EUR-Lex Access to European Union law

Back to EUR-Lex homepage

This document is an excerpt from the EUR-Lex website

Document 32015D1554

Decisión de Ejecución (UE) 2015/1554 de la Comisión, de 11 de septiembre de 2015, por la que se establecen disposiciones de aplicación de la Directiva 2006/88/CE en lo que respecta a los requisitos de vigilancia y los métodos de diagnóstico [notificada con el número C(2015) 6188] (Texto pertinente a efectos del EEE)

OJ L 247, 23.9.2015, p. 1–62 (BG, ES, CS, DA, DE, ET, EL, EN, FR, HR, IT, LV, LT, HU, MT, NL, PL, PT, RO, SK, SL, FI, SV)

In force

ELI: http://data.europa.eu/eli/dec_impl/2015/1554/oj

23.9.2015   

ES

Diario Oficial de la Unión Europea

L 247/1


DECISIÓN DE EJECUCIÓN (UE) 2015/1554 DE LA COMISIÓN

de 11 de septiembre de 2015

por la que se establecen disposiciones de aplicación de la Directiva 2006/88/CE en lo que respecta a los requisitos de vigilancia y los métodos de diagnóstico

[notificada con el número C(2015) 6188]

(Texto pertinente a efectos del EEE)

LA COMISIÓN EUROPEA,

Visto el Tratado de Funcionamiento de la Unión Europea,

Vista la Directiva 2006/88/CE del Consejo, de 24 de octubre de 2006, relativa a los requisitos zoosanitarios de los animales y de los productos de la acuicultura, y a la prevención y el control de determinadas enfermedades de los animales acuáticos (1), y, en particular, su artículo 49, apartado 3, su artículo 50, apartado 4, su artículo 57, letra b), y su artículo 61, apartado 3,

Considerando lo siguiente:

(1)

La Directiva 2006/88/CE establece medidas preventivas mínimas para la vigilancia y la detección precoz en los animales acuáticos de las enfermedades que enumera en su anexo IV (en lo sucesivo, «las enfermedades de la lista»), y las medidas de control que deben aplicarse en caso de sospecha o de aparición de un brote de dichas enfermedades. Asimismo establece los requisitos para que los Estados miembros o las zonas o compartimentos de los Estados miembros obtengan la calificación de «libre de enfermedad».

(2)

La erradicación de las enfermedades de la lista y la obtención de la calificación de libre de enfermedad por parte de un Estado miembro, zona o compartimento deben basarse en los mismos principios y seguir el mismo enfoque científico en toda la Unión. Por esta razón, es necesario establecer a nivel de la Unión requisitos específicos para los sistemas de erradicación y vigilancia, así como para los métodos de muestreo y diagnóstico que deben utilizar los Estados miembros a fin de obtener la calificación de libre de enfermedad, ya sea en todo su territorio o en una zona o compartimento.

(3)

Los exámenes de laboratorio que deben efectuarse en caso de sospecha o confirmación de la presencia de las enfermedades de la lista deben ser los mismos en toda la Unión y han de seguir normas y protocolos científicos idénticos. De conformidad con la Directiva 2006/88/CE, es necesario establecer los métodos y procedimientos específicos de diagnóstico que deben utilizar los laboratorios designados a tal efecto por las autoridades competentes de los Estados miembros.

(4)

El Código Sanitario para los Animales Acuáticos, adoptado por la Organización Mundial de Sanidad Animal (OIE) («el Código Acuático»), establece normas para mejorar la sanidad de los animales acuáticos y el bienestar de los peces de cultivo en el mundo a través de textos normativos para un comercio internacional seguro de animales acuáticos y sus productos. Varios capítulos del Código Acuático formulan recomendaciones sobre el uso de determinadas pruebas de diagnóstico. La OIE regula dichas pruebas en su Manual de Pruebas de Diagnóstico para los Animales Acuáticos («el Manual Acuático»). Para garantizar que los requisitos de la Unión en relación con el diagnóstico de las enfermedades de los animales acuáticos sean coherentes con las normas internacionales, las disposiciones de la presente Decisión deben tener en cuenta las normas y recomendaciones del Código Acuático.

