présence d'une maladie répertoriée, conformément à l'article 39 de la directive 2006/88/CE, et les mesures à prendre en vue de l'obtention d'un statut sanitaire de catégorie III pour un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V.

Les exigences établies dans la présente annexe concernent les maladies répertoriées suivantes:

1.

la septicémie hémorragique virale (SHV)

Partie 1

2.

la nécrose hématopoïétique infectieuse (NHI)

Partie 1

3.

l'herpèsvirose de la carpe koï (HVCK)

Partie 2

4.

l'anémie infectieuse du saumon (AIS)

Partie 3

5.

l'infection à Marteilia refringens

Partie 4

6.

l'infection à Bonamia ostreae

Partie 5

7.

la maladie des points blancs (MPB)

Partie 6

II.   Définitions

Aux fins des annexes I et II, on entend par:

a)   «compartiment continental»: une ou plusieurs fermes aquacoles situées dans la partie continentale du territoire d'un ou de plusieurs États membres, qui relèvent d'un dispositif commun de biosécurité et abritent une population d'animaux aquatiques dotée d'un statut zoosanitaire qui lui est propre au regard d'une maladie particulière;

b)   «ferme aquacole continentale»: une ferme aquacole située dans la partie continentale du territoire d'un État membre;

c)   «zone continentale»: un secteur géographique précis situé dans la partie continentale du territoire d'un ou de plusieurs États membres, caractérisé par un système hydrographique homogène comprenant des parties de bassin hydrographique (depuis la ou les sources jusqu'à une barrière naturelle ou artificielle empêchant toute remontée d'animaux aquatiques à partir des parties du bassin situées en aval), un bassin hydrographique entier (depuis la ou les sources jusqu'à l'estuaire) ou encore plusieurs bassins hydrographiques, estuaires compris, en raison du lien épidémiologique qui existe entre les bassins hydrographiques au travers de l'estuaire;

d)   «ferme aquacole officiellement déclarée infectée»: une ferme aquacole dans laquelle la présence d'une ou de plusieurs des maladies répertoriées a été confirmée par l'autorité compétente, conformément à l'article 28, point a), à l'article 29 et à l'article 57, point b), de la directive 2006/88/CE.

e)   «ferme aquacole en contact»: une ferme aquacole qui, de toute évidence, a été contaminée par du matériel infectieux provenant d'une ferme aquacole officiellement déclarée infectée, ou qui est fortement suspectée d'avoir été ainsi contaminée.

PARTIE 1

SURVEILLANCE DE LA SEPTICÉMIE HÉMORRAGIQUE VIRALE (SHV) ET DE LA NÉCROSE HÉMATOPOÏÉTIQUE INFECTIEUSE (NHI) ET MÉTHODES DE LUTTE CONTRE CES MALADIES

I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la SHV et la NHI ainsi que des mesures de confinement destinées à lutter contre ces maladies répertoriées

I.1.   Exigences générales relatives aux inspections sanitaires et à l'échantillonnage en ce qui concerne la SHV et la NHI:

a)

les inspections sanitaires et, s'il y a lieu, l'échantillonnage doivent être effectués pendant la période de l'année où la température de l'eau est inférieure à 14 °C ou à tout moment, lorsque la température de l'eau est susceptible d'atteindre les minima annuels;

b)

lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent être représentatifs des différents écosystèmes abritant des populations sauvages des espèces sensibles;

c)

lorsque des fermes aquacoles ou des populations sauvages doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires ou d'échantillonnages, l'intervalle entre les inspections sanitaires et entre chaque prélèvement d'échantillons doit être d'au moins quatre mois et doit être aussi long que possible compte tenu des conditions de température définies au point a);

d)

toutes les unités de production, telles que les étangs, les viviers et les cages en filet doivent faire l'objet d'inspections sanitaires destinées à établir la présence de poissons morts, faibles ou au comportement anormal. Une attention particulière doit être accordée au point d'évacuation des eaux, où les poissons faibles ont tendance à s'accumuler en raison du courant;

e)

les poissons des espèces sensibles devant faire l'objet d'un échantillonnage sont sélectionnés comme suit:

i)

si des truites arc-en-ciel sont présentes, seuls des poissons de cette espèce doivent être sélectionnés pour l'échantillonnage, sauf dans les cas où d'autres espèces sensibles présentant des signes typiques de la SHV ou de la NHI sont présentes; en l'absence de truites arc-en-ciel, l'échantillon doit être représentatif de toutes les autres espèces sensibles présentes;

ii)

en présence de poissons faibles, au comportement anormal ou qui viennent de mourir mais ne sont pas encore décomposés, ces poissons doivent être sélectionnés; si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentant toutes les sources d'eau doivent être inclus dans l'échantillon;

iii)

les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les parties de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la SHV et la NHI

I.2.1.   Programmes de surveillance:

a)

un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III tel que visé à l'annexe III, partie B, de la directive 2006/88/CE en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir le statut sanitaire de catégorie I pour ces maladies répertoriées à condition que toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment respectent les exigences fixées à l'annexe V de ladite directive, et que toutes ces fermes aquacoles ainsi que, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de cette directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément à cette partie, aient fait l'objet d'un des programmes de surveillance suivants:

i)

modèle A — programme de surveillance sur deux ans:

Les fermes aquacoles ou les points de prélèvement doivent avoir été soumis à des inspections sanitaires et fait l'objet d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 1.A de la section II.

Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2. doivent s'être révélés négatifs pour la SHV ou la NHI, ou pour les deux, et toute suspicion de SHV ou de NHI doit avoir été écartée conformément aux méthodes d'échantillonnage et de diagnostic établies au point II.3;

ii)

modèle B — programme de surveillance sur quatre ans avec taille d'échantillon réduite

Les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de quatre années consécutives, comme indiqué dans le tableau 1.B de la section II.

Au cours de cette période de quatre ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour la SHV ou la NHI, ou pour les deux, et toute suspicion de SHV ou de NHI, ou des deux maladies, doit avoir été écartée conformément aux méthodes d'échantillonnage et de diagnostic établies au point II.3;

b)

si, au cours de la mise en œuvre du programme de surveillance visé au point a), une infection par la SHV ou la NHI, ou par les deux à la fois, est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre un programme d'éradication tel qu'établi au point I.2.2, à condition de satisfaire aux conditions suivantes:

i)

il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne la SHV ou la NHI, ou les deux, est indépendant du statut zoosanitaire des populations d'animaux aquatiques vivant dans les eaux naturelles avoisinantes par rapport à ces maladies répertoriées conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE;

ii)

elle a été vidée de ses poissons, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

iii)

elle a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux.

I.2.2.   Programmes d'éradication

I.2.2.1.   Exigences générales

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir un statut sanitaire de catégorie I pour ces maladies répertoriées à condition que toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment aient fait l'objet d'un programme d'éradication conforme aux points a) à e) suivants:

a)

les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE doivent avoir été effectivement appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, doit avoir été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par ces deux maladies répertoriées.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de la maladie répertoriée aux poissons d'élevage et aux poissons sauvages, à savoir la mortalité, le taux de mortalité et la distribution de la mortalité dans la ferme aquacole infectée par la SHV ou la NHI, ou par les deux à la fois, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par ces deux maladies répertoriées, et doit correspondre:

1.

dans les zones côtières: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par les deux, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées;

2.

à l'intérieur des terres: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par les deux à la fois; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique ou de la superficie occupée par la ferme aquacole à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de la SHV ou de la NHI, ou des deux à la fois;

ii)

l'autorité compétente met en place un périmètre de surveillance, qui s'étend au-delà du périmètre de protection et qui correspond:

1.

dans les zones côtières: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées

2.

à l'intérieur des terres: à une zone étendue qui se situe au-delà du périmètre de protection établi;

b)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par la SHV ou la NHI, ou par les deux, doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants:

i)

un prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par la SHV ou la NHI, ou par les deux, ou sur au moins 30 poissons en l'absence de signes cliniques ou de signes post mortem;

ii)

une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une par mois pendant la période durant laquelle la température de l'eau est inférieure à 14 °C, sauf lorsque les étangs ou les cages en filet sont couverts de glace, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);

c)

toutes les fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par les deux, doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'une durée minimale de six semaines doit être observée. Lorsque toutes les fermes aquacoles officiellement déclarées infectées à l'intérieur d'un même périmètre de protection ont été vidées de leurs poissons, un vide sanitaire synchronisé d'au moins trois semaines doit être respecté. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication.

Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. Pour ces fermes, la durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas;

d)

toutes les fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par ces deux maladies répertoriées, ainsi que toutes les autres fermes aquacoles soumises à un vide sanitaire situées à l'intérieur des périmètres de protection et de surveillance établis qui sont visées au point c), doivent être repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire «indemne de maladie» (catégorie I), en ce qui concerne la SHV ou la NHI, ou les deux.

Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été évacuées, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);

e)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1.

I.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole qui ont précédemment été déclarés indemnes de la NHI ou de la SHV, ou des deux, puissent retrouver le statut «indemne de maladie»

Un compartiment continental comprenant une seule ferme aquacole qui a précédemment été déclaré indemne de la SHV ou de la NHI, ou de ces deux maladies répertoriées, dont le statut sanitaire en ce qui concerne ces maladies répertoriées est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver le statut de catégorie I dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:

a)

la ferme aquacole dont l'infection par la SHV ou la NHI, ou par les deux, a été officiellement confirmée, doit avoir été vidée de ses poissons, nettoyée et désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines doit avoir été observée;

b)

la ferme aquacole dont l'infection par la NHI ou la SHV, ou par les deux, a été officiellement confirmée a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux.

I.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la SHV et la NHI, ou les deux

Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent être soumises à une inspection sanitaire et les poissons doivent faire l'objet d'un échantillonnage conformément au tableau 1.C figurant à la section II de la présente partie, compte tenu du risque de contamination de la ferme aquacole par la SHV ou la NHI, ou par ces deux maladies répertoriées.

Lors de la détermination de la fréquence des inspections sanitaires pour les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux, qui se trouvent dans des zones continentales et dont le statut sanitaire en ce qui concerne la SHV ou la NHI dépend de la situation sanitaire du statut zoosanitaire des populations d'animaux aquatiques dans les eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 2, de la directive 2006/88/CE, le risque de transmission de la SHV ou de la NHI, ou des deux, doit être considéré comme élevé.

Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2. se révèlent négatifs pour la SHV ou la NHI, ou pour ces deux maladies répertoriées, et tant que toute suspicion de SHV ou de NHI, ou des deux, est écartée conformément aux méthodes de diagnostic établies au point II.3.

I.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE, c'est-à-dire pour passer du statut sanitaire de catégorie V à celui de catégorie III

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir le statut sanitaire de catégorie III pour ces maladies répertoriées à condition que:

a)

les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles concernées doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du virus de la NHI ou du virus de la SHV, ou de ces deux agents, de l'environnement de la ferme aquacole;

b)

toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant été soumises à un vide sanitaire ou à d'autres mesures conformément au point a) à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne la SHV ou la NHI, ou les deux à la fois;

c)

le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a).

II.   Méthodes d'échantillonnage et de diagnostic

II.1.   Organes à prélever

Les tissus à examiner sont la rate, le rein antérieur et soit le cœur, soit l'encéphale. Lorsque l'échantillonnage est effectué sur des géniteurs, les ovaires ou le liquide séminal peuvent également être examinés.

S'il s'agit de jeunes alevins, les poissons entiers de longueur inférieure à 4 cm peuvent être réduits en petits fragments à l'aide de ciseaux stériles ou d'un scalpel après élimination de la partie du corps située à l'arrière de l'anus. Si un échantillon est constitué de poissons entiers de longueur comprise entre 4 et 6 cm, les viscères, y compris les reins, doivent être prélevés.

Il est possible de regrouper des fragments d'organes provenant de dix poissons au maximum.

II.2.   Méthodes de diagnostic pour obtenir et conserver le statut «indemne de maladie» en ce qui concerne la SHV ou la NHI, ou les deux

La méthode de diagnostic conforme aux méthodes et procédures de diagnostic approuvées indiquées à l'annexe II, partie 1, point I, pour obtenir ou conserver le statut «indemne de maladie» en ce qui concerne la SHV ou la NHI, ou les deux, est une des deux méthodes suivantes:

a)

isolement du virus en culture cellulaire, puis identification par méthode immuno-enzymatique (ELISA), test d'immunofluorescence indirecte (IFAT), test de neutralisation du virus ou amplification en chaîne par polymérase en présence d'une transcriptase inverse en temps réel (RT-qPCR) ou

b)

RT-qPCR.

II.3.   Méthodes d'échantillonnage et de diagnostic pour exclure ou confirmer la présence de la SHV ou de la NHI

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion de SHV ou de NHI, ou des deux à la fois, conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:

a)

la ferme aquacole suspecte doit faire l'objet d'au moins une inspection sanitaire et d'un échantillonnage portant sur dix poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par la SHV ou la NHI, ou par les deux, ou sur au moins 30 poissons en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés à l'aide d'une ou de plusieurs des méthodes de diagnostic indiquées aux points i) et ii), conformément aux méthodes de diagnostic et procédures détaillées figurant à l'annexe II, partie 1, section II, à savoir:

i)

isolement conventionnel du virus en culture cellulaire, suivi de son identification par méthode immunochimique ou moléculaire;

ii)

détection du virus par RT-qPCR;

iii)

autres techniques de diagnostic d'efficacité similaire avérée telles que le test d'immunofluorescence indirecte (IFAT), la méthode immunoenzymatique (ELISA), la RT-PCR et l'immunohistochimie (IHC);

b)

la présence de la SHV est considérée comme confirmée si au moins une de ces méthodes de diagnostic donne des résultats positifs pour le virus de la SHV (VSHV). La présence de la NHI est considérée comme confirmée si au moins une de ces méthodes de diagnostic donne des résultats positifs pour le virus de la NHI (VNHI). La confirmation du premier cas de SHV ou de NHI dans des États membres, des zones ou des compartiments précédemment non infectés doit être obtenue par isolement conventionnel du virus en culture cellulaire ou par RT-qPCR;

c)

une suspicion de SHV ou de NHI, ou des deux à la fois, peut être écartée si les résultats de la culture cellulaire ou de la RT-qPCR n'apportent pas d'élément supplémentaire prouvant la présence du virus de la SHV ou de la NHI, ou des deux.

Tableau 1.A

Programme de surveillance des zones et compartiments pour la période de deux ans visée au point I.2.1. a) i) qui précède l'obtention du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI

Type de ferme aquacole

Nombre d'inspections sanitaires par an (sur deux ans)

Nombre de prélèvements par an (sur deux ans)

Nombre de poissons par échantillon (1)

Nombre de poissons en développement

Nombre de géniteurs (2)

a)

Fermes aquacoles détenant des géniteurs

2

2

50 (première inspection)

75 (deuxième inspection)

30 (première ou deuxième inspection)

0 (première ou deuxième inspection)

b)

Fermes aquacoles détenant exclusivement des géniteurs

2

1

0

75 (première ou deuxième inspection)

c)

Fermes aquacoles ne détenant pas de géniteurs

2

2

75 (3) (première et deuxième inspections)

0

Nombre maximal de poissons par regroupement: 10


Tableau 1.B

Programme de surveillance avec taille d'échantillon réduite pour la période de quatre ans visée au point I.2.1. a) ii) qui précède l'obtention du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI

Type de ferme aquacole

Nombre d'inspections sanitaires par an

Nombre de prélèvements par an

Nombre de poissons par échantillon (4)

Nombre de poissons en développement

Nombre de géniteurs (5)

Deux premières années de la période de surveillance

a)

Fermes aquacoles détenant des géniteurs

2

1

0 (première inspection)

30 (deuxième inspection)

0 (première inspection)

0 (deuxième inspection)

b)

Fermes aquacoles détenant exclusivement des géniteurs

2

1

0

30 (première ou deuxième inspection)

c)

Fermes aquacoles ne détenant pas de géniteurs

2

1

30 (6) (première ou deuxième inspection)

0

Deux dernières années de la période de surveillance

a)

Fermes aquacoles détenant des géniteurs

2

2

30 (première inspection)

0 (deuxième inspection)

0 (première inspection)

30 (deuxième inspection)

b)

Fermes aquacoles détenant exclusivement des géniteurs

2

2

 

30 (première et deuxième inspections)

c)

Fermes aquacoles ne détenant pas de géniteurs

2

2

30 (6) (première et deuxième inspections)

 

Nombre maximal de poissons par regroupement: 10


Tableau 1.C

Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI visé au point I.3

Niveau de risque

Nombre d'inspections sanitaires

Nombre de poissons par échantillon (9)

Élevé

Deux par an

30 (7)  (8)

Moyen

Une par an

30 (7)

Faible

Une tous les deux ans

30 (7)

Nombre maximal de poissons par regroupement: 10

PARTIE 2

SURVEILLANCE DE L'HERPÈSVIROSE DE LA CARPE KOÏ (HVCK) ET MÉTHODES DE LUTTE CONTRE CETTE MALADIE

I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'HVCK ainsi que des mesures de confinement destinées à lutter contre l'infection par l'herpèsvirus koï (HVK)

I.1.   Exigences générales

Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant les populations sauvages sensibles, à savoir les cours d'eau et les lacs.

La surveillance ciblée doit reposer sur un suivi régulier des sites détenant des espèces sensibles. Les sites doivent être contrôlés lorsque la température de l'eau a atteint des niveaux propices au développement de la maladie (> 15 °C) et au plus tôt deux semaines après que ces températures ont été atteintes. Tous les poissons malades ou présentant un comportement anormal qui sont observés sur le site doivent faire l'objet d'un échantillonnage et être testés.

Dans la mesure du possible, les poissons qui ont été maintenus longtemps à des températures propices au développement du virus, c'est-à-dire entre 15 et 26 °C pendant deux à trois semaines, doivent faire l'objet d'un échantillonnage. L'approche décrite ci-après est toutefois acceptable:

a)

recueillir une sous-population au moment du transfert des étangs d'hiver aux étangs d'été et maintenir les poissons dans la même eau que celle des étangs d'été jusqu'à obtention de la température minimale requise, ou

b)

prélever les échantillons au moment de la capture ou lors d'autres manipulations des poissons faisant partie des pratiques de gestion normales. Dans la mesure du possible, les échantillons doivent être prélevés entre 24 et 72 heures après ces pratiques de gestion afin d'augmenter les chances de détection de l'herpèsvirus koï.

Lorsque des fermes aquacoles ou des populations sauvages doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires ou d'échantillonnages, l'intervalle entre les inspections sanitaires ou entre chaque prélèvement d'échantillons doit être aussi long que possible pendant la saison où la température de l'eau est susceptible d'atteindre les maxima annuels sans pour autant dépasser la limite de 28 °C.

Toutes les unités de production, telles que les étangs et les viviers, doivent faire l'objet d'inspections sanitaires destinées à établir la présence de poissons morts, faibles ou au comportement anormal.

Les poissons de l'espèce Cyprinus carpio et ses hybrides, tels que Cyprinus carpio × Carassius auratus, doivent être prélevés lorsqu'ils sont présents dans la ferme aquacole.

Les poissons à inclure dans les échantillons sont sélectionnés comme suit:

i)

en présence de poissons faibles, au comportement anormal ou qui viennent de mourir, mais ne sont pas encore décomposés, ces poissons doivent être sélectionnés;

ii)

si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentatifs de toutes les sources d'eau doivent être inclus dans l'échantillon;

iii)

les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les parties de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'HVCK

I.2.1.   Programmes de surveillance

a)

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'HVCK peut obtenir un statut sanitaire de catégorie I lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment respectent les conditions requises pour l'obtention du statut «indemne de maladie» qui sont définies à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de la partie I, point 2, paragraphe 2, de ladite annexe le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément à cette partie, ont fait l'objet de l'un des programmes de surveillance suivants:

i)

modèle A — programme de surveillance sur deux ans

les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 2.A de la section III.

Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour l'HVK et toute suspicion d'HVCK doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point III.2;

ii)

modèle B — programme de surveillance sur quatre ans avec taille d'échantillon réduite

Les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de quatre années consécutives, comme indiqué dans le tableau 2.B de la section III.

Au cours de cette période de quatre ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour l'HVK et toute suspicion d'HVCK doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point III.2;

b)

si, au cours de la mise en œuvre du programme de surveillance de quatre ans visé au point a), une infection par l'HVK est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre le programme d'éradication décrit au point I.2.2, à condition de satisfaire aux conditions suivantes:

i)

il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne l'HVCK est indépendant du statut zoosanitaire des populations d'animaux aquatiques dans les eaux naturelles avoisinantes pour cette maladie répertoriée, conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE;

ii)

elle a été vidée de ses poissons, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

iii)

elle a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I en ce qui concerne l'HVCK.