(5)

A este respecto, para muchas de las enfermedades de la lista, el Manual Acuático contiene varias pruebas y procedimientos que deben utilizarse en los exámenes de laboratorio. Con objeto de uniformar la base científica del diagnóstico de las enfermedades de la lista a nivel de la Unión, es necesario elegir entre las pruebas y procedimientos de diagnóstico recomendados por la OIE y especificar las pruebas que deben ser obligatorias con fines de examen de laboratorio cuando se lleven a cabo programas de vigilancia y cuando se trate de descartar la sospecha o confirmar la presencia de las enfermedades de la lista. Ya que también será necesario disponer de métodos y procedimientos alternativos en ciertos casos, deben proporcionarse descripciones y algunas explicaciones científicas sobre cuándo y cómo podrían ser aplicados los métodos alternativos. Esto es especialmente necesario para los procedimientos de diagnóstico más detallados.

(6)

A fin de producir resultados diagnósticos precisos y reproducibles, es importante que los procedimientos y protocolos detallados que vayan a usarse sean validados de conformidad con las normas de calidad pertinentes a las que se refiere la parte I del anexo VI de la Directiva 2006/88/CE. Un elemento necesario de los protocolos de diagnóstico para muchos de los métodos establecidos en la presente Decisión es el uso de kits de pruebas comerciales, que han sido validados en ensayos acreditados por los laboratorios de referencia de la Unión Europea para las respectivas enfermedades. En interés de la seguridad jurídica, es conveniente mencionar en la presente Decisión los nombres comerciales de dichos kits de pruebas validados.

(7)

Para determinados Estados miembros, la obtención de la calificación de libre de una o varias enfermedades de la lista, en todo su territorio o en una zona o compartimento, puede plantear dificultades. En tales situaciones, es posible que el Estado miembro no desee obtener o recuperar la calificación de libre de dichas enfermedades. Las medidas mínimas de control que deben aplicarse en los casos en que el Estado miembro no desee obtener o recuperar la calificación de libre de enfermedades han de ser las mismas a nivel de la Unión y deben basarse en los mismos criterios. Por tanto, de conformidad con la Directiva 2006/88/CE, es necesario establecer normas detalladas para el confinamiento de las enfermedades de la lista y requisitos mínimos para levantar tales medidas de confinamiento.

(8)

La Decisión 2001/183/CE de la Comisión (2) establece los requisitos relativos a los planes de muestreo y los métodos de diagnóstico para la detección y confirmación de la necrosis hematopoyética infecciosa y la septicemia hemorrágica viral, enfermedades que figuran en la lista. La Decisión 2003/466/CE de la Comisión (3) establece requisitos relativos a los planes de muestreo y los métodos de diagnóstico para la detección de la anemia infecciosa del salmón, así como criterios para la delimitación de zonas y la adopción de medidas oficiales de vigilancia ante la sospecha o la confirmación de dicha enfermedad. La Decisión 2002/878/CE de la Comisión (4) establece los requisitos relativos a los planes de muestreo y los métodos de diagnóstico para la detección y confirmación de la presencia de bonamiosis y marteiliosis en los moluscos. Para que tales requisitos queden actualizados, estas tres decisiones deben ser sustituidas por la presente Decisión. En consecuencia, conviene derogar las Decisiones 2001/183/CE, 2002/878/CE y 2003/466/CE.

(9)

Dado que algunos Estados miembros necesitan cierto tiempo para poner al día sus laboratorios nacionales de referencia a fin de cumplir los requisitos que establece la presente Decisión, esta debe aplicarse a partir del 1 de abril de 2016.

(10)

Las medidas previstas en la presente Decisión se ajustan al dictamen del Comité Permanente de Vegetales, Animales, Alimentos y Piensos.

HA ADOPTADO LA PRESENTE DECISIÓN:

Artículo 1

Objeto

La presente Decisión establece normas relativas a:

a)

la vigilancia, las zonas tampón, el muestreo y los métodos de diagnóstico que deben aplicar los Estados miembros en relación con la calificación sanitaria de sus territorios, o de zonas o compartimentos de estos, con respecto a las enfermedades no exóticas de los animales acuáticos que figuran en la parte II del anexo IV de la Directiva 2006/88/CE («las enfermedades de la lista»);

b)

los métodos de diagnóstico que deben usarse para los exámenes de laboratorio en caso de sospecha o confirmación de la presencia de enfermedades de la lista, y

c)

las medidas mínimas de control que deben aplicarse en caso de sospecha o confirmación de una enfermedad de la lista en un Estado miembro, zona o compartimento que no hayan sido declarados libres de dicha enfermedad.