I.2.2.   Programmes d'éradication

I.2.2.1.   Exigences générales

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'HVCK peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme d'éradication suivant:

a)

les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE ont effectivement été appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par l'HVK.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de l'HVCK aux poissons d'élevage et aux poissons sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des poissons dans la ferme aquacole infectée par l'HVK; la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par l'HVK et doit correspondre à la totalité du bassin hydrographique de ladite ferme aquacole; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de l'HVCK;

ii)

un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre à une zone étendue située autour du périmètre de protection établi;

b)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par l'HVK doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants:

i)

le prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec l'HVCK, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem;

ii)

une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point III.2 ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois pendant la saison durant laquelle la température de l'eau est susceptible de dépasser 15 °C, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);

c)

toutes les fermes aquacoles officiellement déclarées infectées par l'HVK doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'une durée d'au moins six semaines doit être observée; lorsque toutes les fermes aquacoles officiellement déclarées infectées à l'intérieur d'un même périmètre de protection ont été vidées de leurs poissons, un vide sanitaire synchronisé d'au moins trois semaines doit être respecté. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication.

Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas.

d)

Toutes les fermes aquacoles officiellement déclarées infectées par l'HVK et toutes les autres fermes aquacoles soumises à un vide sanitaire qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées:

i)

avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'HVCK ou

ii)

transitoirement jusqu'au 31 décembre 2020, avec des poissons provenant d'États membres, de zones ou de compartiments faisant l'objet d'un programme de surveillance de l'HVCK approuvé.

Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);

e)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent avoir ensuite été soumis au moins au programme de surveillance décrit au point I.2.1.

I.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole ayant précédemment été déclarés indemnes de l'HVCK puissent retrouver le statut «indemne de maladie»

Un compartiment continental comprenant une seule ferme aquacole jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'HVCK, dont le statut sanitaire à l'égard de cette maladie est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver le statut de catégorie I pour l'HVCK dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:

a)

il a été vidé de ses poissons, nettoyé, désinfecté et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

b)

il a été repeuplé avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I ou de compartiments faisant l'objet d'un programme de surveillance de l'HVCK approuvé (statut sanitaire de catégorie II).

I.3.   Exigences spécifiques pour le maintien du statut sanitaire de catégorie I en ce qui concerne l'HVCK

Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 2.B figurant à la section III de la présente partie, compte tenu du risque de contamination de la ferme aquacole par l'HVK.

Dans les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne l'HVCK qui se trouvent dans des zones continentales et comprennent une ou plusieurs fermes aquacoles dont le statut sanitaire en ce qui concerne l'HVCK dépend de celui des eaux naturelles avoisinantes à l'égard de cette maladie répertoriée conformément à l'annexe V, partie II, point 2, de la directive 2006/88/CE, la fréquence des inspections sanitaires doit correspondre au nombre indiqué dans le tableau 2.C pour le niveau de risque élevé.

Dans les États membres, les zones ou les compartiments qui comptent un nombre limité de fermes aquacoles dont la surveillance ciblée ne permet pas d'obtenir suffisamment de données épidémiologiques, les programmes de surveillance nécessaires pour maintenir le statut «indemne de maladie» doivent inclure des points de prélèvement sélectionnés conformément aux exigences fixées au point I.1.

50 % de ces points de prélèvement doivent faire l'objet d'inspections et de prélèvements chaque année, par rotation. L'échantillonnage doit être réalisé conformément au tableau 2.C de la section III. Les échantillons doivent être sélectionnés, préparés et examinés comme indiqué à la section II et les résultats des examens de laboratoire doivent être négatifs en ce qui concerne la présence de l'agent de l'HVCK.

Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour l'HVCK, et toute suspicion d'HVCK doit être écartée conformément aux méthodes de diagnostic établies au point III.2.

I.4.   Exigences spécifiques pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE pour l'obtention du statut sanitaire de catégorie III en ce qui concerne l'HVCK dans des États membres, des zones ou des compartiments ayant un statut sanitaire de catégorie V

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'HVCK peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:

a)

Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles concernées doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de l'HVK de l'environnement de la ferme aquacole;

b)

toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant été soumises à un vide sanitaire ou à d'autres mesures conformément au point a) qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'HVCK;

c)

le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a).

II.   Méthodes de diagnostic et d'échantillonnage pour la surveillance visant à l'obtention et au maintien du statut «indemne de maladie» en ce qui concerne l'HVCK

II.1.   Échantillons

Les tissus à examiner sont prélevés sur les branchies et les reins. Il est possible de regrouper des fragments d'organes provenant de deux poissons au maximum.

II.2.   Méthodes de diagnostic pour la surveillance visant à l'obtention et au maintien du statut «indemne de maladie» en ce qui concerne l'HVCK

La méthode de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'HVCK est l'amplification en chaîne par polymérase en temps réel (qPCR), conformément aux méthodes et procédures de diagnostic détaillées qui figurent à l'annexe II, partie 2, point II.

III.   Méthodes de diagnostic et d'échantillonnage pour les enquêtes officielles destinées à confirmer ou à écarter une suspicion d'HVCK

III.1.   Échantillons

Les tissus à examiner sont prélevés sur les branchies et les reins. Il est possible de regrouper des fragments d'organes provenant de deux poissons au maximum.

III.2.   Méthodes d'enquête officielle et de diagnostic pour exclure ou confirmer la présence d'une infection par l'HVK

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'HVCK conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:

a)

l'enquête officielle doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par l'HVK, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés à l'aide de la méthode de diagnostic indiquée au point b) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 2, point II;

b)

la présence de l'infection par l'HVK doit être considérée comme confirmée si l'HVK est détecté par PCR;

une suspicion d'HVCK peut être écartée si les résultats de cet essai n'apportent aucun élément supplémentaire prouvant la présence de l'HVK.

Tableau 2.A

Programme de surveillance des zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'HVCK visée au point I.2.1

 

 

Nombre d'inspections cliniques par an (sur deux ans)

Nombre d'examens de laboratoire par an (sur deux ans)

Nombre de poissons par échantillon

Fermes aquacoles/sites de prélèvement

Deux premières années de la période de surveillance

2

2

75 (10)

 

Nombre maximal de poissons par regroupement: 2


Tableau 2.B

Programme de surveillance des zones et compartiments pour la période de quatre ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'HVCK visée au point I.2.1

 

 

Nombre d'inspections cliniques par an

Nombre d'examens de laboratoire par an

Nombre de poissons par échantillon

Fermes aquacoles/sites de prélèvement

Deux premières années de la période de surveillance

1

1

30

Fermes aquacoles/sites de prélèvement

Deux dernières années de la période de surveillance

2

2

30

 

Nombre maximal de poissons par regroupement: 2


Tableau 2.C

Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'HVCK visé au point I.3

Niveau de risque

Nombre d'inspections sanitaires

Nombre de poissons par échantillon

Élevé

Deux par an

30

Moyen

Une par an

30

Faible

Une tous les deux ans

30

Nombre maximal de poissons par regroupement: 2


Tableau 2.D

Programme de surveillance en vue du maintien du statut «indemne de maladie» en ce qui concerne l'HVCK dans des États membres, zones ou compartiments comptant un nombre limité de fermes aquacoles dont la surveillance ciblée ne permet pas d'obtenir suffisamment de données épidémiologiques visé au point I.3

 

Nombre d'inspections cliniques par an

Nombre d'examens de laboratoire par an

Nombre de poissons par échantillon

Points de prélèvement

Une tous les deux ans

Un tous les deux ans

30

Nombre maximal de poissons par regroupement: 2

PARTIE 3

SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'ANÉMIE INFECTIEUSE DU SAUMON (AIS)

I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'AIS ainsi que des mesures de confinement destinées à lutter contre l'infection par des variants délétés dans la région hautement polymorphe (RHP) du virus de l'AIS (VAIS)

I.1.   Exigences générales

Lorsque des fermes aquacoles doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires et d'échantillonnages conformément aux dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, l'intervalle entre les inspections sanitaires ou entre chaque prélèvement d'échantillons doit être aussi long que possible.

Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant des populations sauvages sensibles.

Des inspections sanitaires doivent être effectuées dans toutes les unités de production, telles que les étangs, les viviers et les cages en filet en vue d'établir la présence de poissons morts, faibles ou au comportement anormal. Une attention particulière doit être accordée au point d'évacuation des eaux, où les poissons faibles ont tendance à s'accumuler en raison du courant.

Les poissons à inclure dans les échantillons sont sélectionnés comme suit:

a)

seuls les poissons moribonds ou qui viennent de mourir et ne sont pas encore décomposés doivent être sélectionnés; en particulier, les poissons présentant une anémie, des saignements ou d'autres signes cliniques évoquant des troubles circulatoires doivent être prélevés en priorité;

b)

si le saumon de l'Atlantique fait partie des espèces sensibles présentes sur le site, des échantillons de saumon de l'Atlantique doivent être prélevés en priorité. En l'absence de saumon de l'Atlantique dans la ferme piscicole, d'autres espèces sensibles doivent faire l'objet d'un échantillonnage;

c)

si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentatifs de toutes les sources d'eau doivent être inclus dans l'échantillon.

d)

les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les unités de production, telles que les cages en filet, les viviers et les étangs, de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne l'AIS

I.2.1.   Programmes de surveillance

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III tel que visé à l'annexe III, partie B, de la directive 2006/88/CE en ce qui concerne l'AIS peut obtenir le statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment satisfont aux exigences définies à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe de cette directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément audit point, ont fait l'objet du programme de surveillance suivant:

a)

les fermes aquacoles ou les points de prélèvement ont fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 3.A de la section II;

b)

au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour les variants délétés dans la RHP du VAIS et toute suspicion d'AIS doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3.

c)

Si, au cours de la mise en œuvre du programme de surveillance, l'AIS est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, un programme d'éradication doit avoir été mis en œuvre conformément au point I.2.2.

I.2.2.   Programmes d'éradication

I.2.2.1.   Exigences générales

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'ISA peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet d'un programme d'éradication conforme aux points a) à e) suivants:

a)

les mesures minimales de lutte prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS, ou dans lesquelles la présence de l'AIS a été confirmée.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de transmission de l'AIS aux poissons d'élevage et aux poissons sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des poissons dans la ferme aquacole infectée par des variants délétés dans la RHP du VAIS ou dans laquelle la présence de l'AIS a été confirmée, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par l'AIS, et doit correspondre:

1.

dans les zones côtières: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par l'AIS, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées;

2.

à l'intérieur des terres: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par l'AIS; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de l'AIS;

ii)

un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre:

1.

dans les zones côtières: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées ou

2.

à l'intérieur des terres: à une zone étendue située au-delà du périmètre de protection établi;

b)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par l'AIS doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants:

i)

un prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons moribonds en cas de signes cliniques ou de signes post-mortem compatibles avec l'AIS, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem;

ii)

une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);

c)

toutes les fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS ou dans lesquelles la présence de l'AIS a été confirmée doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'au moins trois mois doit être observée. Les périmètres de protection et de surveillance peuvent être levés lorsque toutes les fermes aquacoles situées à l'intérieur du périmètre de protection ont été vidées de leurs poissons, nettoyées et désinfectées et qu'une période de vide sanitaire synchronisé d'au moins six semaines a été respectée.

Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. Pour ces fermes, la durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas;

d)

toutes les fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS ou dans lesquelles la présence de l'AIS a été confirmée et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire situées à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'ISA.

Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);

e)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1.

I.2.2.2.   Exigences à respecter pour retrouver le statut «indemne de maladie» dans le cas des compartiments continentaux comptant une seule ferme aquacole ayant précédemment bénéficié du statut sanitaire de catégorie I

Un compartiment continental comptant une seule ferme aquacole jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'AIS, dont le statut sanitaire est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver ce statut dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:

a)

il a été vidé de ses poissons, nettoyé, désinfecté et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

b)

il a été repeuplé avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'AIS.

I.3.   Exigences minimales pour le maintien du statut sanitaire de catégorie I en ce qui concerne l'AIS

Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 3.B (11) figurant à la section II de la présente partie, compte tenu du risque de propagation de l'AIS à la ferme aquacole.

Lors de la détermination de la fréquence des inspections sanitaires dans les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne l'AIS qui se trouvent dans des zones continentales et dont le statut sanitaire en ce qui concerne l'AIS dépend du statut sanitaire des eaux naturelles avoisinantes abritant le saumon de l'Atlantique (Salmo salar), le risque de transmission de l'AIS doit être considéré comme élevé.

Le statut «indemne de maladie» en ce qui concerne l'AIS ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour les variants délétés dans la RHP du VAIS, et que toute suspicion d'AIS a été écartée conformément aux méthodes de diagnostic établies au point II.3.

I.4.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie III en ce qui concerne l'infection par des variants délétés dans la RHP du VAIS dans des États membres, des zones ou des compartiments ayant un statut sanitaire de catégorie V

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'AIS peut obtenir le statut sanitaire de catégorie III à condition que:

a)

Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du VAIS de l'environnement de la ferme aquacole;

b)

toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) qui sont situées à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'AIS;

c)

le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a);

d)

aucune infection par des variants délétés dans la RHP du VAIS n'ait pas été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion durant cette période ait été écartée conformément aux procédures établies au point II.3.

II.   Méthodes de diagnostic et enquêtes officielles

II.1.   Échantillons

Les tissus à examiner sont:

a)

histologie: rein antérieur, foie, cœur, pancréas, intestins, rate et branchies;

b)

immunohistochimie: rein médian et cœur, y compris les valves et le bulbe artériel;

c)

analyse par RT-qPCR: rein médian et cœur;

d)

culture du virus: rein médian, cœur, foie et rate.

Il est possible de regrouper des fragments d'organes provenant de cinq poissons au maximum.

II.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'AIS

La méthode de diagnostic à utiliser en vue de l'obtention ou du maintien du statut «indemne de maladie» en ce qui concerne l'AIS conformément aux points I.2 et I.3 est l'analyse par RT-qPCR suivie du séquençage des échantillons positifs conformément aux méthodes et procédures détaillées décrites à l'annexe II, partie 3.

En cas de résultat positif à l'issue de l'analyse par RT-qPCR, d'autres échantillons doivent être testés avant la mise en œuvre des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE.

Ces échantillons doivent être testés comme suit, conformément aux méthodes et procédures détaillées décrites à l'annexe II, partie 3:

a)

examen des échantillons par RT-qPCR puis séquençage du gène HE pour vérifier les délétions dans la RHP

et

b)

examen sur préparations tissulaires à l'aide d'anticorps spécifiques dirigés contre le virus de l'AIS (à savoir IHC sur coupes fixées ou test IFAT sur empreintes tissulaires); ou

c)

isolement et identification du virus de l'AIS dans une culture de cellules provenant d'au moins un échantillon prélevé sur n'importe quel poisson issu de la ferme aquacole.

II.3.   Méthodes d'enquête officielle et de diagnostic pour exclure ou confirmer la présence de l'AIS

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'AIS conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:

a)

l'enquête officielle, qui doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 poissons moribonds en cas de signes cliniques ou de signes post mortem compatibles avec l'AIS. En l'absence de signe clinique ou post mortem compatible avec l'AIS, l'inspection sanitaire doit être suivie d'un échantillonnage ciblé sur au moins 30 poissons moribonds ou morts depuis peu mais de constitution normale conformément au point I.1. Les échantillons doivent être testés conformément aux méthodes de diagnostic établies indiquées au point b);

b)

en cas de résultat positif pour les variants délétés dans la RHP du VAIS à l'issue de l'analyse par RT-qPCR, d'autres échantillons doivent être testés avant la mise en œuvre des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE. Les suspicions d'infection par le VAIS doivent être confirmées conformément aux critères ci-après, suivant les méthodes et procédures détaillées décrites à l'annexe II, partie 3:

i)

détection du VAIS par RT-qPCR avec séquençage du gène HE pour vérifier les délétions dans la RHP, et détection du VAIS dans des préparations tissulaires à l'aide d'anticorps spécifiques dirigés contre le VAIS (à savoir IHC sur coupes fixées ou test IFAT sur empreintes tissulaires)

ou

ii)

détection du VAIS par RT-qPCR avec séquençage du gène HE pour vérifier les délétions dans la RHP, et

isolement et identification du VAIS dans une culture de cellules provenant d'au moins un échantillon prélevé sur n'importe quel poisson issu de la ferme aquacole;

c)

lorsque des modifications cliniques, macropathologiques ou histopathologiques compatibles avec l'AIS sont constatées, ces constatations doivent être corroborées par la détection du virus par deux méthodes de diagnostic reposant sur des principes de détection distincts, telles que la RT-qPCR et l'IHC, conformément à l'annexe II, partie 3.

Une suspicion d'AIS peut être écartée lorsqu'il est établi, à l'issue des tests et inspections réalisés sur une période de 12 mois à partir de la date à laquelle est née la suspicion, qu'aucun élément supplémentaire ne prouve la présence de l'AIS.

Tableau 3.A

Programme de surveillance des zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'AIS visée au point I.2.1.

Année de surveillance

Nombre d'inspections sanitaires par an (sur deux ans)

Nombre d'examens de laboratoire par an (sur deux ans)

Nombre de poissons à échantillonner par an

Année 1

6

2 (12)

2 * 75 (13)

Année 2

6

2 (12)

2 * 75 (13)


Tableau 3.B

Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'AIS visé au point I.3  (15)

Niveau de risque

Nombre d'inspections sanitaires par an

Nombre d'examens de laboratoire par an

Nombre de poissons à échantillonner par an

Élevé

2

2 (14)

2 × 30

Moyen

1

1 (14)

30

Faible

Une tous les deux ans

Un tous les deux ans

30 tous les deux ans

PARTIE 4

SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'INFECTION À MARTEILIA REFRINGENS

I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens

I.1.   Exigences générales

Des inspections sanitaires et, le cas échéant, le prélèvement d'échantillons en vue d'examens de laboratoire doivent être réalisés pendant la période de l'année où l'on sait que la prévalence du parasite est maximale dans l'État membre, la zone ou le compartiment. Si cette information n'est pas disponible, l'échantillonnage doit être réalisé juste après que la température de l'eau a dépassé 17 °C.

Si les mollusques doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la partie 4, les critères suivants doivent être respectés:

a)

si des mollusques des genres Ostrea spp.et Mytilus spp. sont présents dans les unités de production ou l'aire de production, ces deux genres doivent être représentés équitablement dans les échantillons. Si un seul de ces genres est présent, ce genre doit être inclus dans les échantillons. Si ni le genre Ostrea ni le genre Mytilus ne sont présents, les échantillons doivent être représentatifs de toutes les autres espèces sensibles présentes;

b)

en présence, dans les unités de production, de mollusques faibles, bâillants ou qui viennent de mourir mais ne sont pas encore décomposés, ces animaux doivent être sélectionnés en priorité. En l'absence de tels mollusques, les animaux sains les plus âgés doivent être sélectionnés;

c)

lorsque les prélèvements sont réalisés dans des fermes conchylicoles qui utilisent plusieurs sources d'eau pour la production des mollusques, des animaux représentant toutes les sources d'eau doivent être inclus dans les échantillons, de sorte que toutes les parties de la ferme y soient proportionnellement représentées;

d)

lorsque les prélèvements sont réalisés dans des parcs à mollusques, des mollusques provenant d'un nombre suffisant de points d'échantillonnage doivent être inclus dans les échantillons de sorte que toutes les parties du parc à mollusques y soient représentées proportionnellement. Les principaux facteurs à prendre en compte pour la sélection de ces points de prélèvements sont les anciens points de prélèvement où Marteilia refringens a été détecté, la densité d'élevage, les courants, la présence d'espèces sensibles, la présence d'espèces vectrices, la bathymétrie et les pratiques de gestion. L'échantillonnage doit également porter sur les bancs naturels.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne Marteilia refringens

I.2.1.   Programmes de surveillance

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'infection à Marteilia refringens peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet au moins du programme de surveillance ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue de tests:

Programme de surveillance de deux ans:

a)

les fermes aquacoles ou les parcs à mollusques doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 4.A de la section II;

b)

au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour Marteilia refringens et toute suspicion d'infection par Marteilia refringens doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3;

c)

lorsque des mollusques des espèces Ostrea edulis, Mytilus edulis ou Mytilus galloprovincialis provenant d'un État membre, d'une zone ou d'un compartiment jouissant d'un statut sanitaire de catégorie I doivent être inclus dans les échantillons, ils doivent avoir été introduits dans la ferme aquacole ou dans le parc à mollusques au moins au printemps précédant immédiatement la période d'exécution du programme de surveillance.

I.2.2.   Programmes d'éradication

L'éradication de Marteilia refringens est considérée comme impossible dans la plupart des cas, mais lorsque l'État membre l'estime faisable, le modèle de programme d'éradication ci-après doit être appliqué.

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Marteilia refringens peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet du programme d'éradication suivant au moins:

a)

les mesures prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles ou du ou des parcs à mollusques officiellement déclarés infectés par Marteilia refringens.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de Marteilia refringens, à savoir: le nombre, l'âge, le taux de mortalité et la distribution de la mortalité des mollusques dans la ferme aquacole ou le parc à mollusques infecté par Marteilia refringens, y compris chez les mollusques sauvages, la distance à laquelle se trouvent les fermes aquacoles ou parcs à mollusques voisins et la densité de ceux-ci, y compris les mollusques sauvages, la proximité des établissements de transformation et des fermes aquacoles ou parcs à mollusques en contact, les espèces, en particulier les espèces sensibles et les espèces vectrices, présentes dans les fermes aquacoles ou les parcs à mollusques, les pratiques d'élevage appliquées dans les fermes aquacoles et les parcs à mollusques contaminés et voisins; les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole ou d'un parc à mollusque officiellement déclaré infecté par Marteilia refringens et doit correspondre à une zone déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;

ii)

un périmètre de surveillance doit être établi au-delà du périmètre de protection, et doit correspondre à une zone située autour du périmètre de protection, déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;

b)

l'ensemble des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE situés à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarés infectés par Marteilia refringens doit faire l'objet d'une enquête officielle comprenant au moins un prélèvement d'échantillons visant à tester 150 mollusques, réalisé après le début de la période de transmission de Marteilia refringens. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer après que la température de l'eau a dépassé 17 °C;

c)

toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés par Marteilia refringens sont vidés de leurs mollusques, font l'objet d'un vide sanitaire et sont si possible nettoyés et désinfectés.