Artículo 2

Definiciones

A efectos de la presente Decisión, se aplicarán las siguientes definiciones:

a)   «septicemia hemorrágica viral» («SHV»): enfermedad causada por el virus de la septicemia hemorrágica viral (VSHV), también conocido como Egtved virus, perteneciente al género Novirhabdovirus y a la familia Rhabdoviridae;

b)   «necrosis hematopoyética infecciosa» («NHI»): enfermedad causada por el virus de la necrosis hematopoyética infecciosa (VNHI), perteneciente al género Novirhabdovirus y a la familia Rhabdoviridae;

c)   «herpesvirosis de la carpa koi» («HCK»): enfermedad causada por el herpesvirus de la carpa koi (HVK), perteneciente a la familia Alloherpesviridae, y conocido por el nombre científico de herpesvirus de los ciprínidos tipo 3 (HVCy-3);

d)   «anemia infecciosa del salmón» («AIS»): enfermedad causada por la infección por el virus de la anemia infecciosa del salmón (ISAV) con supresión en la HPR, perteneciente al género Isavirus, de la familia Orthomyxoviridae;

e)   «infección por Marteilia refringens»: enfermedad causada por una infección por el protozoo Marteilia refringens, del orden Paramyxida;

f)   «infección por Bonamia ostreae»: enfermedad causada por una infección por el protozoo Bonamia ostreae, del filo Haplosporidia;

g)   «enfermedad de las manchas blancas» (o «EMB»): enfermedad causada por el virus del síndrome de las manchas blancas (VSMB), que es un virus con ADN bicatenario del género Whispovirus, dentro de la familia Nimaviridae.

Artículo 3

Requisitos mínimos aplicables a los programas de erradicación y vigilancia

Los Estados miembros velarán por que se cumplan las disposiciones sobre programas de vigilancia y erradicación, zonas tampón, muestreo y métodos de diagnóstico establecidos en el anexo I y los métodos específicos y procedimientos detallados establecidos en el anexo II cuando deba concederse, retirarse o devolverse a un Estado miembro, o a una zona o compartimento dentro de un Estado miembro, la calificación de libre de una o varias enfermedades de la lista.

Artículo 4

Requisitos mínimos para los métodos de diagnóstico y procedimientos específicos

Los Estados miembros velarán por que se apliquen los métodos de control establecidos en el anexo I y los métodos de diagnóstico específicos y procedimientos detallados establecidos en el anexo II cuando se efectúen exámenes de laboratorio a fin de confirmar o descartar la presencia de una enfermedad de la lista.

Artículo 5

Medidas mínimas de control del confinamiento de las enfermedades de la lista y requisitos mínimos para el levantamiento de las medidas de confinamiento establecidas en Estados miembros, zonas o compartimentos no declarados libres de enfermedades de la lista

Los Estados miembros velarán por que se apliquen las medidas mínimas de control y los requisitos mínimos para el levantamiento de las medidas de confinamiento que se establecen en el anexo I cuando lleven a cabo medidas de control o levanten las medidas de confinamiento de una o varias enfermedades de la lista en un Estado miembro o en una zona o compartimento que no estén declarados libres de tales enfermedades de la lista.

Artículo 6

Derogaciones

Quedan derogadas las Decisiones 2001/183/CE, 2002/878/CE y 2003/466/CE.

Artículo 7

Fecha de aplicación

La presente Decisión será aplicable a partir del 1 de abril de 2016.

Artículo 8

Destinatarios

Los destinatarios de la presente Decisión serán los Estados miembros.

Hecho en Bruselas, el 11 de septiembre de 2015.

Por la Comisión

Vytenis ANDRIUKAITIS

Miembro de la Comisión


(1)  DO L 328 de 24.11.2006, p. 14.

(2)  Decisión 2001/183/CE de la Comisión, de 22 de febrero de 2001, por la que se establecen los planes de muestreo y los métodos de diagnóstico para la detección y confirmación de determinadas enfermedades de los peces y se deroga la Decisión 92/532/CEE (DO L 67 de 9.3.2001, p. 65).

(3)  Decisión 2003/466/CE de la Comisión, de 13 de junio de 2003, por la que se establecen los criterios para la delimitación de zonas y la adopción de medidas oficiales de vigilancia ante la sospecha o la confirmación de anemia infecciosa del salmón (AIS) (DO L 156 de 25.6.2003, p. 61).

(4)  Decisión 2002/878/CE de la Comisión, de 6 de noviembre de 2002, por la que se establecen planes de muestreo y métodos de diagnóstico para la detección y confirmación de la presencia de bonamiosis (Bonamia ostreae) y marteiliosis (Marteilia refringens) en los moluscos (DO L 305 de 7.11.2002, p. 57).


ANEXO I

MÉTODOS DE VIGILANCIA Y CONTROL

I.   Introducción

El presente anexo establece:

a)

requisitos para los programas de erradicación y vigilancia contemplados en el artículo 44 de la Directiva 2006/88/CE y para los métodos de muestreo y diagnóstico que deben utilizarse a fin de conceder la calificación de libre de enfermedad a Estados miembros, zonas o compartimentos con arreglo al capítulo VII de dicha Directiva;

b)

métodos de muestreo y diagnóstico que deben utilizarse en los exámenes de laboratorio realizados en caso de sospecha y destinados a confirmar la presencia de las enfermedades no exóticas enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE («las enfermedades de la lista»), de conformidad con lo dispuesto en el artículo 28, letra a), y el artículo 57, letra b), de la citada Directiva;

c)

las medidas de confinamiento que deben adoptarse en caso de confirmación de una enfermedad de la lista, con arreglo al artículo 39 de la Directiva 2006/88/CE, y las medidas que deben adoptarse a fin de obtener la calificación sanitaria de la categoría III en un Estado miembro, zona o compartimento que tenga la categoría V.

Los requisitos que se establecen en el presente anexo se aplican a las siguientes enfermedades de la lista:

1.

Septicemia hemorrágica viral (SHV)

Parte 1

2.

Necrosis hematopoyética infecciosa (NHI)

Parte 1

3.

Herpesvirosis de la carpa koi (HCK)

Parte 2

4.

Anemia infecciosa del salmón (AIS)

Parte 3

5.

Infección por Marteilia refringens

Parte 4

6.

Infección por Bonamia ostreae

Parte 5

7.

Enfermedad de las manchas blancas (EMB)

Parte 6

II.   Definiciones

A efectos de los anexos I y II, se entenderá por:

a)   «compartimento continental»: una o varias explotaciones situadas en la parte continental de uno o varios Estados miembros, sujetas a un sistema de bioseguridad común y que contienen una población de animales acuáticos con una calificación sanitaria particular con respecto a una enfermedad específica;

b)   «explotación continental»: explotación que cría animales de acuicultura situada en la parte continental del territorio de un Estado miembro;

c)   «zona continental»: zona geográfica precisa situada en la parte continental de uno o varios Estados miembros con un sistema hidrológico homogéneo que comprende partes de una cuenca hidrográfica desde las fuentes hasta una barrera natural o artificial que impide la migración hacia arriba de los animales acuáticos desde tramos inferiores de la cuenca hidrográfica, una cuenca hidrográfica completa desde sus fuentes hasta su estuario o más de una cuenca hidrográfica, incluidos sus estuarios, debido a la relación epidemiológica entre las cuencas hidrográficas a través del estuario;

d)   «explotación oficialmente declarada infectada»: explotación que cría animales acuáticos en la que la autoridad competente ha confirmado una o varias enfermedades de la lista con arreglo al artículo 28, letra a), al artículo 29 y al artículo 57, letra b), de la Directiva 2006/88/CE.

e)   «explotación en contacto»: explotación que cría animales acuáticos que se ha demostrado o se sospecha firmemente que ha sido contaminada por material infeccioso procedente de una explotación oficialmente declarada infectada.