La durée de la période de vide sanitaire doit être d'au moins:

i)

deux mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens limités avec les eaux avoisinantes telles que celles des écloseries et des nurseries;

ii)

deux mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens illimités avec les eaux avoisinantes, à condition que les mollusques infectés des espèces sensibles et les mollusques des espèces sensibles ayant des liens épidémiologiques avec la ferme aquacole ou le parc à mollusques infectés aient été récoltés ou retirés avant la période de l'année où l'on sait que la prévalence de Marteilia refringens est maximale ou, si cette information n'est pas connue, avant la période où la température de l'eau dépasse 17 °C;

iii)

quatorze mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens illimités avec les eaux avoisinantes, à condition que les mollusques infectés des espèces sensibles et les mollusques des espèces sensibles ayant des liens épidémiologiques avec la ferme aquacole ou le parc à mollusques infectés n'aient pas été récoltés ou retirés avant la période de l'année où l'on sait que la prévalence de Marteilia refringens est maximale ou, si cette information n'est pas connue, lorsque les mollusques des espèces sensibles n'ont pas été récoltés ou éliminés avant la période où la température de l'eau dépasse 17 °C.

Lorsque toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés sont vidés de leurs mollusques, un vide sanitaire synchronisé d'au moins quatre semaines doit être mis en place.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis soient vidés de leurs mollusques, nettoyés, désinfectés et qu'ils fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;

d)

la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques ayant fait l'objet d'un vide sanitaire situés à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne Marteilia refringens.

Le repeuplement ne doit avoir lieu qu'une fois que toutes fermes aquacoles officiellement déclarées infectées ont été vidées de leurs mollusques, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2 c);

e)

toutes les fermes aquacoles et tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1 de la présente partie.

I.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'infection à Marteilia refringens

Lorsqu'une surveillance ciblée est requise pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, la totalité des fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doit faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 4.B de la section II, compte tenu du risque de contamination de la ferme aquacole ou du parc à mollusques par Marteilia refringens.

Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic décrites au point II.2 se révèlent négatifs pour Marteilia refringens et que toute suspicion d'infection à Marteilia refringens est écartée conformément aux méthodes de diagnostic décrites au point II.3.

I.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne l'infection à Marteilia refringens

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Marteilia refringens peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:

a)

Les exigences définies au paragraphe I.2.2, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de Marteilia refringens de l'environnement de la ferme aquacole;

b)

la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis et ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) aient été repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'infection à Marteilia refringens;

c)

le repeuplement n'ait eu lieu qu'après que la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, nettoyés, désinfectés et soumis à un vide sanitaire ou à d'autres mesures conformément au point a);

d)

aucune infection à Marteilia refringens n'ait été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.

II.   Méthodes de diagnostic et enquêtes officielles

II.1.   Échantillons

L'animal entier est présenté au laboratoire pour la réalisation des tests de diagnostic spécifiés aux points II.2 et II.3.

II.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens

Les méthodes de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 4, sont l'examen histopathologique, les empreintes tissulaires ou la PCR.

II.3.   Méthodes d'enquête officielle et de diagnostic visant à confirmer la présence d'une infection à Marteilia refringens ou à écarter une suspicion d'une telle infection

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'infection à Marteilia refringens conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:

a)

l'enquête officielle doit comporter au moins un échantillonnage sur 30 mollusques d'espèces sensibles si la suspicion est fondée sur un rapport de mortalité, ou, si tel n'est pas le cas, sur 150 mollusques d'espèces sensibles, les prélèvements étant réalisés après le début de la période de transmission de Marteilia refringens. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer après que la température de l'eau a dépassé 17 °C;

b)

les échantillons doivent être testés à l'aide des méthodes de diagnostic indiquées au point i) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 4, section I:

i)

la présence de Marteilia refringens doit être considérée comme confirmée lorsque l'examen histopathologique, les empreintes tissulaires ou l'hybridation in situ donnent un résultat positif associé à un résultat positif obtenu par la PCR complétée par un séquençage;

ii)

la suspicion d'infection à Marteilia refringens peut être écartée dans les cas où les tests visés au point i) n'apportent aucun élément supplémentaire prouvant la présence de Marteilia refringens.

Tableau 4.A

Programme de surveillance dans les États membres, zones ou compartiments pour la période qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens visé au point I.2.1

 

Nombre d'inspections sanitaires par an

Nombre d'examens de laboratoire par an

Nombre de mollusques par échantillon

Fermes aquacoles/parcs à mollusques

1

1

150


Tableau 4.B

Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens visé au point I.3

Niveau de risque

Nombre d'inspections sanitaires

Nombre d'examens de laboratoire

Nombre de mollusques par échantillon

Élevé

Une par an

Un tous les deux ans

150

Moyen

Une tous les deux ans

Un tous les deux ans

150

Faible

Une tous les deux ans

Un tous les quatre ans

150

PARTIE 5

SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'INFECTION À BONAMIA OSTREAE

I.   Exigences relatives aux programmes de surveillance ou d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae

I.1.   Exigences générales

Des inspections sanitaires et, s'il y a lieu, un échantillonnage des unités de production doivent être effectués pendant la période de l'année où l'on sait que la prévalence de Bonamia ostreae est maximale dans l'État membre, la zone ou le compartiment. Si cette information n'est pas disponible, l'échantillonnage doit être réalisé en hiver ou au début du printemps.

Si les mollusques doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la partie 5, les critères suivants doivent être respectés:

a)

lorsque des huîtres de l'espèce Ostrea edulis sont présentes, seules des huîtres de cette espèce doivent être sélectionnées pour l'échantillonnage. En l'absence de telles huîtres, l'échantillon doit être représentatif de toutes les autres espèces sensibles présentes;

b)

en présence de mollusques faibles, bâillants ou qui viennent de mourir mais ne sont pas encore décomposés, ces animaux doivent être sélectionnés en priorité. En l'absence de tels mollusques, les animaux sains les plus âgés doivent faire partie des mollusques sélectionnés;

c)

lorsque les prélèvements sont réalisés dans des fermes aquacoles qui utilisent plusieurs sources d'eau pour la production des mollusques, des animaux représentant toutes les sources d'eau doivent être inclus dans les échantillons, de sorte que toutes les parties de la ferme aquacole y soient proportionnellement représentées;

d)

lorsque des échantillons sont prélevés dans des parcs à mollusques, des animaux provenant d'un nombre suffisant de points d'échantillonnage doivent être inclus dans l'échantillon. Les principaux facteurs à prendre en compte pour la sélection de ces points de prélèvements sont les anciens points de prélèvement où Bonamia ostreae a été détecté, la densité d'élevage, les courants, la présence d'espèces sensibles, la présence d'espèces vectrices, la bathymétrie et les pratiques de gestion. L'échantillonnage doit aussi porter sur les bancs naturels se trouvant à l'intérieur des parcs à mollusques ou adjacents à ceux-ci.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne l'infection à Bonamia ostreae

I.2.1.   Programmes de surveillance

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme de surveillance ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue de tests.

Programme de surveillance de deux ans:

a)

les fermes aquacoles et les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 5.A de la présente partie;

b)

au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour Bonamia ostreae et toute suspicion d'infection par Bonamia ostreae doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3;

c)

lorsque des huîtres de l'espèce Ostrea edulis provenant d'un État membre, d'une zone ou d'un compartiment jouissant d'un statut sanitaire de catégorie I doivent être incluses dans l'échantillon, elles doivent avoir été introduites dans la ferme aquacole ou le parc à mollusques au moins à l'automne précédant immédiatement la période d'exécution du programme de surveillance.

I.2.2.   Programmes d'éradication

L'éradication de Bonamia ostreae est considérée comme impossible dans la plupart des cas, mais lorsque l'État membre l'estime faisable, le modèle de programme d'éradication ci-après doit être appliqué.

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet du programme d'éradication suivant au moins:

a)

les mesures minimales de lutte prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles ou du ou des parcs à mollusques officiellement déclarés infectés par Bonamia ostreae.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de cette maladie répertoriée, à savoir: le nombre, l'âge, le taux de mortalité et la distribution de la mortalité des mollusques dans la ferme aquacole ou le parc à mollusques infecté par Bonamia ostreae, y compris les mollusques sauvages, l'éloignement et la densité des fermes aquacoles ou parcs à mollusques voisins, y compris les mollusques sauvages, la proximité des établissements de transformation et des fermes aquacoles ou parcs à mollusques en contact, les espèces présentes dans les fermes aquacoles ou les parcs à mollusques, en particulier les espèces sensibles et les espèces vectrices, les pratiques d'élevage appliquées dans les fermes aquacoles ou les parcs à mollusques contaminés et dans les fermes aquacoles ou parcs à mollusques voisins, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole ou d'un parc à mollusques officiellement déclaré infecté par Bonamia ostreae et doit correspondre à une zone déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;

ii)

un périmètre de surveillance doit être établi au-delà du périmètre de protection, et doit correspondre à une zone située autour du périmètre de protection, déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;

b)

la totalité des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE situés à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarés infectés par Bonamia ostreae doit faire l'objet d'une enquête officielle comprenant au moins un prélèvement d'échantillons visant à tester 150 mollusques, réalisé après le début de la période de transmission de Bonamia ostreae. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer en hiver ou au début du printemps;

c)

toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés par Bonamia ostreae doivent être vidés de leurs mollusques, soumis à un vide sanitaire et si possible nettoyés et désinfectés; la durée de la période de vide sanitaire doit être d'au moins six semaines.

Lorsque la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, un vide sanitaire synchronisé d'au moins quatre semaines doit être mis en place.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis soient vidés de leurs mollusques, nettoyés, désinfectés et qu'ils fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;

d)

la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des fermes aquacoles ou des parcs à mollusques ayant fait l'objet d'un vide sanitaire situés à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'infection à Bonamia ostreae. Le repeuplement ne doit avoir lieu qu'une fois que toutes fermes aquacoles officiellement déclarées infectées ont été vidées de leurs mollusques, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2 c);

e)

la totalité des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication doit ensuite faire l'objet du programme de surveillance décrit au point I.2.

I.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'infection à Bonamia ostreae

Lorsqu'une surveillance ciblée est requise pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, la totalité des fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doit faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 5.B figurant à la section II de la présente partie, compte tenu du risque de contamination de la ferme aquacole ou du parc à mollusques par Bonamia ostreae.

Le statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour Bonamia ostreae, et que toute suspicion d'infection à Bonamia ostreae a été écartée conformément aux méthodes de diagnostic établies au point II.3.

I.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne l'infection à Bonamia ostreae.

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:

a)

Les exigences définies au paragraphe I.2.2, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de Bonamia ostreae de l'environnement de la ferme aquacole;

b)

la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis et ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) aient été repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'infection à Bonamia ostreae;

c)

le repeuplement n'ait eu lieu qu'après que la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, nettoyés, désinfectés et soumis à un vide sanitaire ou à d'autres mesures conformément au point a);

d)

aucune infection à Bonamia ostreae n'ait été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.

II.   Méthodes et critères de diagnostic

II.1.   Échantillons

L'animal entier est présenté au laboratoire pour la réalisation des tests de diagnostic spécifiés aux points II.2 et II.3.

II.2.   Méthodes de diagnostic pour l'obtention et le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae

Les méthodes de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne les infections à Bonamia ostreae sont l'examen histopathologique, les empreintes tissulaires ou la PCR. Lors de l'application de ces méthodes de diagnostic, les méthodes et procédures détaillées correspondantes décrites à l'annexe II, partie 5, doivent être respectées.

II.3.   Critères de diagnostic pour confirmer la présence d'une infection à Bonamia ostreae ou écarter une suspicion d'une telle infection

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'infection à Bonamia ostreae conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:

l'enquête officielle doit comporter au moins un échantillonnage sur 30 mollusques d'espèces sensibles si la suspicion est fondée sur un rapport de mortalité, ou, si tel n'est pas le cas, sur 150 mollusques d'espèces sensibles, les prélèvements étant réalisés après le début de la période de transmission de Bonamia ostreae. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer en hiver ou au début du printemps. Les échantillons doivent être testés à l'aide des méthodes de diagnostic indiquées au point i) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 5, section I:

i)

la présence de Bonamia ostreae doit être considérée comme confirmée lorsque l'examen histopathologique, les empreintes tissulaires ou l'hybridation in situ donnent un résultat positif associé à un résultat positif obtenu par la PCR complétée par un séquençage, conformément aux méthodes et procédures approuvées décrites à l'annexe II, partie 5;

ii)

une suspicion d'infection à Bonamia ostreae doit être écartée si ces tests n'apportent pas de preuve supplémentaire de la présence de Bonamia ostreae.

Tableau 5.A

Programme de surveillance dans les États membres, zones ou compartiments pour la période qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae visé au point I.2.1

 

Nombre d'inspections sanitaires par an

Nombre d'examens de laboratoire par an

Nombre de mollusques par échantillon

Fermes aquacoles/parcs à mollusques

1

1

150


Tableau 5.B

Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae visé au point I.3

Niveau de risque

Nombre d'inspections sanitaires

Nombre d'examens de laboratoire

Nombre de mollusques par échantillon

Élevé

Une par an

Un tous les deux ans

150

Moyen

Une tous les deux ans

Un tous les deux ans

150

Faible

Une tous les deux ans

Un tous les quatre ans

150

PARTIE 6

SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE LA MALADIE DES POINTS BLANCS (MPB)

I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la MPB ainsi que des mesures de confinement destinées à lutter contre l'infection par le virus du syndrome des points blancs (VSPB)

I.1.   Exigences générales relatives aux inspections et à l'échantillonnage

L'échantillonnage des crustacés en vue d'examens de laboratoire doit être effectué chaque fois que la température de l'eau est susceptible d'atteindre les maxima annuels. Cette exigence concernant la température de l'eau s'applique également aux inspections sanitaires lorsque celles-ci sont réalisables et appropriées.

Si les crustacés d'élevage doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la présente partie, les critères suivants doivent être respectés:

a)

en présence de crustacés faibles ou moribonds dans les unités de production, ces animaux doivent être sélectionnés en priorité. En l'absence de tels crustacés, l'échantillonnage doit porter sur des animaux appartenant à différentes cohortes de taille, à savoir des juvéniles et des adultes des espèces sensibles, qui doivent être représentés proportionnellement dans les échantillons;

b)

si plus d'une source d'eau est utilisée pour la production des crustacés, des crustacés sensibles représentatifs de toutes les sources d'eau doivent être inclus dans les échantillons.

Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant des populations sauvages sensibles, à savoir les eaux marines, les estuaires, les cours d'eau et les lacs.

Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, les crustacés à inclure dans l'échantillonnage doivent être sélectionnés comme suit:

i)

dans les aires marines et estuariennes, une ou plusieurs des espèces suivantes doivent être sélectionnées: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus ou les crevettes pénéides, notamment Penaeus japonicus, Penaeus kerathurus, Penaeus semisulcatus. Si ces espèces ne sont pas présentes, les échantillons doivent être représentatifs des autres espèces de décapodes sensibles présentes. Étant donné la grande variété d'hôtes sensibles, il y a lieu de choisir des hôtes appartenant à des genres ou familles de l'ordre des Decapoda dont la sensibilité a été démontrée expérimentalement ou dans la nature;

ii)

dans les cours d'eau et les lacs, une ou plusieurs des espèces suivantes doivent être sélectionnées: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes ou Orconectes limosus. Si ces espèces ne sont pas présentes, les échantillons doivent être représentatifs des autres espèces de décapodes sensibles présentes. Étant donné la grande variété d'hôtes sensibles, il y a lieu de choisir des hôtes appartenant à des genres ou familles de l'ordre des Decapoda dont la sensibilité a été démontrée expérimentalement ou dans la nature;

iii)

en présence de crustacés faibles ou moribonds, ces animaux doivent être sélectionnés en priorité. En l'absence de tels crustacés, l'échantillonnage doit porter sur des animaux appartenant à différentes cohortes de taille, à savoir des juvéniles et des adultes des espèces sensibles, qui doivent être représentés proportionnellement dans les échantillons.

I.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne la MPB

I.2.1.   Programmes de surveillance

a)

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne la MPB conformément à l'annexe III, partie B, de la directive 2006/88/CE peut obtenir le statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment remplissent les conditions fixées à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de ladite directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément audit point, ont fait l'objet du programme de surveillance de deux ans ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue d'essais.

Les fermes aquacoles ou les points de prélèvement ont fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 6.A de la section II.

Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 se sont révélés négatifs pour la MPB et toute suspicion de MPB a été écartée conformément aux méthodes de diagnostic indiquées au point II.3;

b)

si, au cours de la mise en œuvre du programme de surveillance visé au point a), une infection par le VSPB est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre le programme d'éradication décrit au point I.2.2 à condition de satisfaire aux conditions suivantes:

i)

il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne la MPB est indépendant de celui des eaux naturelles avoisinantes pour cette maladie répertoriée, conformément à l'annexe V, partie II, point 3 de la directive 2006/88/CE;

ii)

elle a été vidée de ses crustacés, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

iii)

elle a été repeuplée avec des crustacés provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I en ce qui concerne la MPB.

I.2.2.   Programmes d'éradication

I.2.2.1.   Exigences générales

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la MPB peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme d'éradication suivant:

a)

les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE ont effectivement été appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie à proximité de la ou des fermes aquacoles officiellement déclarées infectées par le VSPB.

La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de transmission de la MPB aux crustacés d'élevage et aux crustacés sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des crustacés dans la ferme aquacole infectée par la MPB, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique.

Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites:

i)

un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par la MPB, et doit correspondre:

1.

dans les aires marines et estuariennes: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par la MPB, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées; ou

2.

dans les eaux douces: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par la MPB; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de la MPB;

ii)

un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre:

1.

dans les aires marines: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées ou

2.

dans les eaux douces: à une zone étendue qui se situe au-delà du périmètre de protection établi;

b)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par la MPB doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants:

i)

un prélèvement d'échantillons en vue de la réalisation de tests sur 10 crustacés en cas de signes cliniques ou de signes post-mortem compatibles avec la MPB, ou sur 150 crustacés en l'absence de signes cliniques ou de signes post mortem; et

ii)

une inspection sanitaire; dans les fermes aquacoles où les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois pendant la saison durant laquelle la température de l'eau est susceptible d'atteindre les maxima annuels, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);

c)

toutes les fermes aquacoles officiellement déclarées infectées par la MPB doivent être vidées de leurs animaux, nettoyées et désinfectées et une période de vide sanitaire d'une durée d'au moins six semaines doit être observée. Lorsque la totalité des fermes aquacoles officiellement déclarées infectées ont été vidées de leurs crustacés, un vide sanitaire synchronisé d'au moins trois semaines doit être mis en place. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication.

Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance.

L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs crustacés, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;

d)

toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes ayant fait l'objet d'un vide sanitaire qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées:

i)

avec des crustacés provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la MPB; ou

ii)

transitoirement jusqu'au 31 décembre 2020, avec des crustacés provenant d'États membres, de zones ou de compartiments faisant l'objet d'un programme de surveillance de la MPB approuvé.

Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées par la MPB ont été vidées de leurs animaux, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1. c);

e)

toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de ladite directive doivent avoir ensuite été soumises au moins au programme de surveillance décrit au point I.2.1.

I.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole précédemment déclarés indemnes de la MPB puissent retrouver le statut «indemne de maladie»

Un compartiment continental comprenant une seule ferme aquacole ayant un statut sanitaire de catégorie I en ce qui concerne la MPB, dont le statut sanitaire à l'égard de cette maladie répertoriée est indépendant de celui des eaux naturelles avoisinantes, conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer ce statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de ladite directive, peut retrouver ce statut de catégorie I dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:

a)

la ferme aquacole infectée par la MPB a été vidée de ses animaux, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;

b)

la ferme infectée a été repeuplée avec des crustacés provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la MPB.

I.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la MPB

Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'une inspection sanitaire et d'échantillonnages conformément au tableau 6.B de la section II, compte tenu du risque de contamination de la ferme aquacole par la MPB.

Dans les États membres, les zones ou les compartiments comptant un nombre limité de fermes aquacoles et où la surveillance ciblée de ces établissements ne fournit pas suffisamment de données épidémiologiques, les programmes de surveillance nécessaires pour maintenir le statut «indemne de maladie» doivent inclure des points de prélèvement sélectionnés conformément aux exigences fixées au point I.1.