PARTE 1

MÉTODOS DE VIGILANCIA Y CONTROL DE LA SEPTICEMIA HEMORRÁGICA VIRAL (SHV) Y LA NECROSIS HEMATOPOYÉTICA INFECCIOSA (NHI)

I.   Requisitos para los programas de vigilancia y erradicación a fin de obtener y mantener la calificación de libre de SHV y NHI y medidas de confinamiento para dichas enfermedades de la lista

I.1.   Requisitos generales para las inspecciones sanitarias y el muestreo en relación con la SHV y la NHI:

a)

Las inspecciones sanitarias y, en su caso, el muestreo se efectuarán durante el período del año en el que la temperatura del agua sea inferior a 14 °C o cuando sea más probable que el agua alcance sus temperaturas mínimas anuales.

b)

Cuando sea precisa una vigilancia específica de las poblaciones salvajes de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE, se determinarán el número y la distribución geográfica de los puntos de muestreo para obtener una cobertura razonable del Estado miembro, zona o compartimento. Los puntos de muestreo serán representativos de los diferentes ecosistemas en los que se encuentren las poblaciones salvajes de especies sensibles.

c)

Cuando las explotaciones o las poblaciones salvajes vayan a ser sometidas a inspecciones sanitarias o muestreo más de una vez al año, los intervalos entre las inspecciones sanitarias y entre las tomas de muestras serán de al menos cuatro meses y lo más largos posible, teniendo en cuenta los requisitos de temperatura de la letra a).

d)

Todas las unidades de producción, como estanques, tanques y jaulas de red, serán sometidas a inspecciones sanitarias para detectar la presencia de peces muertos, débiles o con comportamiento anómalo. Se prestará especial atención a la zona de salida de agua, donde tienden a acumularse los peces débiles a causa de las corrientes de agua.

e)

Los peces de especies sensibles que vayan a recogerse como muestras se seleccionarán como sigue:

i)

si hay truchas arco iris, solo se seleccionarán para el muestreo los peces de esta especie, a menos que estén presentes peces de otras especies sensibles que muestren síntomas típicos de SHV o NHI; si no hay truchas arco iris, la muestra será representativa de todas las demás especies sensibles presentes,

ii)

si hay peces débiles, con comportamiento anómalo o recién muertos pero no descompuestos, se seleccionarán; si se utiliza más de una fuente de agua para la producción piscícola, se incluirán en la muestra peces que representen todas las fuentes de agua,

iii)

los peces se seleccionarán de modo que estén representadas proporcionalmente en la muestra todas las partes de la explotación y todas las clases anuales.

I.2.   Requisitos específicos para obtener la calificación sanitaria de libre de enfermedad (categoría I) con respecto a la SHV y la NHI

I.2.1.   Programas de vigilancia:

a)

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III de conformidad con la parte B del anexo III de la Directiva 2006/88/CE con respecto a la SHV, la NHI o ambas podrá obtener la categoría I con respecto a dichas enfermedades de la lista a condición de que todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro de ese Estado miembro, zona o compartimento cumplan los requisitos establecidos en el anexo V de la misma Directiva y de que todas las explotaciones y, en caso de que lo exija la parte I, punto 2, párrafo segundo, de su anexo V, todos los puntos de muestreo de poblaciones salvajes seleccionados de conformidad con dicha parte hayan sido sometidos a uno de los siguientes programas de vigilancia:

i)

Modelo A. Programa de vigilancia de dos años:

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 1.A de la sección II.

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta a la SHV, a la NHI o a ambas y cualquier sospecha de SHV, NHI o de ambas se habrá descartado de conformidad con los métodos de muestreo y de diagnóstico del punto II.3.

ii)

Modelo B. Programa de vigilancia de cuatro años con una muestra reducida:

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de cuatro años consecutivos, conforme a lo establecido en el cuadro 1.B de la sección II.

Durante ese período de cuatro años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta a la SHV, a la NHI o a ambas y cualquier sospecha de SHV, NHI o de ambas se habrá descartado de conformidad con los métodos de muestreo y de diagnóstico del punto II.3.

b)

Si durante la aplicación del programa de vigilancia al que se refiere la letra a) queda confirmada la infección por SHV, NHI o ambas en una explotación incluida en ese programa de vigilancia y, por tanto, le ha sido retirada la calificación sanitaria de la categoría II a la explotación, esta podrá recuperar inmediatamente su calificación sanitaria de la categoría II y seguir aplicando el programa de vigilancia para obtener la calificación de libre de enfermedad sin aplicar un programa de erradicación con arreglo al punto I.2.2 a condición de que cumpla las siguientes condiciones:

i)

es una explotación continental cuya calificación sanitaria con respecto a la SHV, la NHI o ambas es independiente de la calificación sanitaria de las poblaciones de animales acuáticos de las aguas naturales circundantes con respecto a esas enfermedades de la lista, de conformidad con la parte II, punto 3, del anexo V de la Directiva 2006/88/CE;

ii)

ha sido vaciada, limpiada, desinfectada y puesta en barbecho; la duración del barbecho será de al menos seis semanas;

iii)

ha sido repoblada con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la SHV, la NHI o ambas.

I.2.2.   Programas de erradicación

I.2.2.1.   Requisitos generales

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la SHV, la NHI o ambas podrá obtener la categoría I con respecto a dichas enfermedades de la lista a condición de que todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas a un programa de erradicación que cumpla lo dispuesto en las letras a) a e) siguientes:

a)

Las medidas de control mínimas establecidas en el capítulo V, sección 4, de la Directiva 2006/88/CE se habrán aplicado eficazmente y se habrá establecido en las inmediaciones de las explotaciones oficialmente declaradas infectadas por la SHV, la NHI o ambas enfermedades de la lista una zona de confinamiento conforme al artículo 32, letra b), de dicha Directiva que incluya una zona de protección y una zona de vigilancia.

La zona de confinamiento habrá sido definida caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de la enfermedad de la lista a los peces de piscicultura y salvajes, como son: el número de peces muertos y la tasa y distribución de la mortalidad de peces en la explotación infectada por la SHV, la NHI o ambas; la distancia y densidad de las explotaciones vecinas; la proximidad a mataderos; las explotaciones en contacto; las especies presentes en las explotaciones; las prácticas de cría aplicadas en las explotaciones afectadas y en las explotaciones vecinas a estas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos en lo que respecta a la delimitación geográfica de dichas zonas:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación oficialmente declarada infectada por la SHV, la NHI o ambas enfermedades de la lista, que corresponderá:

1)

en las zonas costeras: a una zona incluida en un círculo de un radio mínimo de una amplitud de marea, o al menos 5 km, con su centro en la explotación oficialmente declarada infectada por la SHV, la NHI o ambas, o una zona equivalente determinada conforme a datos hidrodinámicos o epidemiológicos adecuados;

2)

en zonas interiores: a toda la cuenca hidrográfica de la explotación oficialmente declarada infectada por la SHV, la NHI o ambas; la autoridad competente podrá limitar la extensión de la zona a partes de la cuenca hidrográfica o de la superficie de explotación, a condición de que no se vea comprometida la prevención de la propagación de la SHV, la NHI o ambas.

ii)

La autoridad competente establecerá una zona de vigilancia fuera de la zona de protección, que corresponderá:

1)

en las zonas costeras: a una zona circundante de la zona de protección donde se superpongan varias amplitudes de marea; o a una zona circundante de la zona de protección e incluida en un círculo de 10 km de radio desde el centro de la zona de protección; o a una zona equivalente determinadas conforme a datos hidrodinámicos o epidemiológicos adecuados;

2)

en zonas interiores: a una zona ampliada fuera de la zona de protección establecida.

b)

Todas las explotaciones no oficialmente declaradas infectadas por la SHV, la NHI o ambas que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos los siguientes elementos:

i)

la toma de muestras para pruebas de 10 peces cuando se observen signos clínicos o post mortem compatibles con una infección por la SHV, la NHI o ambas, o de un mínimo de 30 peces cuando no se observen signos clínicos o post mortem;

ii)

una inspección sanitaria en las explotaciones en las que las pruebas contempladas en el inciso i) hayan dado resultados negativos; las inspecciones sanitarias continuarán una vez al mes durante el período en el que la temperatura del agua es inferior a 14 °C, excepto cuando los estanques o jaulas de red estén cubiertos de hielo, hasta que se retire la zona de protección de conformidad con el punto I.2.2.1, letra c).

c)

Todas las explotaciones oficialmente declaradas infectadas por la SHV, la NHI o ambas serán vaciadas, limpiadas, desinfectadas y puestas en barbecho. La duración del barbecho será de al menos seis semanas. Cuando todas las explotaciones oficialmente declaradas infectadas dentro de la misma zona de protección se vacíen, se dejarán en barbecho de forma sincronizada durante al menos tres semanas. El presente apartado se aplicará también a las nuevas explotaciones oficialmente declaradas infectadas durante la aplicación del programa de erradicación.