50 % de ces points de prélèvement doivent faire l'objet d'inspections et de prélèvements chaque année, par rotation. L'échantillonnage doit être réalisé conformément au tableau 6.B de la section II. Les échantillons doivent être sélectionnés, préparés et analysés conformément aux méthodes d'échantillonnage et de diagnostic décrites à la section II et les examens de laboratoire doivent avoir fourni des résultats négatifs en ce qui concerne l'agent de la MPB.

Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour la MPB et que toute suspicion de MPB est écartée conformément aux méthodes d'enquête officielle et de diagnostic établies au point II.3.

I.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne la MPB

Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la MPB peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:

a)

Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du VSPB de l'environnement de la ferme aquacole;

b)

toutes les fermes aquacoles officiellement déclarées infectées par la MPB et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) situées à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des crustacés provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne la MPB;

c)

le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées par la MPB ont été vidées de leurs animaux, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a);

d)

la MPB n'ait pas été détectée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.

II.   Méthodes d'échantillonnage et de diagnostic

II.1.   Échantillons

Des échantillons d'épiderme tégumentaire, soit disséqué, soit présent dans les pattes locomotrices, les pléopodes, les pièces buccales ou les branchies de l'animal d'expérience sont fixés dans de l'éthanol à 95 % avant la préparation des échantillons pour la PCR en deux étapes.

D'autres échantillons, fixés pour l'examen histologique et l'examen en microscopie électronique à transmission peuvent être prélevés pour corroborer les données de diagnostic obtenues par PCR.

II.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de la MPB»

La méthode de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de la MPB» conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 6, est la PCR en deux étapes.

Si la PCR en deux étapes donne un résultat positif, celui-ci doit être corroboré par le séquençage du produit d'amplification avant la mise en place des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE, si possible, concrètement, par la mise en évidence, par examen histologique et microscopie électronique à transmission, de signes pathognomoniques de la MPB chez les hôtes sensibles sélectionnés.

II.3.   Méthodes d'enquête officielle et de diagnostic pour écarter une suspicion de MPB ou pour confirmer la présence de la maladie

Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion de MPB conformément à l'article 28 de la directive 2006/88/CE, la procédure d'inspection, d'échantillonnage et d'essai suivante doit être respectée:

a)

l'enquête officielle doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 crustacés en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par le SVPB, ou sur 150 crustacés en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés conformément à la méthode de diagnostic indiquée au point II.2 (PCR en deux étapes);

b)

la présence de la MPB doit être considérée comme confirmée lorsque la PCR en deux étapes suivie d'un séquençage, réalisée selon les méthodes et procédures détaillées indiquées à l'annexe II, partie 6, se révèle positive pour le VSPB et que des signes pathognomoniques de la MPB sont observés chez les hôtes sélectionnés.

Une suspicion de MPB peut être écartée si les résultats de ces tests n'apportent aucun élément supplémentaire prouvant la présence de la MPB.

Tableau 6.A

Programme de surveillance dans les États membres, zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de la MPB» visée au point I.2.1

 

Nombre d'inspections cliniques par an

Nombre d'examens de laboratoire par an

Nombre de crustacés par échantillon

Fermes aquacoles/sites de prélèvement

1

1

150


Tableau 6.B

Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de la MPB» visé au point I.3

Niveau de risque

Nombre d'inspections sanitaires

Nombre d'examens de laboratoire

Nombre de crustacés par échantillon

Élevé

Une par an

Un tous les deux ans

150

Moyen

Une tous les deux ans

Un tous les deux ans

150

Faible

Une tous les deux ans

Un tous les quatre ans

150


(1)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.

(2)  Les ovaires ou le liquide séminal des géniteurs doivent être recueillis au moment de la maturation, à l'occasion de la ponte artificielle (stripping).

(3)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 5 %.

(4)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.

(5)  Les ovaires ou le liquide séminal des géniteurs doivent être recueillis au moment de la maturation, à l'occasion de la ponte artificielle (stripping).

(6)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 10 %.

(7)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.

(8)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 10 %.

(9)  Au minimum un échantillon doit être prélevé pour chaque inspection sanitaire.

(10)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection de l'HVK avec un niveau de confiance de 95 % si la prévalence escomptée est de 5 %.

(11)  Ne s'applique pas aux fermes aquacoles qui élèvent uniquement des truites arc-en-ciel (Oncorhynchus mykiss) ou des truites fario (Salmo trutta), ou les deux, dans une eau provenant exclusivement de sources d'eau douce n'abritant pas le saumon de l'Atlantique (Salmo salar).

(12)  Les échantillons doivent être prélevés et stockés puis examinés au cours de deux périodes de tests d'un mois chaque année (au printemps et en automne), ou selon ce qui convient en fonction de considérations d'ordre pratique.

(13)  Nombre maximal de poissons par regroupement: 5.

(14)  Les échantillons doivent être prélevés et examinés au cours de deux périodes de tests d'un mois chaque année (au printemps et en automne), ou selon ce qui convient en fonction de considérations d'ordre pratique.

(15)  Ne s'applique pas aux fermes aquacoles qui élèvent uniquement des truites arc-en-ciel (Oncorhynchus mykiss) ou des truites fario (Salmo trutta), ou les deux, dans une eau provenant exclusivement de sources d'eau douce n'abritant pas le saumon de l'Atlantique (Salmo salar).


ANNEXE II

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES

I.   Introduction

La présente annexe établit les procédures détaillées des méthodes de diagnostic à appliquer lors des examens de laboratoire prévus par les programmes d'éradication et de surveillance décrits à l'annexe I de la présente décision, et afin de confirmer ou d'écarter les suspicions des maladies non exotiques ci-après qui sont énumérées à l'annexe IV, partie II de la directive 2006/88/CE (ci-après les «maladies répertoriées»), conformément à l'article 57, point b), de cette directive:

1.

la septicémie hémorragique virale (SHV)

Partie 1

2.

la nécrose hématopoïétique infectieuse (NHI)

Partie 1

3.

l'herpèsvirose de la carpe koï (HVCK)

Partie 2

4.

l'anémie infectieuse du saumon (AIS)

Partie 3

5.

l'infection à Marteilia refringens

Partie 4

6.

l'infection à Bonamia ostreae

Partie 5

7.

la maladie des points blancs (MPB)

Partie 6

II.   Définitions

Aux fins de la présente annexe, on entend par «milieu de transport», un milieu de culture cellulaire contenant 10 % de sérum de veau, 200 UI de pénicilline, 200 μg de streptomycine et 200 μg de kanamycine par millilitre ou d'autres antibiotiques d'efficacité avérée.

PARTIE 1

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE LA NHI ET DE LA SHV

I.   Méthodes et procédures de diagnostic pour la surveillance de la SHV et de la NHI

Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la NHI ou la SHV visé à l'annexe I, partie 1, section I, à l'aide des méthodes de diagnostic indiquées dans la partie 1, points II.1 et II.2, de ladite annexe, les méthodes et procédures de diagnostic détaillées décrites aux points I.1 à I.6 doivent être appliquées.

I.1.   Préparation et expédition des échantillons de poissons

I.1.1.   Tissus destinés à un examen virologique sur culture cellulaire

Avant d'être expédiés ou transférés vers le laboratoire, les morceaux d'organes à examiner doivent être prélevés sur le poisson à l'aide d'instruments de dissection stériles et placés dans des tubes en plastique stériles contenant le milieu de transport.

La quantité de tissus de poisson nécessaire pour un examen virologique sur culture cellulaire et par RT-qPCR dépend de la taille des poissons. On prélèvera donc l'alevin entier (si longueur du corps < 4 cm), les viscères, y compris les reins (si 4 cm < longueur du corps < 6 cm) ou, dans le cas des poissons de plus grande taille, les reins, la rate, le cœur et/ou l'encéphale, ainsi que le liquide ovarien des reproductrices au moment du frai.

Du liquide ovarien ou séminal ou des morceaux d'organes provenant de dix poissons au maximum peuvent être regroupés dans un tube stérile contenant au moins 4 ml de milieu de transport; ils constituent un échantillon global. Le poids minimal de tissus contenus dans chaque échantillon doit être de 0,5 gramme (g).

L'examen virologique sur culture cellulaire doit commencer dès que possible et au plus tard 48 heures après le prélèvement des échantillons. Dans des cas exceptionnels, l'examen virologique peut commencer au plus tard 72 heures après la collecte du matériel à examiner à condition que celui-ci soit conservé dans le milieu de transport et que les conditions de température requises pendant le transport aient pu être respectées.

I.1.2.   Échantillons destinés à l'analyse par amplification en chaîne par polymérase en présence de transcriptase inverse (RT-PCR ou RT-qPCR)

Les échantillons doivent être prélevés sur le poisson conformément à la procédure décrite au point I.1.1 à l'aide d'un instrument stérile, puis transférés dans des tubes en plastique stériles contenant le milieu de transport. Les tissus de 10 poissons peuvent être rassemblés dans un tube pour constituer un échantillon global. Toutefois, si la quantité d'inoculum est faible, on regroupera les tissus provenant de cinq poissons au maximum. Il est aussi possible de regrouper les échantillons dans des réactifs de stabilisation de l'ARN, à raison de 0,2 g de tissu/ml de réactif selon les recommandations des fabricants, mais chaque poisson devra être traité séparément et ne devra pas être regroupé avec d'autres dans les échantillons en raison de la faible quantité de matériel à utiliser pour l'extraction.

Des poissons entiers peuvent aussi être envoyés au laboratoire.

I.2.   Expédition des échantillons de poissons

Les tubes contenant les tissus des poissons dans le milieu de transport qui sont destinés à la culture cellulaire ou à l'analyse par RT-qPCR doivent être placés dans des conteneurs isolés, tels que des boîtes en polystyrène à parois épaisses, avec une quantité suffisante de glace ou d'un autre agent réfrigérant ayant le même effet afin de garantir la réfrigération des échantillons pendant le transport vers le laboratoire. Il y a toutefois lieu d'éviter la congélation des échantillons. La température d'un échantillon pendant son transport ne doit jamais dépasser 10 °C et le récipient de transport doit encore contenir de la glace lors de sa réception, ou un ou plusieurs blocs réfrigérants doivent encore être partiellement ou totalement congelés.

Des poissons entiers peuvent être envoyés au laboratoire si les conditions de température pendant le transport visées au premier paragraphe peuvent être respectées. Le cas échéant, les poissons entiers, éventuellement enveloppés dans du papier absorbant, doivent être placés dans un sac en plastique pour l'expédition. Des poissons vivants peuvent également être expédiés.

I.3.   Collecte de matériel de diagnostic supplémentaire

Si le laboratoire de diagnostic y consent, d'autres tissus de poissons peuvent aussi être collectés et préparés en vue d'examens supplémentaires.

I.4.   Préparation des échantillons destinés à la culture cellulaire et à l'analyse par RT-qPCR

I.4.1.   Congélation dans des cas exceptionnels

En cas de difficultés pratiques empêchant le traitement des échantillons dans les 48 heures suivant la collecte des tissus de poisson, il est possible de congeler les spécimens de tissus dans le milieu de transport à – 20 °C ou à une température inférieure et de procéder à l'examen virologique dans les 14 jours suivants. Toutefois, les tissus ne doivent être congelés et décongelés qu'une seule fois avant examen. Les motifs précis de chaque congélation d'échantillons de tissus de poisson doivent être consignés.

I.4.2.   Homogénéisation des organes

Au laboratoire, les tissus de poisson contenus dans les tubes doivent être complètement homogénéisés (à l'aide d'un malaxeur d'échantillons, d'un mélangeur ou d'un ensemble pilon-mortier avec sable stérile) et mis ensuite en suspension dans le milieu de transport d'origine.

Si un échantillon est constitué d'un poisson entier de longueur inférieure à 4 cm, celui-ci doit être réduit en petits fragments à l'aide de ciseaux stériles ou d'un scalpel, après élimination de la partie du corps située à l'arrière de l'anus. Si un échantillon est constitué d'un poisson entier de longueur comprise entre 4 et 6 cm, il y a lieu de prélever les viscères, y compris les reins. Si un échantillon est constitué d'un poisson entier de longueur supérieure à 6 cm, les spécimens de tissus doivent être prélevés comme décrit au point I.1. Les spécimens de tissus doivent être réduits en petits fragments à l'aide de ciseaux stériles ou d'un scalpel et homogénéisés comme décrit au premier paragraphe, puis mis en suspension dans le milieu de transport.

Le rapport final entre les tissus et le milieu de transport doit être ajusté à 1:10 au laboratoire.

I.4.3.   Centrifugation de l'homogénat

L'homogénat doit être centrifugé entre 2 000 et 4 000 g dans une centrifugeuse réfrigérée à une température comprise entre 2 et 5 °C pendant 15 minutes et le surnageant doit être recueilli; celui-ci peut ensuite être traité avec des antibiotiques, soit pendant 4 heures à 15 °C, soit pendant une nuit entre 4 et 8 °C. Si l'échantillon a été expédié dans un milieu de transport, le traitement du surnageant par des antibiotiques n'est pas nécessaire.

En cas de difficultés pratiques, telles qu'une panne d'incubateur ou des problèmes de cultures cellulaires, empêchant l'inoculation des cellules dans les 48 heures qui suivent la collecte des échantillons de tissus, le surnageant peut être congelé à – 80 °C et l'examen virologique réalisé dans les quatorze jours.

Si le surnageant recueilli est conservé à – 80 °C au cours des 48 heures suivant l'échantillonnage, il ne peut être réutilisé qu'une seule fois pour l'examen virologique.

Avant d'inoculer les cellules, le surnageant doit être mélangé à parts égales avec un lot de sérums anti-sérotypes indigènes du virus de la nécrose pancréatique infectieuse (NPI), dilués de façon appropriée, et doit être incubé ainsi pendant au minimum une heure à 15 °C ou pendant au maximum 18 heures à 4 °C. Le titre de l'antisérum doit être d'au moins 1/2 000 dans un test de neutralisation sur plaque à 50 %.

Le traitement de tous les inoculums par le sérum anti-virus de la NPI vise à empêcher l'effet cytopathogène (ECP) dû au virus de la NPI de se manifester dans les cultures cellulaires inoculées. Cela permet de réduire la durée des examens virologiques ainsi que le nombre de cas où l'apparition d'un ECP devrait être considérée comme une manifestation possible du virus de la SHV ou de la NHI.

Lorsque les échantillons proviennent d'unités de production considérées comme indemnes de la NPI, le traitement des inoculums par le sérum antivirus de la NPI peut être omis.

I.4.4.   Préparation des échantillons pour les programmes de surveillance faisant appel à la RT-PCR et à la RT-qPCR

Si les échantillons ont été placés dans le milieu de transport, la procédure décrite aux points I.4.2 et I.4.3 doit être suivie. Après centrifugation, le surnageant doit être recueilli et l'ARN extrait. Si aucun autre examen ne doit être réalisé directement après la centrifugation, les échantillons doivent être immédiatement congelés à – 20 °C ou à une température inférieure.

Pour l'analyse des tissus de poisson conservés dans du réactif de stabilisation de l'ARN, d'autres opérations doivent être réalisées dans les délais précisés ci-après sur les échantillons stockés à différentes températures:

 

échantillons stockés à 37 °C: dans un délai d'un jour;

 

échantillons stockés à 25 °C: dans un délai d'une semaine

 

échantillons stockés à 4 °C: dans un délai d'un mois;

 

échantillons stockés à – 20 °C: délai indéterminé.

Les échantillons globaux conservés dans le réactif de stabilisation de l'ARN doivent être traités de la même manière que les échantillons simples dans du réactif de stabilisation de l'ARN. Dans le cas d'échantillons globaux dans du réactif de stabilisation de l'ARN, le volume de l'échantillon ne doit dépasser le volume recommandé par le fabricant pour l'extraction de l'ARN à l'aide de kits tels que RNeasy Minikit (Qiagen) ou similaires. En cas de regroupement d'échantillons plus grands, les kits ou les méthodes d'extraction doivent être adaptés en conséquence.

Les échantillons recueillis dans des réactifs de stabilisation de l'ARN ne doivent pas être utilisés pour les cultures cellulaires.

I.4.5.   Regroupement d'échantillons pour la RT-qPCR

Étant donné que les protocoles de RT-qPCR sont d'une sensibilité identique ou supérieure à celle des méthodes de culture cellulaire, il est dans certains cas acceptable d'utiliser pour la PCR le surnageant des tissus homogénéisés d'organes prélevés sur 10 poissons au maximum et regroupés dans le milieu de culture cellulaire. Toutefois, en raison de la quantité nettement réduite d'inoculum utilisée pour la PCR par rapport à la culture cellulaire, tous les tissus de poissons doivent être soigneusement homogénéisés avant le regroupement du matériel pour l'extraction.

Le même principe s'applique lorsque les échantillons sont recueillis dans des réactifs de stabilisation de l'ARN. Toutefois, dans ce cas, il est souvent difficile de regrouper dans un même tube du matériel pouvant provenir de 10 poissons, et il faut donc réduire le nombre de poissons par échantillon global et le ramener à un chiffre compris entre 2 et 5.

I.5.   Examen virologique sur culture cellulaire

I.5.1.   Cultures cellulaires et milieux

Des cellules de la lignée cellulaire 2 d'alevins de crapet arlequin (Bluegill fry) (BF-2) ou de la lignée cellulaire 2 de gonades de truite arc-en-ciel (Rainbow trout gonad) (RTG-2) et des cellules de Epithelioma papulosum cyprini (EPC) ou de poisson tête de boule (Fathead minnow) (FHM) sont cultivées à une température comprise entre 20 et 30 °C dans un milieu approprié, en l'occurrence le milieu essentiel minimal de Eagle (MEM) ou une variante de celui-ci, additionné de sérum fœtal bovin à 10 % et d'antibiotiques à une concentration standard.

Lorsque les cellules sont cultivées dans des flacons fermés, le milieu doit être tamponné à l'aide de bicarbonate. Le milieu utilisé pour la culture cellulaire en unités ouvertes peut être tamponné à l'aide de tris(hydroxyméthyl)aminométhane-HCl (Tris-HCl) (23 mM) et de bicarbonate de sodium (6 mM). Le pH doit être égal à 7,6 ± 0,2.

Pour l'inoculation des cultures par du matériel tissulaire de poisson, il convient d'utiliser des cultures cellulaires jeunes, âgées normalement d'un jour et monocouches si possible; néanmoins, les cultures d'âge compris entre 4 et 48 heures sont acceptables. Les cellules doivent être en phase de croissance active au moment de l'inoculation.

I.5.2.   Inoculation des cultures cellulaires

Une suspension d'organes traitée aux antibiotiques doit être inoculée aux cultures cellulaires en deux dilutions distinctes, à savoir la dilution initiale et, en outre, une dilution au 1:10 de celle-ci (soit des dilutions finales respectives des tissus dans le milieu de culture de 1:100 et 1:1 000), de manière à éviter les interférences homologues. Deux lignées cellulaires au moins doivent être inoculées comme indiqué au point I.5.1. Le rapport entre la quantité d'inoculum et le volume du milieu de culture cellulaire doit être de 1:10 environ.

Pour chaque dilution et chaque lignée cellulaire, il y a lieu d'utiliser une surface de culture minimale d'environ 2 cm2, ce qui correspond à un puits sur une plaque de culture cellulaire à 24 puits. Des plaques de culture cellulaire doivent être utilisées dans la mesure du possible.

I.5.3.   Incubation des cultures cellulaires

Les cultures cellulaires inoculées doivent être incubées à 15 °C pendant sept à dix jours. Si la couleur du milieu de culture vire du rouge au jaune, indiquant une acidification du milieu, il y a lieu d'ajuster le pH à l'aide d'une solution stérile de bicarbonate ou à l'aide de substances équivalentes pour garantir la sensibilité des cellules à l'infection virale.

Tous les six mois au moins, ou lorsqu'on suspecte une diminution de la sensibilité cellulaire, il y a lieu de procéder au titrage des préparations mères congelées de VSHV et VNHI, afin de vérifier la sensibilité des cultures cellulaires à l'infection. La procédure décrite à la section III doit être appliquée, si possible.

I.5.4.   Microscopie

Les cultures cellulaires inoculées doivent être examinées régulièrement (au moins trois fois par semaine) au microscope à un grossissement compris entre × 40 et × 150 pour rechercher un ECP. Si un ECP net est observé, les procédures d'identification du virus décrites au point I.6 doivent être mises en œuvre immédiatement.

I.5.5.   Repiquage

Si aucun ECP ne s'est manifesté après une première incubation de sept à dix jours, il convient de procéder à un repiquage sur des cultures cellulaires fraîches en utilisant une surface de culture identique à celle de la culture primaire.

Des parties aliquotes du milieu (surnageant) de toutes les cultures ou de tous les puits constituant la culture primaire sont regroupées en pools par lignée cellulaire sept à dix jours après l'inoculation. Les pools non dilués et dilués au 1:10 (ce qui donne respectivement des dilutions finales du surnageant au 1:10 et au 1:100) sont ensuite inoculés chacun à des cultures cellulaires homologues, comme décrit au point I.5.2. Une autre possibilité consiste à inoculer directement des parties aliquotes de 10 % du milieu constituant la culture primaire dans un puits contenant une culture cellulaire fraîche (repiquage de puits à puits). L'inoculation peut être précédée d'une préincubation des dilutions avec le sérum antivirus de la NPI à la dilution appropriée, comme décrit au point I.4.3.