Cuando se pongan en barbecho las explotaciones oficialmente declaradas infectadas, las zonas de protección se convertirán en zonas de vigilancia.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración del barbecho de dichas explotaciones tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones oficialmente declaradas infectadas por la SHV, la NHI o ambas enfermedades de la lista y todas las demás explotaciones puestas en barbecho dentro de las zonas de protección y vigilancia establecidas a las que se refiere la letra c) serán repobladas con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de libre de enfermedad (categoría I) con respecto a la SHV, la NHI o ambas.

La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2.1, letra c).

e)

Todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación y, cuando se exija la vigilancia de poblaciones salvajes, los puntos de muestreo seleccionados con arreglo al punto I.1, se someterán posteriormente al sistema de vigilancia establecido en el punto I.2.1.

I.2.2.2.   Requisitos para que recuperen la calificación de libre de enfermedad los compartimentos continentales que consten de una sola explotación previamente declarada libre de NHI, de SHV o de ambas

Un compartimento continental que conste de una sola explotación previamente declarada libre de SHV, de NHI o de ambas enfermedades de la lista, cuya calificación sanitaria en lo que se refiere a estas enfermedades de la lista sea independiente de las aguas naturales circundantes con arreglo a la parte II, punto 3, del anexo V de la Directiva 2006/88/CE y cuya calificación sanitaria de la categoría I haya sido retirada con arreglo al artículo 53, apartado 3, de dicha Directiva podrá recuperar la calificación sanitaria de la categoría I inmediatamente después de que la autoridad competente haya confirmado que se cumplen las siguientes condiciones:

a)

La explotación oficialmente confirmada como infectada por la SHV, la NHI o ambas ha sido vaciada, limpiada, desinfectada y puesta en barbecho. La duración del barbecho será de al menos seis semanas.

b)

La explotación oficialmente confirmada como infectada por la SHV, la NHI o ambas ha sido repoblada con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la SHV, la NHI o ambas.

I.3.   Requisitos específicos para mantener la calificación sanitaria de libre de enfermedad (categoría I) con respecto a la SHV, la NHI o ambas

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de la categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro del Estado miembro, la zona o el compartimento en cuestión serán sometidas a una inspección sanitaria y se tomarán muestras de los peces de conformidad con el cuadro 1.C de la sección II de la presente parte, teniendo en cuenta el nivel de riesgo que presente la explotación de contraer SHV, NHI o ambas enfermedades de la lista.

Al determinar la frecuencia de las inspecciones sanitarias de los compartimentos con calificación sanitaria de la categoría I respecto a la SHV, la NHI o ambas situados en zonas continentales y en los que la calificación sanitaria con respecto a la SHV o la NHI dependa de la calificación sanitaria de las poblaciones de animales acuáticos de las aguas naturales circundantes de conformidad con la parte II, punto 2, del anexo V de la Directiva 2006/88/CE, el riesgo de contraer SHV, NHI o ambas se considerará alto.

La calificación de libre de enfermedad solo se mantendrá mientras todas las muestras analizadas utilizando los métodos de diagnóstico del punto II.2 den resultados negativos por lo que respecta a la SHV, a la NHI o a ambas y cualquier sospecha de SHV, NHI o de ambas quede descartada de conformidad con los métodos de diagnóstico del punto II.3.

I.4.   Requisitos para el levantamiento de las medidas de confinamiento establecidas en el artículo 39 de la Directiva 2006/88/CE, a saber, para el cambio de una calificación sanitaria de la categoría V a una calificación sanitaria de la categoría III

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la SHV, la NHI o ambas podrá obtener la calificación sanitaria de la categoría III con respecto a dichas enfermedades de la lista a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2.1, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones serán sometidas a una medida alternativa que proporcione una garantía similar de exterminio del VNHI, del VSHV o de ambos desde el entorno de la explotación;

b)

todas las explotaciones oficialmente declaradas infectadas y todas las demás explotaciones puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a la SHV, la NHI o ambas;

c)

la repoblación solo se haya efectuado después de que todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a).

II.   Métodos de diagnóstico y muestreo

II.1.   Órganos objeto de muestreo

El material tisular que deberá examinarse será el bazo, el riñón anterior y el corazón o el encéfalo. Cuando se tomen muestras de peces reproductores, también podrá examinarse fluido ovárico o seminal.