Les cultures inoculées doivent ensuite être incubées à 15 °C pendant sept à dix jours, puis examinées comme indiqué au point I.5.4.

Si un ECP toxique se manifeste au cours des trois premiers jours d'incubation, un repiquage doit être effectué à ce stade, mais les cellules doivent alors être incubées pendant sept jours puis repiquées à nouveau et soumises à une nouvelle période d'incubation de sept jours. Lorsqu'un ECP toxique se manifeste après trois jours, les cellules doivent être repiquées une fois puis incubées jusqu'à ce que se soient écoulés au total quatorze jours à partir de l'inoculation primaire. Aucun signe de toxicité ne doit se manifester au cours des sept derniers jours d'incubation.

Si une contamination bactérienne se produit malgré le traitement antibiotique, le repiquage doit être précédé d'une centrifugation à 2 000-4 000 g pendant 15 à 30 minutes à une température comprise entre 2 et 5 °C, ou d'une filtration du surnageant à travers un filtre de 0,45 μm, ou bien des deux à la fois (membrane à faible capacité de liaison des protéines). En outre, le repiquage doit être réalisé suivant les mêmes procédures que celles décrites pour l'apparition d'un ECP toxique au quatrième alinéa du présent point.

Si aucun ECP ne se manifeste, le test est réputé négatif.

I.6.   Identification du virus

Si un ECP a été observé dans une culture cellulaire, le milieu (surnageant) doit être recueilli et examiné par une ou plusieurs des techniques suivantes: méthode immunoenzymatique (ELISA), test d'immunofluorescence (IF), neutralisation, RT-PCR ou RT-qPCR. Si ces méthodes n'ont pas permis d'identifier le virus de façon certaine dans un délai d'une semaine, le surnageant doit être envoyé au laboratoire de référence national ou au laboratoire de référence de l'Union pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE en vue d'une identification immédiate.

I.6.1.   ELISA

Un test ELISA en double sandwich doit être réalisé pour identifier l'isolat de virus. Les plaques de micropuits sont enduites à raison de 50 μl/puits (0,9 pg) d'une solution d'immunoglobulines (Ig) de sérums anti-NHI ou anti-SHV de lapin purifiées à la protéine A, de qualité reconnue, diluées dans un tampon de carbonate (pH 9,6) contenant 15 mM d'azoture de sodium, puis incubées à 4 °C pour une durée comprise entre 18 heures et 2 semaines.

Sur une plaque de dilution, chaque échantillon contenant 1 % de Triton X-100 et les témoins positifs doit être dilué à l'aide de la solution tampon [à savoir une solution saline tamponnée au phosphate (PBS)-T-BSA, 1 % BSA] dans un rapport de dilution de 4 (1:4, 1:16, 1:64). Les plaques ELISA doivent être lavées dans du PBS contenant 0,05 % de Tween 20 (PBS-T) et 50 μl de chaque dilution doivent être transférés de la plaque de dilution vers la plaque ELISA lavée et enduite.

Les plaques ELISA doivent ensuite être incubées pendant 30 minutes à 37 °C, avant d'être lavées et incubées 30 minutes à 37 °C en présence d'anticorps monoclonaux (AcM) spécifiques (à savoir IP5B11 pour l'identification du virus de la SHV et HYB-136-3 pour celle du virus de la NHI). 50 μl d'anticorps anti-souris de lapin conjugués à de la peroxydase de raifort (HRP) dilués au 1:1 000 dans du PBS-T-BSA doivent être transférés sur la plaque ELISA.

Enfin, après nouveau lavage, les réactions sont déclenchées par addition de 50 μl d'orthophénylènediamine (OPD) dans chaque puits. Les plaques ELISA doivent être incubées pendant 20 minutes à température ambiante dans l'obscurité, et la réaction doit être arrêtée par addition de 100 μl de H2SO4 0,5 M par puits.

L'absorbance doit être contrôlée à la longueur d'onde de 492 puis de 620 nm dans un lecteur ELISA. Les échantillons sont déclarés positifs ou négatifs après comparaison des résultats aux valeurs d'absorbance des témoins positifs et négatifs. En règle générale, les échantillons présentant une absorbance totale (A) < 0,5 pour du matériel non dilué sont considérés comme étant négatifs; les échantillons dont les valeurs A sont comprises entre 0,5 et 1,0 sont considérés comme suspects et les échantillons avec valeurs A > 1,0 sont considérés comme positifs.

D'autres versions de la technique ELISA d'une efficacité similaire avérée peuvent être utilisées en lieu et place de celles mentionnées au présent point.

I.6.2.   Immunofluorescence (IF)

L'identification des agents pathogènes répertoriés que sont les virus de la SHV et de la NHI doit être réalisée en infectant des cellules dans des plaques 96 puits «Black» ou des plaques 24 puits classiques, ou sur lamelles dans des plaques 24 puits. Si l'identification du virus de la NHI ou de la SHV, ou des deux, s'effectue par infection de cellules sur des lamelles, le protocole suivant doit être appliqué:

a)

les lamelles doivent être ensemencées lorsque les cellules sont entre 60 et 90 % de confluence après 24 heures de culture. On utilisera de préférence des cellules EPC en raison de leur forte adhérence aux surfaces de verre, mais d'autres lignées cellulaires, telles que BF-2, RTG-2 ou FHM, peuvent également être utilisées. On inoculera 150 μl de surnageant de culture cellulaire à deux dilutions différentes (1:10 et 1:1 000) en deux exemplaires à des cultures monocouches âgées d'un jour qui sont ensuite incubées à 15 °C pendant 24 heures;

b)

le milieu de culture cellulaire est ensuite éliminé, et les monocouches de cellules infectées sont fixées avec 0,5 ml d'une solution aqueuse d'acétone glacée (80 % v/v). La fixation doit avoir lieu sous hotte pendant 15 minutes à la température ambiante, puis la solution d'acétone doit être éliminée et les lamelles séchées à l'air pendant au moins 30 minutes. À ce stade, les plaques doivent être traitées immédiatement ou bien stockées à une température de – 20 °C en vue d'une utilisation ultérieure;

c)

les anticorps monoclonaux spécifiques (à savoir IP5B11 pour le virus de la SHV et HYB-136-3 pour le virus de la NHI) doivent être dilués dans du PBST 0,01 M, à pH 7,2, à la dilution recommandée par le fournisseur des AcM; ils doivent ensuite être ajoutés aux cultures monocouches fixées, à raison de 50 à 100 μl/puits, et les plaques doivent ensuite être incubées pendant une heure à 37 °C dans une étuve humide;

d)

les lamelles doivent être rincées en douceur trois fois dans du PBS contenant 0,05 % de Tween 20 (PBS-T), et le tampon doit être totalement éliminé après le dernier rinçage. Les cellules doivent ensuite être incubées pendant une heure à 37 °C avec des anticorps anti-immunoglobulines de souris conjugués à de l'isothiocyanate de fluorescéine (FITC) ou du tétraméthylrhodamine-5-(et 6-)isothiocyanate (TRITC), utilisés comme anticorps primaires, dilués conformément aux instructions du fournisseur, avant nouveau rinçage au PBS-T puis séchage. Les cultures colorées doivent être montées sur lames de verre à l'aide d'une solution saline de glycérol puis examinées en lumière ultraviolette incidente. Utiliser des oculaires 10 × ou 12 × et des lentilles d'objectif × 25 ou × 40, dont les ouvertures numériques sont respectivement > 0,7 et > 1,3.

Il est aussi possible de recourir à d'autres techniques d'IF (pour ce qui est des cultures cellulaires, de la fixation et des anticorps de référence) d'efficacité équivalente avérée.

I.6.3.   Neutralisation

Les cellules présentes dans le surnageant recueilli doivent être éliminées par centrifugation (entre 2 000 et 4 000 g) ou par filtration sur membrane (0,45 μm) à l'aide d'une membrane à faible capacité de liaison des protéines, puis le surnageant doit être dilué au 1:100 et au 1:10 000 dans le milieu de culture.

Des parties aliquotes d'au moins deux dilutions du surnageant doivent être mélangées et incubées séparément pendant 60 minutes à 15 °C avec des parties égales des réactifs suivants:

a)

du sérum contenant l'anticorps spécifique de groupe contre le virus de la SHV, à une dilution de 1:50 (v:v),

b)

du sérum contenant l'anticorps spécifique de groupe contre le virus de la NHI, à une dilution de 1:50 (v:v),

c)

un lot d'antisérums anti-sérotypes indigènes du virus de la NPI, à une dilution de 1:50 (v:v),

d)

le milieu seul (témoin positif).

Au moins deux cultures cellulaires doivent être inoculées à l'aide de 50 μl du mélange surnageant-sérum de chaque virus, puis incubées à 15 °C. L'apparition de l'ECP doit être vérifiée comme indiqué au point I.5.4.

Les souches et les isolats du virus de la SHV qui ne réagissent pas dans les tests de neutralisation doivent être identifiés par les techniques IF ou ELISA.

D'autres tests de neutralisation présentant une efficacité similaire avérée peuvent aussi être utilisés.

I.6.4.   RT-PCR/RT-qPCR

I.6.4.1.   Préparation de l'ARN viral

Toutes les manipulations sur l'ARN doivent être réalisées sur de la glace, et des gants doivent être utilisés.

L'ARN doit être extrait par la méthode phénol/chloroforme ou par chromatographie d'affinité sur colonnes, selon les instructions du fabricant. Il est possible d'utiliser les kits d'extraction de l'ARN disponibles dans le commerce, qui permettent d'obtenir un ARN de qualité utilisable dans les protocoles de RT-PCR détaillés ci-après.

L'ARN doit être remis en suspension dans de l'eau distillée exempte d'ARNase (c.-à-d. de l'eau traitée avec du pyrocarbonate de diéthyle à 0,1 %) ou un tampon d'élution approprié.

I.6.4.2.   RT-PCR

Les amorces suivantes doivent être utilisées pour la détection du VNHI:

 

amorce sens 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′;

 

amorce antisens 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.

Les cycles suivants doivent être utilisés (RT-PCR en une seule étape): 1 cycle: 50 °C pendant 30 minutes; 1 cycle: 95 °C pendant 2 minutes; 30 cycles: 95 °C pendant 30 secondes, 50 °C pendant 30 secondes, 72 °C pendant 60 secondes; 1 cycle: 72 °C pendant 7 minutes et trempage à 4 °C.

Les amorces suivantes doivent être utilisées pour la détection du VSHV:

 

VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′;

 

VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.

Les cycles suivants doivent être utilisés (RT-PCR en une seule étape): 50 °C pendant 30 minutes, 95 °C pendant 15 minutes, 35 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 68 °C pendant 60 secondes. La réaction doit être ensuite maintenue à une température de 68 °C pendant 7 minutes.

La quantité et la spécificité des réactions de RT-PCR doivent être évaluées par électrophorèse sur gel d'agarose à 1,5 % à l'aide de bromure d'éthidium, et les produits des réactions doivent être observés en lumière UV. Un amplicon de PCR de 693 paires de bases (pb) peut être observé pour le VNHI. Pour le VSHV, la taille de l'amplicon peut atteindre 505 pb.

Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. Afin de dissiper tout doute, il convient de prévoir des témoins positifs et négatifs et des amplicons de séquences appropriés. En ce qui concerne les amorces du VSHV, l'utilisation de cellules BF-2 nécessite une attention particulière, car les amorces peuvent réagir avec l'ADN/l'ARN de la lignée cellulaire et produire des faux-positifs de même taille. Si le test est réalisé sur du surnageant provenant de cellules BF-2, tous les fragments amplifiés par PCR doivent être séquencés.

I.6.4.3.   RT-qPCR pour le VSHV

Pour le VSHV, l'amplification doit être réalisée à l'aide de la sonde et des amorces suivantes:

 

amorce sens: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′;

 

amorce antisens: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′;

 

et sonde: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

RT-qPCR en une étape:

À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles: 50 °C pendant 30 minutes, 95 °C pendant 15 minutes, 40 cycles de 94 °C pendant 15 secondes, 60 °C pendant 40 secondes et 72 °C pendant 20 secondes, à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

I.6.4.4.   RT-qPCR pour le VNHI

Pour le VNHI, l'amplification doit être réalisée à l'aide de la sonde et des amorces suivantes:

 

amorce sens: 5′-AGA-GCC-AAG-GCA-CTG-TGC-G-3′;

 

amorce antisens: 5′-TTCTTTGCGGCTTGGTTGA-3′;

 

et sonde: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.

RT-qPCR en deux étapes:

L'analyse reposant sur une amplification en deux étapes, des précautions doivent être prises lors de la manutention des tubes entre les réactions, afin d'éviter toute contamination.

Succession de cycles (après l'étape de la transcription inverse): 50 °C pendant 2 minutes, 95 °C pendant 10 minutes, puis 40 cycles de 95 °C pendant 15 secondes et 60 °C pendant 1 minute, à adapter si nécessaire.

D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

II.   Méthodes et procédures de diagnostic détaillées pour écarter une suspicion de SHV ou de NHI ou des deux maladies, ou pour confirmer la présence d'une de ces maladies ou des deux

Lorsqu'un examen de laboratoire est requis pour confirmer ou exclure la présence de la NHI ou de la SHV, ou de ces deux maladies à la fois, conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic établies à l'annexe I, partie 1, point II.3, les méthodes et procédures de diagnostic détaillées suivantes doivent être appliquées:

a)

isolement classique du virus suivi d'une identification de celui-ci par séroneutralisation ou par technique immunochimique ou moléculaire;

b)

détection du virus par RT-PCR ou RT-qPCR;

c)

autres techniques de diagnostic, telles que IFAT, ELISA, RT-PCR, IHC.

II.1.   Isolement classique du virus suivi de son identification

II.1.1.   Sélection des échantillons

Au moins dix poissons présentant des signes typiques de NHI ou de SHV doivent être sélectionnés pour un examen.

II.1.2.   Préparation et expédition des échantillons de poissons

La préparation et l'expédition aux fins de l'isolement classique du virus doivent être effectuées selon les méthodes et procédures indiquées au point I.2.

II.1.3.   Collecte de matériel de diagnostic supplémentaire

La collecte de matériel supplémentaire aux fins de l'isolement classique du virus doit être réalisée selon les méthodes et procédures indiquées au point I.3.

II.1.4.   Préparation des échantillons en vue de l'examen de cultures cellulaires

La préparation des échantillons en vue de l'examen de cultures cellulaires aux fins de l'isolement classique du virus doit être effectuée selon les méthodes et procédures indiquées au point I.4.

II.1.5.   Examen virologique sur culture cellulaire

L'examen virologique aux fins de l'isolement classique du virus doit être effectué selon les méthodes et procédures indiquées au point I.5.

II.1.6.   Identification du virus

L'identification du virus aux fins de son isolement classique doit être effectuée selon les méthodes et procédures indiquées au point I.6.

II.2.   Détection du virus par RT-qPCR

II.2.1.   Sélection des échantillons

La sélection des échantillons aux fins de la détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées au point I.1.2.

II.2.2.   Préparation et expédition des échantillons de poisson

La préparation et l'expédition des échantillons aux fins de la détection du virus par RT-qPCR doivent être réalisées selon les méthodes et procédures indiquées au point I.2.

II.2.3.   Collecte de matériel de diagnostic supplémentaire

La collecte de matériel de diagnostic supplémentaire aux fins de la détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées au point I.3.

II.2.4.   Préparation des échantillons pour la RT-qPCR

La préparation des échantillons aux fins de la détection du virus par RT-qPCR doit être réalisée selon les méthodes et procédures indiquées au point I.6.4.1.

II.2.5.   RT-qPCR

La détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées aux points I.6.4.1, I.6.4.3 et I.6.4.4.

II.3.   Autres techniques de diagnostic

Le surnageant préparé comme indiqué au point I.4.3 peut être soumis à un test ELISA, à un test d'immunofluorescence indirecte (IFAT) ou à une analyse par RT-PCR conformément aux instructions figurant respectivement aux points I.6.1, I.6.2 ou I.6.4. Les tissus peuvent être soumis à d'autres techniques de diagnostic telles que l'IFAT sur coupes congelées ou l'analyse immunohistochimique sur tissus fixés au formol. Ces techniques rapides doivent être complétées par un examen virologique conformément au point II a) ou au point II b), dans les 48 heures suivant l'échantillonnage:

a)

si un résultat négatif a été obtenu ou

b)

si un résultat positif a été obtenu avec un matériel représentant le premier cas de NHI ou SHV.

III.   Titrage destiné à vérifier la sensibilité des cultures cellulaires à l'infection

Lors du titrage destiné à vérifier la sensibilité des cultures cellulaires à l'infection visé au point I.5.3, les procédures décrites ci-après doivent être respectées.

Il convient d'utiliser au moins deux isolats de VSHV et un isolat de VNHI. Ces isolats doivent être représentatifs des principaux groupes de virus dans l'Union européenne, à savoir, en ce qui concerne le VSHV, un isolat pathogène issu de truite arc-en-ciel évoluant en eau douce et un isolat pathogène de turbot évoluant en eau de mer et, en ce qui concerne le VNHI, une souche pathogène de truite arc-en-ciel provenant de l'Union européenne. Il convient d'utiliser des isolats bien définis provenant des États membres. Des lots de virus ayant subi un petit nombre de passages sont propagés, dans des flacons de culture cellulaire, sur des cellules BF-2 ou RTG-2 dans le cas du VSHV, et sur des cellules EPC ou FHM dans le cas du VNHI. Il convient d'utiliser un milieu de culture contenant au moins 10 % de sérum. Pour l'inoculation, la multiplicité d'infection doit être faible (< 1).

Lorsque l'ECP est total, le virus est récolté par centrifugation du surnageant de la culture cellulaire à 2 000 g pendant quinze minutes, stérilisé et filtré à travers une membrane de 0,45 μm, puis réparti dans des cryotubes étiquetés. Le virus doit être conservé à – 80 °C.

Une semaine après la congélation, trois fioles de chaque virus sont décongelées sous eau froide et titrées sur leurs lignées cellulaires respectives. Chaque isolat de virus doit être décongelé et titré tous les six mois au moins, ou dès que l'on suspecte une diminution de la sensibilité d'une lignée cellulaire.

Les procédures de titrage doivent être décrites en détail et la même procédure doit être appliquée à chaque fois.

Le titrage par dilution limite doit comprendre au moins six réplicats de chaque série de dilutions. Les titres doivent être comparés à ceux obtenus antérieurement. Si le titre d'un des trois isolats viraux baisse d'un facteur 100 ou plus par rapport au titre initial, la lignée cellulaire ne doit plus être utilisée à des fins de surveillance.

Si différentes lignées cellulaires sont conservées au laboratoire, chaque lignée doit être examinée séparément.

Des registres sont conservés pendant dix ans au moins.

PARTIE 2

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'HERPÈSVIROSE DE LA CARPE KOÏ (HVCK)

I.   Méthodes et procédures de diagnostic détaillées pour écarter une suspicion d'HVCK ou confirmer la présence de cette maladie

Lorsqu'un examen de laboratoire est requis pour confirmer la présence de l'HVCK ou pour écarter une suspicion de cette maladie, conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic établies à l'annexe I, partie 2, section III, les méthodes et procédures de diagnostic détaillées indiquées aux points I.1 à I.2 de la présente partie doivent être appliquées.

I.1.   Préparation des échantillons de poissons

À des fins de diagnostic, il est possible d'utiliser des poissons (expédiés vivants ou morts et emballés séparément dans des conteneurs aseptiques hermétiques) ou bien des organes ou des morceaux d'organes congelés conservés dans de l'éthanol de concentration comprise entre 80 % et la concentration de l'éthanol absolu, ou dans un milieu de transport viral (en vue d'un traitement dans les 48 heures suivant le prélèvement) pour procéder aux essais par des méthodes fondées sur la PCR classique ou la qPCR.

Pour la détection de l'HVK, les branchies et les reins doivent être prélevés; en outre, la rate, l'encéphale et les intestins peuvent être inclus dans un échantillon supplémentaire distinct. En cas d'infection aiguë, il est possible de regrouper des tissus provenant de cinq poissons au maximum.

De surcroît, des échantillons non létaux tels que du sang, des frottis et des biopsies de branchies et des prélèvements de mucus peuvent être utilisés dans certains cas (c'est-à-dire que des poissons de grande valeur peuvent être utilisés lorsque l'on suspecte la présence de l'HVK).

I.1.1.   Extraction de l'ADN

L'ADN doit être extrait conformément aux procédures standard.

Il est possible d'utiliser les kits d'extraction de l'ADN disponibles dans le commerce, qui permettent d'obtenir un ADN de qualité utilisable dans les protocoles de PCR décrits au point I.2.

I.2.   Détection et identification de l'agent infectieux par des méthodes basées sur l'amplification en chaîne par polymérase (PCR)

I.2.1.   qPCR pour la détection de l'HVK

Pour la détection de l'HVK par qPCR, le protocole suivant doit être appliqué:

 

amorce sens (KHV-86f): 5′-GACGCCGGAGACCTTGTG-3′;

 

amorce antisens (KHV-163r): 5′-CGGGTTCTTATTTTTGTCCTTGTT-3′

 

et sonde (KHV-109p): 5′-FAM-CTTCCTCTGCTCGGCGAGCACG-3′.

Succession de cycles: un cycle de 95 °C pendant 15 minutes, suivi de 40 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

I.2.2.   PCR classique pour la détection de l'HVK

Le protocole décrit au présent point, qui cible le gène codant pour la thymine kinase (TK) de l'HVK, doit être utilisé. Toutefois, d'autres protocoles de PCR dont la sensibilité et la spécificité sont, de toute évidence, similaires à celles du protocole décrit peuvent être utilisés à la place de ce dernier.

 

Amorce sens (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′;

 

amorce antisens (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.

Succession de cycles: un cycle de 95 °C pendant 5 minutes, suivi de 35 cycles de 95 °C pendant 30 secondes, 52 °C pendant 30 secondes et 72 °C pendant une minute et d'un cycle de 72 °C pendant 10 minutes. La taille du produit doit être de 409 bp.

Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

La première détection du virus dans une zone doit être confirmée par séquençage ou par envoi d'échantillons à un laboratoire de référence national ou au laboratoire de référence de l'Union pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE en vue d'une identification immédiate.

II.   Méthodes et procédures de diagnostic détaillées pour la surveillance de l'HVCK

Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou du maintien d'un statut sanitaire donné en ce qui concerne l'HVCK comme indiqué à l'annexe I, partie 2, section I, à l'aide des méthodes de diagnostic décrites dans la partie 2, sections II ou III, de ladite annexe, les méthodes et procédures de diagnostic figurant aux points II.1 et II.2 de la présente partie doivent être appliquées.

II.1.   Préparation des échantillons de poisson

Dans la mesure du possible, les poissons qui ont été maintenus longtemps à des températures propices au développement du virus (c'est-à-dire entre 15 et 26 °C pendant deux à trois semaines) doivent faire l'objet d'un échantillonnage. Si possible, les échantillons doivent être prélevés au minimum 24 heures et au maximum 72 heures après des pratiques de gestion susceptibles de réactiver le virus dans les poissons vecteurs, telles que la capture en filet ou le transport, afin d'augmenter les chances de détection de l'HVK.

Aux fins de la surveillance de l'HVCK, les poissons peuvent être expédiés vivants ou morts et emballés séparément dans des conteneurs aseptiques hermétiques; sinon, il est aussi possible d'utiliser des organes ou des morceaux d'organes congelés conservés dans de l'alcool de concentration comprise entre 80 % et 100 % ou dans un milieu de transport viral (en vue d'un traitement dans les 48 heures suivant le prélèvement) pour des tests par des méthodes fondées sur la PCR. Pour la surveillance de l'HVCK, les branchies et les reins doivent être prélevés.

Le regroupement de tissus de plusieurs poissons doit être évité dans la mesure du possible. Si ce regroupement est nécessaire, il ne portera que sur deux poissons au maximum. Les échantillons de plus grande taille doivent être homogénéisés au moyen d'un ensemble mortier-pilon ou d'un malaxeur, et des sous-échantillons devront être prélevés avant la clarification en vue de l'extraction de l'ADN. Une autre solution consiste à prélever des sous-échantillons de chaque tissu présent dans l'échantillon et à les placer dans des tubes de lyse.

II.1.1.   Extraction de l'ADN

L'ADN doit être extrait conformément aux procédures standard. Il est possible d'utiliser les kits d'extraction de l'ADN disponibles dans le commerce, qui permettent d'obtenir un ADN de qualité utilisable dans les protocoles de PCR décrits au point II.2.

Le rapport acceptable entre les tissus et le milieu est de 1:9 p/v. Les essais doivent porter sur 20 à 25 mg de tissus.

II.2.   Surveillance de l'HVCK par méthodes fondées sur la PCR

Pour la surveillance de l'HVCK, il y a lieu de recourir à la qPCR. Si des échantillons positifs apparaissent dans une zone qui n'a pas été préalablement confirmée positive, les résultats de l'essai doivent être confirmés:

a)

par séquençage d'un produit de PCR ou de PCR nichée («nested PCR») obtenu à partir des échantillons.

La séquence consensus obtenue doit coïncider (à 98 % au moins) avec les séquences de référence;

b)

ou par envoi des échantillons à un laboratoire national de référence.

II.2.1.   qPCR pour la détection de l'HVK

Le protocole de qPCR décrit ci-dessous doit être appliqué:

 

amorce sens (KHV-86f): 5′-GACGCCGGAGACCTTGTG-3′;

 

amorce antisens (KHV-163r): 5′-CGGGTTCTTATTTTTGTCCTTGTT-3′

 

et sonde (KHV-109p): 5′-FAM-CTTCCTCTGCTCGGCGAGCACG-3′.

Succession de cycles: un cycle de 95 °C pendant 15 minutes, suivi de 50 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes.

Les résultats de la qPCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

II.2.2.   PCR classique pour confirmer la détection de l'HVK

Pour confirmer la présence d'une infection par l'HVK, le protocole générique de PCR nichée décrit dans le tableau 2.1 ci-dessous doit être utilisé, suivi d'un séquençage du produit d'amplification.

Tableau 2.1

Amorces et conditions pour le protocole de PCR nichée ciblant tous les herpèsvirus des cyprinidés (CyHV-1, CyHV-2 et CyHV-3)

Nom de l'amorce

Séquence

Succession de cycles

Taille du produit

CyHVpol-sens

5′-CCAGCAACATGTGCGACGG-3′

Première phase de PCR

1 cycle:

95 °C pendant 2 minutes

40 cycles:

 

95 °C pendant 30 secondes

 

55 °C pendant 30 secondes

 

72 °C pendant 45 secondes

1 cycle:

72 °C pendant 10 minutes.

362 pb

CyHVpol-antisens

5′-CCGTARTGAGAGTTGGCGCA-3′

CyHVpol-interne sens

5′-CGACGGVGGYATCAGCCC-3′

Deuxième phase de PCR

1 cycle:

95 °C pendant 2 minutes

40 cycles:

 

95 °C pendant 30 secondes

 

55 °C pendant 30 secondes

 

72 °C pendant 45 secondes

1 cycle:

72 °C pendant 10 minutes.

339 pb

CyHVpol-interne antisens

5′-GAGTTGGCGCAYACYTTCATC-3′

Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. D'autres versions de PCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

Le séquençage peut être effectué par le laboratoire ou confié à des sociétés extérieures spécialisées. Les résultats du séquençage doivent être analysés en comparant les séquences aux séquences de référence connues de l'HVK (numéros d'accès à GenBank AP008984, DQ657948 et DQ177346). La séquence consensus obtenue doit coïncider à 98 % au moins avec ces séquences de référence.

PARTIE 3

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'ANÉMIE INFECTIEUSE DU SAUMON (AIS)

I.   Procédures d'échantillonnage pour la surveillance de l'AIS et la lutte contre cette maladie

Lors du prélèvement d'échantillons et des examens de laboratoire réalisés aux fins des programmes de surveillance ou d'éradication décrits à l'annexe I, partie 3, ou en vue de confirmer la présence de l'AIS ou d'écarter une suspicion d'AIS conformément à l'article 57, point b), de la directive 2006/88/CE, les méthodes et procédures détaillées établies aux points I.1, I.2 et I.3 de la présente section doivent être appliquées.

I.1.   Préparation des échantillons de poisson

Aux fins des examens de laboratoire visant à détecter un foyer d'AIS, les échantillons de poisson ne doivent pas être regroupés, dans la mesure du possible. Toutefois, aux fins de la surveillance de l'AIS, le regroupement de 2 à 5 poissons est acceptable.

Des échantillons destinés à l'analyse par amplification en chaîne par polymérase en présence d'une transcriptase inverse (RT-PCR) doivent être prélevés sur tous les poissons présents dans l'échantillon. Un morceau de rein médian doit être prélevé sur chaque poisson à l'aide d'un instrument stérile et transféré dans un microtube de centrifugation contenant 1 ml de solution de conservation de l'ARN d'efficacité avérée. Les tissus de cinq poissons au maximum peuvent être regroupés dans un tube de solution de transport pour constituer un échantillon global. Le poids de tissu d'un échantillon doit être de 0,5 g. Quand les poissons sont trop petits pour constituer un échantillon pesant le poids requis, il est possible d'ajouter, par ordre de préférence, des morceaux de rein, de cœur, de rate, de foie ou de cæcum pylorique pour atteindre 0,5 g.

Les tissus destinés à l'examen histologique doivent être prélevés uniquement sur des poissons fraîchement sacrifiés de constitution normale, sur des poissons présentant des signes cliniques compatibles avec l'AIS ou sur des poissons ayant fait l'objet de constatations post-mortem compatibles avec la présence de l'AIS. Toute lésion externe ou interne constatée doit donner lieu au prélèvement de l'individu concerné, et dans tous les cas, des échantillons de rein médian, de cœur, de foie, de pancréas, d'intestin, de branchies et de rate doivent être prélevés sur chaque poisson à l'aide d'un scalpel et transférés dans une solution saline tamponnée de formol à 8-10 % (v/v). Le rapport entre le fixateur et les tissus doit être d'au moins 20:1 pour garantir une conservation satisfaisante des tissus. En vue d'une analyse immunohistochimique (IHC), des échantillons de rein médian et de cœur doivent être prélevés.

Les tissus destinés à l'examen virologique sur culture cellulaire doivent être prélevés sur tous les poissons présents dans les échantillons. Des morceaux de foie, de rein antérieur ou médian, de cœur et de rate doivent être prélevés sur les poissons à l'aide d'un instrument stérile et transférés dans des tubes en plastique contenant 9 ml de milieu de transport. Des tissus prélevés sur cinq poissons au maximum peuvent être rassemblés dans un tube contenant une solution de transport pour constituer un échantillon global. Le poids de tissu d'un échantillon doit être de 1,0 ± 0,5 g.

I.2.   Expédition des échantillons de poissons

Des poissons entiers peuvent être envoyés au laboratoire si les conditions de température pendant le transport qui sont décrites au paragraphe 3 du présent point peuvent être respectées. Les poissons entiers doivent être enveloppés dans du papier absorbant et expédiés dans un sac en plastique, réfrigéré comme indiqué dans ledit paragraphe.

Des poissons vivants peuvent également être expédiés, mais uniquement sous la supervision du laboratoire de référence national pour les maladies des poissons et compte tenu des règles supplémentaires de désinfection et de biosécurité applicables lors du transport de poissons vivants.

Les échantillons de sang et les tubes contenant les tissus de poisson destinés à l'examen virologique ou à l'analyse par RT-PCR doivent être placés dans des récipients isolés, tels que des boîtes en polystyrène à parois épaisses, contenant une quantité suffisante de glace ou de blocs réfrigérants pour garantir la réfrigération des échantillons pendant le transport vers le laboratoire. La congélation doit être évitée et le récipient de transport doit encore contenir de la glace lors de sa réception, ou bien un ou plusieurs des blocs réfrigérants doivent être encore partiellement ou totalement congelés. Exceptionnellement, les échantillons destinés à l'analyse par RT-PCR et ceux destinés à l'examen virologique peuvent être surgelés et transportés vers le laboratoire à une température inférieure ou égale à – 20 °C.

Pour l'analyse l'ultérieure par RT-PCR de tissus conservés dans du réactif de stabilisation de l'ARN (RNAlater), l'extraction de l'ARN doit être réalisée dans les délais indiqués ci-dessous, en fonction de la température de stockage des échantillons:

 

échantillons stockés à 37 °C: dans un délai d'un jour;

 

échantillons stockés à 25 °C: dans un délai d'une semaine;

 

échantillons stockés à 4 °C: dans un délai d'un mois;

 

échantillons stockés à – 20 °C: délai indéterminé.

Si les tissus de poisson sont transportés dans du fixateur pour examen histologique, ils doivent être expédiés dans des tubes étanches placés dans des récipients résistant aux chocs. Il y a toutefois lieu d'éviter la congélation de ces échantillons.

L'examen virologique sur culture cellulaire doit commencer dès que possible et au plus tard 48 heures après le prélèvement des échantillons. Dans des cas exceptionnels, l'examen virologique peut commencer au plus tard 72 heures après la collecte du matériel à examiner à condition que celui-ci soit conservé dans le milieu de transport et que les conditions de température requises pendant le transport aient pu être respectées.

I.3.   Collecte de matériel de diagnostic supplémentaire

Sous réserve de l'approbation du laboratoire de diagnostic, des tissus de poisson autres que ceux visés au point I.1 peuvent être collectés et préparés en vue d'un examen supplémentaire.

II.   Méthodes et procédures de diagnostic détaillées pour la surveillance de l'AIS et pour confirmer la présence de l'AIS ou écarter une suspicion de cette maladie

Lorsque des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne l'AIS comme indiqué à l'annexe I, partie 3, section I, ou afin de confirmer la présence de l'AIS ou d'écarter une suspicion d'AIS conformément à l'article 57, point b), de la directive 2006/88/CE à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 3, section II, les méthodes et procédures détaillées figurant aux points II.1 à II.5 ci-après doivent être appliquées.

II.1.   Examen des échantillons par RT-PCR

La méthode de diagnostic à utiliser pour la détection du VAIS est la RT-qPCR. Étant donné que les résultats de la RT-pPCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, il y a lieu de prévoir des témoins positifs et négatifs et des amplicons adéquats afin de dissiper tout doute.

II.1.1.   Extraction de l'ARN total

Toutes les manipulations sur l'ARN doivent être réalisées sur de la glace, et des gants doivent être utilisés.

L'ARN total doit être extrait par la méthode phénol/chloroforme ou par chromatographie d'affinité sur colonnes, selon les instructions du fabricant.

L'ARN purifié doit être remis en suspension dans de l'eau distillée exempte d'ARNase (c.-à-d. de l'eau traitée avec du pyrocarbonate de diéthyle à 0,1 %).

La concentration et la pureté de l'ARN extrait doivent être évaluées en mesurant la densité optique à 260 nm et à 280 nm. Il est également possible d'inclure des témoins internes ciblés contre le génome viral comme indiqué au point II.1.3.

II.1.2.   RT-PCR pour la détection du VAIS

Plusieurs méthodes de RT-PCR peuvent être utilisées pour l'amplification du génome du VAIS. Il est possible de procéder à une RT-PCR en deux étapes en réalisant les réactions de RT et de PCR dans deux tubes distincts. Toutefois, une réaction en une seule étape, dans laquelle les deux réactions sont réalisées dans un seul tube, est également possible. La méthode en une étape doit être privilégiée dans la mesure du possible car le tube unique réduit au minimum le risque de contamination croisée, puisque tout transfert de contenu est évité; de surcroît, cette méthode est considérée comme étant aussi sensible que la méthode en deux étapes.

Il y a lieu d'utiliser les amorces et le protocole décrit dans le présent point, à savoir la paire d'amorces ILA1 ou ILA2 qui ciblent le segment 8 et qui ont été jugées adéquates pour la détection du VAIS dans des foyers d'infection ainsi que dans les poissons vecteurs. L'amorce antisens ILA2 ne convient pas pour les isolats provenant d'Amérique du Nord et une autre série d'amorces doit être utilisée dans ces cas.

 

Amorce sens (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′;

 

amorce antisens (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.

Succession de cycles: un cycle de 50 °C pendant 30 minutes, 1 cycle de 94 °C pendant 15 minutes, 40 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 72 °C pendant 60 secondes; un cycle de 72 °C pendant 5 minutes. Taille du produit: 155 pb.

Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de RT-PCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

II.1.3.   RT-qPCR pour la détection du VAIS

Le recours à la RT-qPCR peut accroître la spécificité et sans doute aussi la sensibilité. La méthode peut être réalisée plus rapidement car il n'y a pas d'étape d'électrophorèse sur gel, et le risque de contamination croisée est réduit puisqu'il est possible d'estimer la quantité d'ARN génomique viral dans le tube à essai. Un des inconvénients de l'essai par RT-qPCR est qu'il n'est souvent pas possible de séquencer les produits d'amplification. Toutefois, en cas de doute sur la spécificité du produit d'amplification, un autre essai spécifique du VAIS doit être effectué pour vérifier le résultat.

Il y a lieu de recourir à l'essai décrit au présent point, qui cible le segment 8. Cet essai doit être valable pour les isolats provenant de pays de l'Union européenne, de l'Association européenne de libre-échange et d'Amérique du Nord. La méthode en une étape doit être utilisée dans la mesure du possible car l'essai réalisé dans un seul tube réduit le risque de contamination croisée.

 

Amorce sens: 5′-CTACACAGCAGGATGCAGATGT-3′;

 

amorce antisens: 5′-CAGGATGCCGGAAGTCGAT-3′

 

et sonde: 5′-FAM-CATCGTCGCTGCAGTTC–MGBNFQ-3′.

À chaque série d'épreuves de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles: un cycle de 50 °C pendant 30 minutes, un cycle de 95 °C pendant 15 minutes, 40 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes, à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

II.1.4.   Séquençage des produits d'amplification de la PCR

 

Amorce sens (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA-3′;

 

amorce antisens (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA-3′.

À chaque série d'épreuves de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles (RT-PCR en une étape): un cycle de 50 °C pendant 30 minutes, un cycle de 94 °C pendant 15 minutes, 40 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 72 °C pendant 60 secondes, un cycle de 72 °C pendant 5 minutes; à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.

La méthode ci-après peut aussi être utilisée pour le séquençage de la RHP dans le segment 6:

 

Amorce sens: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′;

 

amorce antisens: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′;

 

taille du produit: 304 nt si HPR0.

Il est aussi possible de recourir à des essais par RT-PCR de sensibilité et de spécificité similaires à celles des essais décrits dans le présent point.

La pureté du produit d'amplification par RT-PCR doit être vérifiée par électrophorèse sur gel avant le séquençage. Si un seul fragment pur apparaît, il doit être purifié directement à partir de la réaction de PCR. Si plusieurs fragments amplifiés sont présents, le fragment d'intérêt doit être purifié par électrophorèse sur gel. La purification des fragments amplifiés à partir de solutions ou de gels d'agarose doit être réalisée à l'aide de colonnes de chromatographie d'affinité pour fragments de PCR conformément aux instructions du fabricant.

Le séquençage doit être réalisé à l'aide des amorces d'amplification par des sociétés de séquençage spécialisées extérieures. Les résultats du séquençage doivent être analysés à l'aide de l'outil de recherche BLAST, et les séquences comparées à d'autres séquences connues se trouvant dans la base de données des nucléotides du Centre national d'informations biotechnologiques des États-Unis (NCBI).

Le séquençage doit permettre de dissiper tout doute quant à la spécificité d'un produit amplifié par RT-PCR.

II.2.   Isolement du VAIS en culture cellulaire

II.2.1.   Préparation des échantillons

Les tissus peuvent être conservés à – 80 °C. Ils ne doivent être congelés et décongelés qu'une fois avant examen. Aux fins de la surveillance et des mesures de lutte, l'examen doit être entrepris aussi rapidement que possible.

Chacun des échantillons (regroupement de tissus dans une solution de transport) doit être complètement homogénéisé à l'aide d'un homogénéisateur validé, puis centrifugé entre 2 000 et 4 000 g pendant 15 minutes à une température comprise entre 0 et 6 °C, et le surnageant doit être filtré (0,45 μm) et incubé avec un volume égal d'un ensemble de sérums anti-sérotypes indigènes du virus de la NPI dûment dilués. Le titre de l'antisérum doit être d'au moins 1:2 000 dans un test de neutralisation sur plaque à 50 %. Le mélange doit être incubé pendant une heure à 15 °C; il constitue l'inoculum.

Le traitement de tous les inoculums par un sérum antivirus de la nécrose pancréatique infectieuse (virus qui, dans certaines régions d'Europe, est présent dans 50 % des échantillons de poissons) vise à empêcher l'apparition d'un effet cytopathogène (ECP) dû au virus NPI dans les cultures cellulaires inoculées. Ce traitement peut être effectué pour réduire la durée des examens virologiques ainsi que le nombre de cas où l'apparition d'un ECP devrait être considérée comme une manifestation possible du VAIS. Lorsque les échantillons proviennent d'unités de production considérées comme indemnes de la NPI, le traitement des inoculums par le sérum antivirus de la NPI peut être omis.

II.2.2.   Inoculation des cultures cellulaires

Des cellules de rein de saumon de l'Atlantique (ASK) doivent être utilisées pour l'isolement primaire du VAIS. D'autres lignées cellulaires dont l'efficacité et la sensibilité sont avérées pour l'isolement du VAIS peuvent être utilisées, compte tenu de la variabilité de la souche et de la capacité des différentes souches de se multiplier dans différentes lignées cellulaires. Les cellules ASK semblent supporter l'isolement et la croissance des isolats de virus connus à ce jour, tant que le nombre de passages est faible. Un effet cytopathogène (ECP) peut se manifester plus distinctement dans les cellules ASK que dans d'autres lignées cellulaires sensibles telles que SHK-1 (cellules de rein antérieur de saumon-1).

Des cellules ASK (65 passages au maximum) doivent être cultivées dans un milieu L-15 contenant du sérum fœtal bovin à 10 %, 200 mM de L-glutamine à 2 % (v/v) et 50 mM de 2-mercaptoéthanol à 0,08 % (v/v) dans des plaques multipuits. Une suspension d'organes traitée par antisérum est inoculée à de jeunes cultures cellulaires en phase de croissance active de manière à obtenir une dilution finale du matériel tissulaire dans le milieu de culture de 1:1 000. Pour chaque organe, 40 μl de la suspension d'inoculum sont ajoutés dans un puits contenant 2 ml de milieu de culture. Afin de minimiser le risque de contamination croisée, on utilisera des plaques à 12 ou 24 puits distinctes pour les échantillons provenant de différentes exploitations piscicoles.

Il convient de conserver une plaque non inoculée qui servira de témoin négatif. Une autre plaque doit être inoculée avec un isolat de référence du VAIS, qui servira de témoin positif, comme suit: inoculer 100 μl d'une préparation mère du VAIS [titre minimal 107 Dose infectant 50 % de la culture tissulaire (DICT50 ml – 1)] dans le premier puits et mélanger. Transférer une fraction de ce matériel du premier puits dans le deuxième afin d'obtenir une dilution au 1:10, puis mélanger. Répéter l'opération sur toute la plaque pour obtenir six dilutions au 1:10. La préparation mère du VAIS peut être conservée à – 80 °C pendant au moins deux ans, mais une fois décongelée, elle doit être utilisée dans les trois jours. Des précautions doivent être prises pour éviter la contamination croisée des plaques d'essai par le témoin positif. Pour éviter ce risque, les témoins positifs doivent être constitués et traités séparément des plaques d'essai. Plutôt que de prévoir un témoin positif à chaque inoculation, il est possible de réaliser tous les six mois un essai de sensibilité des cellules d'ASK au VAIS.

Les échantillons doivent être incubés à 15 ± 2 °C pendant une durée maximale de 15 jours. Les cellules doivent être examinées au microscope deux fois pour détecter un ECP, d'abord entre le cinquième et le septième jour, puis entre le douzième et le quatorzième jour après inoculation. Si un ECP est détecté, les procédures d'identification du virus doivent être mises en œuvre immédiatement conformément au point II.2.4. Si aucun ECP n'est observé au quatorzième jour, il y a lieu de procéder à un test d'immunofluorescence indirecte (IFAT), à un test d'hémadsorption ou à une RT-PCR.

II.2.3.   Repiquage

Le repiquage doit être effectué entre le treizième et le quinzième jour. Du surnageant de culture doit être ajouté dans les puits de plaques multipuits contenant des cellules fraîches en phase de croissance active, à la dilution appropriée (1/10), et les plaques doivent ensuite être incubées à 14 ± 2 °C pendant une durée maximale de 18 jours. Les cultures cellulaires doivent être examinées deux fois au microscope pour rechercher un ECP, d'abord entre le cinquième et le septième jour puis entre le quatorzième et le dix-huitième jour après inoculation. Si un ECP est détecté, les procédures d'identification du virus doivent être mises en œuvre immédiatement conformément au point II.2.4. Si aucun ECP n'est observé entre le quatorzième et le dix-huitième jour, il faut procéder à un test d'hémadsorption ou à une RT-PCR.

Si un effet cytotoxique est observé au cours des sept premiers jours suivant l'incubation, il faut procéder à ce stade à un repiquage et incuber les cellules pendant quatorze à dix-huit jours, puis réaliser un nouveau repiquage suivi d'une nouvelle période d'incubation de quatorze à dix-huit jours. Si l'effet cytotoxique apparaît au bout de sept jours, le repiquage n'est effectué qu'une fois et les cellules sont incubées de manière à parvenir à un total de vingt-huit à trente-six jours d'incubation à partir de l'inoculation primaire.

En cas de contamination bactérienne de la culture primaire, le test doit être recommencé avec l'homogénat de tissus conservé à – 80 °C. Avant inoculation, l'homogénat de tissus doit être centrifugé à 4 000 g pendant 15 à 30 minutes à une température comprise entre 0 et 6 °C et le surnageant doit être filtré à 0,22 μm. Si la contamination bactérienne survient pendant l'étape de repiquage, le surnageant doit être filtré à 0,22 μm, puis inoculé à des cellules fraîches qui seront ensuite incubées pendant une nouvelle période de quatorze à dix-huit jours.

II.2.4.   Tests d'identification du virus

Si un ECP est observé à quelque stade que ce soit, ou si le test d'hémadsorption est positif, il faut procéder à l'identification du virus. Les méthodes de prédilection pour l'identification du VAIS sont la RT-PCR conformément au point II.1 et l'immunofluorescence (IF) conformément au point II.2.6. Si l'on soupçonne la présence d'autres virus, des tests supplémentaires d'identification du virus doivent être effectués. Si ces tests n'ont pas permis d'identifier le virus de façon certaine dans un délai d'une semaine, le surnageant doit être envoyé en vue d'une identification immédiate:

a)

au laboratoire de référence de l'Organisation mondiale de la santé animale (OIE) pour l'AIS ou

b)

à un laboratoire national de référence ou au laboratoire de référence de l'Union européenne pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE.

II.2.5.   Hémadsorption

Comme la réplication du VAIS dans des cultures cellulaires n'entraîne pas toujours l'apparition d'un ECP, chaque puits doit être soumis à une épreuve de RT-PCR ou à un test d'hémadsorption conformément au présent point, ou bien à un test IF conformément au point II.2.6.

Du milieu de culture cellulaire doit être prélevé dans chacun des puits, y compris ceux des témoins positifs et négatifs, et placé dans des tubes stériles étiquetés. Ajouter dans chaque puits 500 μl d'une suspension à 0,2 % (v/v) d'hématies de cheval ou de lapin lavées ou d'une suspension à 0,05 % (v/v) d'hématies de truite arc-en-ciel ou de saumon de l'Atlantique lavées, puis incuber à température ambiante pendant 45 minutes. Éliminer les hématies et rincer chaque puits deux fois avec du milieu L-15. Chaque puits doit être examiné au microscope.

La présence d'amas d'érythrocytes adhérant à la surface des cellules d'ASK est révélatrice d'une possible infection par un orthomyxovirus. Si le test d'hémadsorption est positif, un test d'identification du virus doit être réalisé immédiatement conformément au point II.2.4.

II.2.6.   Immunofluorescence (IF)

Des cellules ASK (65 passages au maximum) doivent être cultivées dans du milieu L-15 contenant du sérum fœtal bovin à 10 %, 200 mM de L-glutamine à 2 % (v/v) et 50 mM de 2-mercaptoéthanol à 0,08 % (v/v) dans des plaques multipuits, et doivent être utilisées à plus de 50 % de confluence. Il est également possible d'utiliser d'autres lignées cellulaires ou un autre milieu de culture d'efficacité avérée. Ajouter respectivement 225 μl de surnageant de culture infectée par le virus présumé dans deux puits, mélanger puis transférer 225 μl de chaque puits dans deux autres puits, de façon à obtenir une dilution au 1:5. Deux autres puits non inoculés serviront de témoins. Les échantillons provenant de chaque site d'une ferme piscicole doivent être traités sur des plaques distinctes, de même que les témoins. Un témoin viral doit être constitué à l'aide d'un isolat de référence du VAIS.

Les plaques doivent être incubées à 14 ± 2 °C et examinées au microscope sept jours durant au maximum. Si un ECP précoce est observé ou si aucun ECP n'est observé dans un délai de sept jours, l'étape suivante est la fixation. Les puits doivent être lavés à l'aide d'une solution saline tamponnée au phosphate (PBS) et fixés par incubation avec de l'acétone à 80 % pendant 20 minutes à température ambiante. Les plaques doivent être séchées à l'air puis immédiatement colorées ou bien conservées entre 0 et 6 °C pendant au maximum 24 heures avant coloration.

Les puits répliques doivent être colorés à l'aide d'un mélange d'anticorps monoclonaux (AcM) 3H6F8 et 1OC9F5 anti-VAIS, ou d'autres AcM d'efficacité et de spécificité avérées, dilués dans du PBS, et les plaques doivent être incubées à 37 ± 4 °C pendant 30 minutes. Après élimination des AcM, les plaques doivent être lavées trois fois au Tween 20 à 0,05 % dans du PBS. Des anti-IgG de souris conjuguées à de l'isothiocyanate de fluorescéine (FITC) diluées dans du PBS doivent être ajoutées dans chaque puits et les plaques doivent être incubées à 37 ± 4 °C pendant 30 minutes. Les dilutions des différents lots de conjugués d'AcM et de FITC doivent être optimisées dans chaque laboratoire. Après élimination des anticorps, les plaques doivent être lavées trois fois au Tween 20 à 0,05 % dans du PBS.

Les puits doivent être examinés immédiatement au microscope inversé équipé pour la fluorescence avec un filtre adapté pour exciter le FITC. Le test est considéré comme positif si des cellules fluorescentes sont observées. Pour que le test soit valable, les témoins positifs doivent donner un résultat positif et les témoins négatifs, un résultat négatif.

II.3.   Examen d'autres tissus

La technique visée au point II.2.6 peut être appliquée à d'autres tissus de poisson tels que le foie, la rate et le cœur, à condition qu'une quantité suffisante de cellules endothéliales, de leucocytes ou de lymphocytes puisse être déposée sur la lame. Si la procédure de marquage est la même pour tous les tissus, il peut être préférable pour certains de renoncer à la coloration à l'iodure de propidium et de recourir à l'éclairage en contraste de phase pour identifier les types de cellules présents sur l'empreinte.

II.4.   Analyse histologique

Des coupes de 5 μm d'épaisseur doivent être réalisées à partir des tissus inclus en paraffine, puis colorées à l'hématoxyline et à l'éosine.

Les modifications histologiques observables chez le saumon de l'Atlantique présentant des signes cliniques de la maladie sont variables, mais elles peuvent inclure les éléments suivants:

a)

nombreux érythrocytes dans le sinus veineux central et dans les capillaires lamellaires des branchies, où ces érythrocytes peuvent également former des thrombus;

b)

pétéchies multifocales à confluentes ou nécrose des hépatocytes, ou les deux, à une certaine distance des plus gros vaisseaux du foie; accumulation multifocale d'érythrocytes dans des sinusoïdes hépatiques dilatés;

c)

accumulation d'érythrocytes dans les vaisseaux sanguins de la lamina propria intestinale, pouvant aboutir à une hémorragie de celle-ci;

d)

distension du stroma splénique due à l'accumulation d'érythrocytes;

e)

légère hémorragie interstitielle diffuse multifocale à généralisée avec nécrose tubulaire dans les zones hémorragiques, accumulation d'érythrocytes dans les glomérules rénaux;

f)

érythrophagocytose dans la rate et hémorragies secondaires dans le foie et les reins.

II.5.   Analyse immunohistochimique (IHC)

Des anticorps polyclonaux anti-nucléoprotéines du VAIS doivent être utilisés sur des coupes de tissus fixés au formol et inclus en paraffine. Les organes à examiner sont le rein médian et le cœur (zone de transition, y compris les trois chambres et les valves). Les cas suspects en raison de signes pathologiques doivent être confirmés par un examen IHC positif. Les coupes histologiques doivent être préparées conformément aux méthodes standard.

1.

Préparation des coupes de tissus

Les tissus doivent être fixés à l'aide d'une solution neutre de formol à 10 % tamponnée au phosphate pendant au moins un jour, puis déshydratés dans une série de bains d'éthanol de concentration croissante, rincés au xylène et inclus en paraffine, conformément aux protocoles standard. Des coupes d'environ 5 μm d'épaisseur (pour IHC sur lames traitées à la poly-L-lysine) doivent être chauffées à une température comprise entre 56 et 58 °C (60 °C au maximum) pendant 20 minutes, déparaffinées au xylène, réhydratées dans une série de bains d'éthanol de concentration décroissante, et colorées à l'hématoxyline et à l'éosine en vue d'une analyse pathomorphologique et immunohistochimique conformément au point 2.

2.

Procédure de coloration pour l'IHC

Toutes les incubations doivent être réalisées à la température ambiante sur un agitateur à bascule, sauf disposition contraire prévue dans la présente décision:

a)

la récupération des antigènes doit être réalisée en faisant bouillir les coupes dans un tampon au citrate 0,1 M à pH 6 pendant 2 × 6 minutes, puis en procédant à l'étape de blocage avec 5 % d'extrait sec dégraissé de lait et 2 % de sérum de chèvre dans 50 mM de TBS (TBS; 50 mM de Tris/HCl, 150 mM de NaCl, pH 7,6) pendant 20 minutes;

b)

les coupes doivent ensuite être incubées pendant la nuit avec l'anticorps primaire (anticorps monospécifique de lapin anti-nucléoprotéines de VAIS) dilué dans du TBS additionné de 1 % d'extrait sec dégraissé de lait, puis lavées trois fois dans du TBS contenant du Tween 20 à 0,1 %;

c)

pour la détection des anticorps liés, les coupes doivent être incubées pendant 60 minutes avec des anticorps anti IgG de lapin conjugués à la phosphatase alcaline. Après un dernier rinçage, on ajoute du rouge neutre (1 mg ml– 1) et du Naphtol AS-MX phosphate (0,2 mg ml– 1) avec 1 mM de lévamisole dans 0,1 M de TBS (pH 8,2) et on laisse développer pendant 20 minutes. Les coupes doivent ensuite être lavées à l'eau du robinet avant contre-coloration à l'hématoxyline de Harris puis montage dans un milieu de montage aqueux. Des coupes de tissus positifs et négatifs au VAIS doivent être incluses en tant que témoins à chaque étape.

3.

Interprétation des résultats de l'IHC

Les résultats du test IHC doivent être interprétés comme indiqué aux points a) et b):

a)

les coupes témoins doivent être considérées comme positives lorsqu'on observe une coloration rouge clairement visible du cytoplasme et de l'intérieur du noyau des cellules endothéliales des vaisseaux sanguins de l'endocarde. Une coupe d'échantillon d'essai ne doit être considérée comme positive que si l'on observe cette coloration rouge marquée à l'intérieur du noyau des cellules endothéliales;

b)

les coupes témoins doivent être considérées comme négatives si elles ne présentent aucune réaction de coloration particulière.

Étant donné que la localisation intranucléaire est spécifique des nucléoprotéines de l'orthomyxovirus pendant une étape de la réplication du virus, mais qu'une coloration cytoplasmique concomitante prédomine souvent, des zones de coloration cytoplasmiques et autres sans localisation intranucléaire doivent être considérées comme étant non spécifiques ou non concluantes.

Les plus fortes réactions positives de coloration sont généralement obtenues sur les cellules endothéliales cardiaques et rénales. Il se peut que la coloration des cellules endothéliales soit faible ou inexistante au niveau de lésions hémorragiques très étendues, sans doute en raison de la lyse des cellules endothéliales infectées.

PARTIE 4

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'INFECTION À MARTEILIA REFRINGENS

I.   Méthodes et procédures de diagnostic détaillées pour le diagnostic de l'infection à Marteilia refringens

Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne l'infection à Marteilia refringens comme indiqué à l'annexe I, partie 4, section I, ou afin de confirmer la présence de cette maladie répertoriée ou d'écarter une suspicion de cette maladie conformément à l'article 57, point b), de la directive 2006/88/CE à l'aide des méthodes de diagnostic décrites à l'annexe I, partie 4, section II, les méthodes et procédures détaillées de diagnostic figurant aux points I.1, I.2 et I.3 de la présente partie doivent être appliquées.

I.1.   Procédure d'échantillonnage

Les mollusques bâillants ou qui viennent de mourir doivent être prélevés en priorité afin d'accroître les chances de trouver des animaux infectés.

Une fois prélevées, les huîtres ou les moules doivent être maintenues à 4 °C ou réfrigérées sur de la glace pendant 24 heures au maximum si les échantillons comprennent des mollusques bâillants et pendant 72 heures tout au plus dans le cas contraire, dans un sac en plastique muni d'une étiquette sur laquelle figurent des informations relatives à la nature et à l'origine des huîtres ou des moules. Les mollusques bâillants ou qui viennent de mourir doivent être séparés des autres mollusques.

Une coupe de tissus incluant les branchies et du tissu cardiaque, de 3 à 5 mm d'épaisseur, doit être utilisée pour le diagnostic histologique de Marteilia refringens. Un morceau de la glande digestive doit être utilisé pour certains tests, y compris pour les empreintes et la réaction en chaîne par polymérase (PCR).

I.2.   Techniques microscopiques

I.2.1.   Cytologie (cytologie sur empreinte)

Après séchage des tissus de glande digestive sur du papier absorbant, plusieurs empreintes doivent être réalisées sur une lame de verre. Les lames doivent être séchées à l'air, fixées au méthanol ou à l'éthanol absolu et colorées à l'aide d'un kit de coloration disponible dans le commerce tel que tel que Diff-Quick®/Hemacolor® conformément aux instructions du fabricant. Après rinçage à l'eau du robinet et séchage, les lames doivent être montées avec une lamelle couvre-objet à l'aide d'une résine synthétique appropriée. Les lames doivent être observées dans un premier temps à un grossissement de × 200, puis en immersion dans l'huile, à un grossissement de × 1 000.

Un résultat positif consiste en l'observation de cellules de taille comprise entre 30 et 40 μm. Leur cytoplasme est basophile, tandis que leur noyau est éosinophile. On observe des auréoles pâles autour de gros granules (réfringents) fortement colorés et, sur les cellules de plus grande taille, une organisation du type emboîtement de cellules.

La technique n'est pas spécifique de l'espèce parasite.

I.2.2.   Analyse histologique

Des fragments de tissus incluant branchies, glande digestive, manteau et gonades doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine et coloration, par exemple à l'hématoxyline et à l'éosine. Les observations doivent être effectuées à un grossissement maximal de × 1 000.

Un résultat positif consiste en l'observation de cellules de taille comprise entre 4 et 40 μm. Les premiers stades sont des cellules multinuclées, de forme sphérique à allongée. Ces cellules proviennent principalement de l'épithélium de l'œsophage et de l'estomac et parfois des palpes labiaux. La sporulation se traduit par la division de cellules à l'intérieur des cellules et se déroule dans les tubules et conduits de la glande digestive. Des granules réfringents apparaissent au cours de la sporulation, mais ne sont pas observés dans les premiers stades. Dans les dernières phases de l'infection, des sporanges libres sont observés dans la lumière du tube digestif. Leur cytoplasme est basophile, tandis que leur noyau est éosinophile. La couleur des granules peut aller de l'orange foncé au rouge foncé.

La technique n'est pas spécifique de l'espèce parasite.

I.3.   Techniques moléculaires

I.3.1.   Extraction de l'ADN

L'ADN doit être extrait conformément aux procédures standard.

Il est possible d'utiliser des kits d'extraction de l'ADN disponibles dans le commerce, qui produisent généralement de l'ADN de haute qualité utilisable pour les protocoles de PCR, comme indiqué au point I.3.2.

I.3.2.   Amplification en chaîne par la polymérase (PCR)

Plusieurs protocoles de PCR ont été élaborés et publiés.

Il y a lieu d'utiliser des amorces PCR ciblant la région de l'espaceur transcrit interne (ITS1), car elles sont capables d'amplifier uniquement M. refringens.

La PCR doit être réalisée dans un volume de 50 μl. Les mélanges pour PCR doivent contenir du tampon [500 mM de KCL, 100 mM de Tris/HCl (pH 9,0 à 25 °C) et 1 % de Triton® X-100], 2,5 mM de MgCl2, 0,2 mM de mélange dNTP, 1 μM d'amorces sens et antisens, 0,02 unités μl– 1 d'ADN Taq polymérase, et 10 à 100 ng d'ADN extrait. Après dénaturation de l'ADN à 94 °C pendant 5 minutes, 30 cycles doivent être effectués, comme suit: dénaturation à 94 °C pendant une minute, hybridation à 55 °C pendant une minute, et élongation à 72 °C pendant une minute par kilopaire de bases. Une étape d'élongation finale de 10 minutes à 72 °C doit être effectuée. Pour la détection de M. refringens, la PCR doit être réalisée avec des amorces qui ciblent la région ITS1 (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ et 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).

Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible.

Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible.

Un résultat positif consiste en un produit d'amplification positif de la taille escomptée (412 pb), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.

I.3.3.   Hybridation in situ

Plusieurs protocoles d'hybridation in situ ont été élaborés et publiés.

Il faut utiliser une sonde ciblant la petite sous-unité du complexe de gènes de l'ARNr car elle a été validée par rapport à l'histologie.

Des fragments de tissus incluant branchies et glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine. Des coupes de 5 μm d'épaisseur doivent être réalisées et placées sur des lames recouvertes d'aminoalkylsilane, puis incubées pendant une nuit dans une étuve à 40 °C. Les coupes doivent être déparaffinées par immersion dans du xylène pendant 10 minutes. Cette étape doit être répétée une fois, puis le solvant doit être éliminé par immersion dans deux bains successifs d'éthanol absolu de 10 minutes chacun. Les coupes doivent ensuite être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante. Elles doivent ensuite être traitées à la protéinase K (100 μg ml– 1) dans un tampon TE [Tris (50 mM), EDTA (10 mM)], à une température de 37 °C pendant 30 minutes. Les lames doivent être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante puis séchées à l'air. Les coupes doivent être incubées avec 100 μl de tampon d'hybridation [4 × SSC (solution saline de citrate), formamide à 50 %, 1 × solution de Denhardt, 250 μg ml– 1 d'ARNt de levure, sulfate de dextrane à 10 %] contenant 10 ng (1 μl des réactifs de la PCR préparés comme décrit au point I.3.2 à l'aide des amorces CCG-GTG-CCA-GGT-ATA-TCT-CG et TTC-GGG-TGG-TCT-TGA-AAG-GC) de la sonde marquée à la digoxigénine. Les coupes doivent être recouvertes de lamelles couvre-objet en plastique pour hybridation in situ et placées sur un bloc chauffant à 95 °C pendant 5 minutes. Les lames doivent ensuite être refroidies sur de la glace pendant une minute avant l'hybridation à une température de 42 °C pendant une nuit dans une étuve humide. Les coupes doivent être lavées deux fois pendant cinq minutes dans 2 × SSC à température ambiante, et une fois pendant 10 minutes dans 0,4 × SSC à 42 °C. Les étapes de détection doivent être réalisées selon les instructions du fabricant. Les lames doivent ensuite être rincées dans de l'eau distillée stérile (dH2O). Les coupes doivent être contre-colorées au brun Bismarck Y et rincées dans dH2O avant l'application de lamelles couvre-objet à l'aide d'un milieu de montage aqueux.

Des coupes provenant d'hôtes infectés et non infectés connus servent respectivement de témoins positifs et négatifs.

Un résultat positif doit être établi par la coloration violet-noire des cellules de M. refringens dans les tissus des organes cibles connus, tandis que tous les témoins négatifs sont négatifs et tous les témoins positifs sont positifs.

I.3.4.   Séquençage

Le séquençage est une des dernières étapes requises pour confirmer le diagnostic. Les régions ciblées sont la petite sous-unité de l'ARNr et ITS1.

II.   Méthodes et procédures de diagnostic détaillées pour la surveillance et la confirmation de l'infection à Marteilia refringens

Aux fins des programmes de surveillance et afin de confirmer la présence d'une infection à Marteilia refringens ou d'écarter une suspicion de cette maladie répertoriée, conformément aux exigences fixées à l'annexe I, partie 4, section II, les méthodes de diagnostic et les procédures correspondantes à utiliser doivent être conformes aux lignes directrices fournies dans le tableau 4.1 ci-dessous:

Tableau 4.1

Lignes directrices concernant les méthodes de diagnostic à appliquer aux fins des programmes de surveillance et pour confirmer une infection à Marteilia refringens ou écarter une suspicion de cette maladie

Méthode

Surveillance ciblée

Diagnostic de présomption

Diagnostic confirmatif

Empreintes de glande digestive

X

X

X, ou

Histopathologie

X

 

X, ou

Hybridation in situ

 

 

X, et

PCR

X

X

X, et

Séquençage

 

 

X

PARTIE 5

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'INFECTION À BONAMIA OSTREAE

I.   Procédures pour le diagnostic de l'infection à Bonamia ostreae

Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne les infections à Bonamia ostreae comme indiqué à l'annexe I, partie 5, section I, ou afin de confirmer la présence de cette maladie répertoriée ou d'écarter une suspicion de cette maladie conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 5, section II, les méthodes et procédures détaillées figurant aux points I.1, I.2 et I.3 ci-après doivent être appliquées.

I.1.   Procédure d'échantillonnage

Les mollusques bâillants ou qui viennent de mourir doivent être prélevés en priorité afin d'accroître les chances de trouver des animaux infectés.

Une fois prélevées, les huîtres doivent être maintenues à 4 °C ou réfrigérées sur de la glace pendant 24 heures au maximum si les échantillons comprennent des mollusques bâillants et pendant 72 heures dans le cas contraire, dans un sac en plastique muni d'une étiquette sur laquelle figurent des informations relatives à la nature et à l'origine des huîtres. Les mollusques bâillants ou qui viennent de mourir doivent être séparés des autres mollusques.

Une coupe de tissus incluant les branchies et du tissu cardiaque, de 3 à 5 mm d'épaisseur, doit être utilisée pour le diagnostic histologique de Bonamia ostreae. Un morceau de la glande digestive doit être utilisé pour certains tests, y compris pour les empreintes et la réaction en chaîne par polymérase (PCR).

I.2.   Techniques microscopiques

I.2.1.   Cytologie (cytologie sur empreinte)

Après séchage des tissus branchiaux ou cardiaques sur du papier absorbant, plusieurs empreintes doivent être réalisées sur une lame de verre. Les lames doivent être séchées à l'air, fixées au méthanol ou à l'éthanol absolu et colorées à l'aide d'un kit de coloration disponible dans le commerce (tel que Diff-Quick®/Hemacolor®) conformément aux instructions du fabricant. Après rinçage à l'eau du robinet et séchage, les lames doivent être montées avec une lamelle couvre-objet à l'aide d'une résine synthétique appropriée. Les lames doivent être observées dans un premier temps à un grossissement de × 200, puis en immersion dans l'huile, à un grossissement de × 1 000.

Un résultat positif doit être constaté en présence de petits organismes sphériques ou ovoïdes (2 à 5 μm de large) à l'intérieur des hémocytes. Toutefois, le parasite peut également être présent à l'extérieur des cellules. Ces organismes ont un cytoplasme basophile et un noyau éosinophile (les couleurs peuvent varier en fonction du colorant utilisé) et, comme ils s'étalent sur la lame, ils peuvent paraître plus grands sur les empreintes qu'à l'examen histologique. Des cellules multinuclées peuvent être observées. La technique n'est pas spécifique de l'espèce parasite.

I.2.2.   Analyse histologique

Des fragments de tissus incluant les branchies et la glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine et coloration, par exemple à l'hématoxyline et à l'éosine. Les observations doivent être effectuées à des grossissements croissants, jusqu'à × 1 000.

Un résultat positif doit être établi en présence de parasites sous la forme de très petites cellules de 2 à 5 μm de large à l'intérieur des hémocytes ou libres dans le tissu conjonctif ou les sinus de l'épithélium des branchies, du tube digestif et du manteau, souvent associés à une réaction inflammatoire intense. Pour dissiper tout doute, le parasite doit être observé à l'intérieur de l'hémocyte afin de mettre en évidence un diagnostic positif. La technique n'est pas spécifique de l'espèce parasite.

I.3.   Techniques moléculaires

I.3.1.   Extraction de l'ADN

L'ADN doit être extrait conformément aux procédures standard.

Il est possible d'utiliser des kits d'extraction de l'ADN disponibles dans le commerce, qui produisent généralement de l'ADN de haute qualité utilisable pour les protocoles de PCR, comme indiqué ci-après.

I.3.2.   Amplification en chaîne par polymérase (PCR)

Plusieurs protocoles de PCR ont été élaborés et publiés.

Deux protocoles de PCR ciblant la petite sous-unité de l'ADNr peuvent être utilisés:

a)

le premier est un protocole de PCR classique permettant d'amplifier plusieurs membres du phylum des Haplosporidia, dont Bonamia spp. Les amorces, dénommées Bo et Boas, sont respectivement 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ et 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′, et elles amplifient un produit de 300 pb. Les mélanges pour PCR contiennent du tampon [500 mM de KCL, 100 mM de Tris/HCl (pH 9,0 à 25 °C) et 1 % de Triton® X-100], 2,5 mM de MgCl2, 0,2 mM de mélange dNTP, 1 μM d'amorces sens et antisens, 0,02 unités μl– 1 d'ADN Taq polymérase, et 0,2 ng μl– 1 de la matrice d'ADN dans un volume total de 50 μl. Les échantillons doivent être dénaturés dans un thermocycleur pendant cinq minutes à 94 °C avant d'être soumis à 30 cycles (94 °C pendant une minute, 55 °C pendant une minute, 72 °C pendant une minute), suivis d'une étape finale d'élongation à 72 °C pendant 10 minutes.

Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible.

Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible.

Un résultat positif consiste en un produit d'amplification positif de la taille escomptée (c.-à-d. 300 pb), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs;

b)

le second protocole de PCR est une PCR en temps réel au SYBR®Green. Elle permet la détection spécifique de B. ostreae (décrite ci-après) et peut être couplée à une PCR en temps réel au SYBR®Green permettant la détection spécifique de B. exitiosa (Ramilo et al., 2013).

Les amorces BOSTRE-F (5′-TTACGTCCCTGCCCTTTGTA-3′) et BOSTRE-R (5′-TCGCGGTTGAATTTTATCGT-3′) amplifient un produit de 208 pb. Les mélanges pour PCR contiennent un mélange SYBR® Green Master Mix (1X), 0,3 μM d'amorces sens et antisens et 200 ng d'ADN extrait. Les échantillons doivent être dénaturés dans un système de détection en temps réel pendant 10 minutes à 95 °C avant d'être soumis à 35 cycles (95 °C pendant 30 secondes, 55 °C pendant 45 secondes et 72 °C pendant une minute). L'analyse de la courbe de fusion est réalisée en augmentant la température de 55 à 95 °C par paliers de 0,5 °C/s et en mesurant l'intensité de fluorescence à chaque changement de température.

Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible.

Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible.

Un résultat positif consiste en un produit d'amplification positif avec un seul pic de température de fusion (78,25 ± 0,25 °C dans les conditions publiées par Ramilo et al. en 2013), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.

I.3.3.   Hybridation in situ

Plusieurs protocoles d'hybridation in situ ont été élaborés et publiés.

Une sonde ciblant la petite sous-unité du complexe de gènes de l'ADNr doit être utilisée, même s'il a été démontré qu'elle pouvait interagir avec certains autres membres du phylum des Haplosporidia.

Des fragments de tissus incluant branchies et glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine. Des coupes de 5 μm d'épaisseur doivent être réalisées et placées sur des lames recouvertes d'aminoalkylsilane, puis incubées pendant une nuit dans une étuve à 40 °C. Les coupes doivent être déparaffinées par immersion dans du xylène pendant 10 minutes. Cette étape doit être répétée une fois, puis le solvant doit être éliminé par immersion dans deux bains successifs d'éthanol absolu de 10 minutes chacun. Les coupes doivent ensuite être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante. Elles doivent ensuite être traitées à la protéinase K (100 μg ml– 1) dans un tampon TE [Tris (50 mM), EDTA (10 mM)], à une température de 37 °C pendant 30 minutes. Les lames doivent être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante puis séchées à l'air. Les coupes doivent être incubées avec 100 μl de tampon d'hybridation [4 × SSC (solution saline de citrate), 50 % de formamide, 1 × solution de Denhardt, 250 μg ml– 1 d'ARNt de levure, 10 % de sulfate de dextrane] contenant 20 ng (2 μl de la réaction de PCR préparés comme décrit au point I.3.2 à l'aide des amorces Bo et Boas) de la sonde marquée à la digoxigénine. Les coupes doivent être recouvertes de lamelles couvre-objet en plastique pour hybridation in situ et placées sur un bloc chauffant à 95 °C pendant 5 minutes. Les lames doivent ensuite être refroidies sur de la glace pendant une minute avant l'hybridation à une température de 42 °C pendant une nuit dans une étuve humide. Les coupes doivent être lavées deux fois pendant cinq minutes dans 2 × SSC à température ambiante, et une fois pendant 10 minutes dans 0,4 × SSC à 42 °C. Les étapes de détection doivent être réalisées selon les instructions du fabricant. Les lames doivent ensuite être rincées dans de l'eau distillée stérile (dH2O). Les coupes doivent être contre-colorées au brun Bismarck Y et rincées dans dH2O avant l'application de lamelles couvre-objet à l'aide d'un milieu de montage aqueux.

Des coupes provenant d'hôtes infectés et non infectés connus servent respectivement de témoins positifs et négatifs.

Un résultat positif consiste en parasites marqués à l'intérieur des hémocytes, tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.

I.3.4.   Séquençage

Le séquençage est une des dernières étapes requises pour confirmer le diagnostic. Les régions ciblées sont la petite sous-unité de l'ARNr et ITS1.

II.   Procédures de surveillance et de confirmation de l'infection à Bonamia ostreae

Aux fins de la surveillance des infections à Bonamia ostreae et pour confirmer la présence d'une telle infection ou écarter une suspicion de cette maladie conformément aux exigences fixées à l'annexe I, partie 5, section II, les méthodes de diagnostic et les procédures correspondantes à utiliser doivent être conformes aux lignes directrices fournies dans le tableau 5.1 ci-dessous:

Tableau 5.1

Lignes directrices concernant les méthodes de diagnostic à appliquer aux fins des programmes de surveillance et pour confirmer une infection à Bonamia ostreae ou écarter une suspicion de cette maladie

Méthode

Surveillance ciblée

Diagnostic de présomption

Diagnostic confirmatif

Empreintes de cœur ou de branchies

X

X

X, ou

Histopathologie

X

 

X, ou

Hybridation in situ

 

 

X, et

PCR

X

X

X, et

Séquençage

 

 

X

PARTIE 6

MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE LA MALADIE DES POINTS BLANCS (MPB)

1.   Procédures de diagnostic pour la détection du virus du syndrome des points blancs (VSPB)

Lorsque des prélèvements et des examens de laboratoire sont réalisés aux fins des programmes de surveillance et d'éradication décrits à l'annexe I, partie 6, section I, et pour confirmer la présence du VSPB ou écarter une suspicion d'infection par ce virus conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 6, section II, les méthodes et procédures détaillées figurant aux points 2 à 7 de la présente partie doivent être appliquées.

Les méthodes et procédures décrites dans la présente partie de l'annexe II ont été adaptées d'après l'essai préconisé par les laboratoires accrédités selon la norme ISO 17025 réalisé au laboratoire de référence de l'Union européenne pour les maladies des crustacés. Il est possible de recourir à d'autres méthodes utilisant des conditions équivalentes ou des kits produits par d'autres fabricants, mais dont la sensibilité et la spécificité sont équivalentes à celles décrites dans la présente partie. Dans tous les cas, le produit amplifié par PCR doit être séquencé pour confirmer qu'il s'agit bien du virus du syndrome des points blancs (VSPB).

2.   Procédure d'échantillonnage

Les tissus (pléopodes et branchies) de crustacés abritant le VSPB doivent être stockés dans de l'éthanol ou dans un réactif de stabilisation de l'ARN (RNAlater), ou surgelés à – 80 °C. Les étapes nécessaires à l'identification du VSPB à partir d'échantillons de tissus sont les suivantes: homogénéisation des tissus, extraction de l'ADN, amplification spécifique de l'ADN du VSPB par PCR, visualisation du produit amplifié sur un gel, purification de l'ADN et séquençage pour confirmer l'identité de l'agent pathogène.

3.   Homogénéisation des tissus

Le broyage des tissus et la préparation d'un homogénat dans un tampon approprié doivent être réalisés à l'aide du broyeur Fast Prep et de tubes Lysing matrix A (MP Biomedicals). Les tissus doivent être pesés, placés dans des tubes Lysing Matrix A, dilués au 1:10 m/v ou selon les instructions du fabricant dans un tampon approprié [G2 et 10 μl de protéinase K à utiliser avec le kit d'extraction de l'ADN de tissus DNA Tissue kit (Qiagen)] et homogénéisés à l'aide de l'homogénéisateur Fast Prep24 pendant deux minutes. Les échantillons homogénéisés doivent être incubés à 56 °C pendant au minimum quatre heures ou pendant une nuit. Les échantillons doivent ensuite être passés au vortex, centrifugés à 9 000 tr/min pendant deux minutes, puis 50 μl de surnageant ou un volume équivalant à 5 mg de tissus (poids de tissu optimal pour le kit d'extraction) doivent être ajoutés dans un tube échantillon pour extraction d'ADN et le volume doit être complété à 200 μl à l'aide de tampon G2.

4.   Extraction de l'ADN

L'ADN total doit être extrait à l'aide d'un kit d'extraction de l'ADN de tissus et du Biorobot EZ1 Advanced XL (Qiagen) suivant les instructions des fabricants. Un témoin d'extraction (ADN de thymus de veau) et un témoin négatif (tampon G2) doivent accompagner chaque lot d'échantillons. L'ADN doit être élué dans un volume de 50 μl. Pour s'assurer que l'extraction a réussi, la concentration d'ADN de tous les échantillons et de tous les témoins doit être déterminée à l'aide d'un NanoDrop. L'ADN extrait doit être congelé à – 20 °C s'il ne doit pas être utilisé immédiatement.

5.   Amplification du VSPB par réaction en chaîne par polymérase (PCR)

La méthode à utiliser pour la détection du VSPB est le protocole de détection du VSPB par PCR nichée décrit dans les paragraphes ci-après, qui permet d'obtenir respectivement lors de la première et de la deuxième phase de PCR un amplicon de 1 447 pb et un amplicon de 848 pb du gène codant pour l'ARNr 18S.

La réaction de la première phase de PCR est mise en œuvre dans un volume de 50 μl contenant, en concentration finale, 1 × GoTaq Buffer (Promega), 5 mM de MgCl2, 1 pmol/μl d'amorce VSPB 146 F1, 1 pmol/μl d'amorce VSPB 146 R1 (tableau 1), 0,25 mM de dNTP, 1,25 U de Taq polymérase et 2,5 μl d'ADN. Chaque échantillon est dupliqué et associé à un témoin d'extraction négatif, un témoin PCR négatif (ajout de 2,5 μl de H2O au lieu d'ADN) et un témoin positif. Le témoin positif doit être constitué de plasmide de VSPB dilué préparé et validé pour une utilisation en interne (disponible auprès du laboratoire de référence de l'Union européenne).

La réaction de la 2e phase de PCR doit être mise en œuvre comme la première, mais en utilisant le jeu d'amorces VSPB 146 F2/R2 et un deuxième témoin positif pour vérifier que cette étape de la PCR a réussi.

Amorce

Séquence

WSSV 146 F1

ACTACTAACTTCAGCCTATCTAG

WSSV 146 R1

TAATGCGGGTGTAATGTTCTTACGA

WSSV 146 F2

GTAACTGCCCCTTCCATCTCCA

WSSV 146 R2

TACGGCAGCTGCTGCACCTTGT

La première comme la seconde phase de la PCR sont mises en œuvre en appliquant la succession de cycles ci-après à l'aide d'un thermocycleur DNA Engine Tetrad 2 Peltier (ou équivalent): une étape initiale de dénaturation à 94 °C pendant 2 minutes, suivie d'une étape à 94 °C pendant 30 secondes, puis 62 °C pendant 30 secondes et 72 °C pendant 30 secondes, répétée pendant 30 cycles, une étape d'élongation à 72 °C pendant deux minutes et maintien à 4 °C.

6.   Électrophorèse sur gel

Les produits amplifiés résultant de la première comme de la deuxième phase de la PCR doivent être visualisés sur des gels d'agarose à 2 % préparés à l'aide de tampon TAE. 15 μl de chaque échantillon doivent être soumis à une tension de 120 volts pendant environ 20 minutes, puis examinés en lumière ultraviolette. Les échantillons positifs produiront une bande de 1 447 pb lors de la première phase de PCR et de 848 pb lors de la seconde. Les échantillons de cette taille doivent être découpés et placés dans un microtube de centrifugation de 1,5 ml. L'ADN contenu dans les tranches de gel doit être purifié à l'aide du kit Wizard® SV Gel and PCR Clean-Up System de Promega conformément aux instructions du fabricant. La concentration de l'ADN doit être estimée à l'aide d'un NanoDrop. L'ADN purifié doit être congelé à – 20 °C s'il n'est pas utilisé immédiatement.

7.   Séquençage des produits de PCR

L'ADN doit être séquencé à l'aide du kit Big Dye Terminator v3.1 (Applied Biosystems). Le volume total de chaque réaction est de 20 μl, les concentrations finales étant 1 × Big Dye Terminator, 1 × tampon de séquençage, 10 pmol/μl d'amorce sens ou antisens et 10 μl d'ADN purifié (dilué à environ 10 ng/μl), et la succession de cycles suivante est appliquée à l'aide d'un thermocycleur DNA Engine Tetrad 2 Peltier (ou équivalent): 94 °C pendant 30 secondes, suivi de 96 °C pendant 10 secondes, 50 °C pendant 10 secondes et à 60 °C pendant quatre minutes, les trois dernières étapes étant reproduites 30 fois.

Les produits de PCR doivent être précipités par une méthode à base d'acétate de sodium, dans le cadre de laquelle on ajoute 20 μl d'ADN à 10 μl de NaAc, 70 μl de H2O et 250 μl d'éthanol; le tout est passé au vortex et centrifugé à 13 000 tr/min pendant 20 minutes, puis le surnageant est éliminé et le culot est lavé avec 200 μl d'éthanol absolu et centrifugé à 13 000 tr/min pendant cinq minutes. Le culot doit être séché à 37 °C pendant cinq minutes. 25 μl de Hi-Di formamide doivent être ajoutés aux culots que l'on chauffe ensuite à 95 °C pendant deux minutes avant de mélanger avec soin au vortex. Les échantillons doivent être séquencés à l'aide de l'analyseur ABI 3130xl Avant Genetic conformément aux instructions du fabricant. Les résultats du séquençage doivent être analysés à l'aide du logiciel Sequencher et les séquences rapprochées de celles qui se trouvent dans la base de données du NCBI, à l'aide de la fonction BLAST.


Top