En caso de alevines, los peces enteros de menos de 4 cm de longitud podrán desmenuzarse con unas tijeras o un escalpelo estériles tras haberse eliminado la parte del cuerpo posterior a la cloaca. Si una muestra consta de peces enteros de una longitud comprendida entre 4 y 6 cm, se recogerán las vísceras, sin descartar los riñones.

Podrán mezclarse trozos de órganos de un máximo de 10 peces.

II.2.   Métodos de diagnóstico para obtener y mantener la calificación de libre de SHV, NHI o ambas

El método de diagnóstico, de conformidad con los métodos y procedimientos de diagnóstico aprobados establecidos en la parte 1, punto I, del anexo II, para obtener o mantener la calificación de libre de SHV, NHI o ambas será uno de los siguientes:

a)

aislamiento del virus en cultivos celulares seguido de identificación mediante el ensayo de inmunoadsorción enzimática (ELISA), la prueba de inmunofluorescencia indirecta (IFAT), la prueba de neutralización viral o la retrotranscripción asociada a reacción en cadena de la polimerasa (RT-qPCR); o bien

b)

RT-qPCR.

II.3.   Métodos de muestreo y diagnóstico para descartar o confirmar la SHV o NHI

Cuando sea preciso confirmar o descartar una sospecha de SHV, NHI o ambas de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicarán los siguientes procedimientos de inspección, muestreo y ensayo:

a)

La explotación sospechosa será sometida al menos a una inspección sanitaria y un muestreo de 10 peces, cuando se observen signos clínicos o post mortem compatibles con una infección por SHV, NHI o ambas, o de un mínimo de 30 peces, cuando no se observen signos clínicos o post mortem. Las muestras se examinarán con uno o varios de los métodos de diagnóstico que se establecen en los incisos i) y ii), de acuerdo con los métodos y procedimientos detallados de diagnóstico de la parte 1, punto II, del anexo II:

i)

aislamiento convencional del virus en cultivo celular seguido de identificación inmunoquímica o molecular del virus,

ii)

detección del virus por RT-qPCR,

iii)

otras técnicas de diagnóstico con eficacia similar demostrada, como la prueba de inmunofluorescencia indirecta (IFAT), el ensayo de inmunoadsorción enzimática (ELISA), la RT-PCR y la inmunohistoquímica (IHC).

b)

La SHV se considerará confirmada si uno o más de estos métodos de diagnóstico dan positivo al VSHV. La NHI se considerará confirmada si uno o más de estos métodos de diagnóstico dan positivo al VNHI. La confirmación del primer caso de SHV o NHI en Estados miembros, zonas o compartimentos no infectados previamente se basará en el aislamiento convencional del virus en cultivo celular o mediante la RT-qPCR.

c)

La sospecha de VSHV, VNHI o ambos virus podrá descartarse si el cultivo celular o la RT-qPCR no aportan ninguna otra prueba de la presencia del VSHV ni del VNHI.

Cuadro 1.A

Sistema de vigilancia de zonas y compartimentos para el período de control de dos años contemplado en el punto I.2.1, letra a), inciso i), anterior a la obtención de la calificación de libre de SHV o NHI

Tipo de explotación

Número de inspecciones sanitarias anuales (dos años)

Número de muestreos anuales (dos años)

Número de peces de la muestra (1)

Número de peces en crecimiento

Número de peces reproductores (2)

a)

Explotaciones con reproductores

2

2

50 (primera inspección)

75 (segunda inspección)

30 (primera o segunda inspecciones)

0 (primera o segunda inspecciones)

b)

Explotaciones que solo contienen reproductores

2

1

0

75 (primera o segunda inspecciones)

c)

Explotaciones sin reproductores

2

2

75 (3) (primera y segunda inspecciones)

0

Número máximo de peces por muestra conjunta: 10


Cuadro 1.B

Sistema de vigilancia con un tamaño de muestra reducido para el período de control de cuatro años contemplado en el punto I.2.1, letra a), inciso ii), anterior a la obtención de la calificación de libre de SHV o NHI

Tipo de explotación

Número de inspecciones sanitarias anuales

Número de muestreos anuales

Número de peces de la muestra (4)

Número de peces en crecimiento

Número de peces reproductores (5)

Primeros dos años del período de vigilancia

a)

Explotaciones con reproductores

2

1

0 (primera inspección)

30 (segunda inspección)

0 (primera inspección)

0 (segunda inspección)

b)

Explotaciones que solo contienen reproductores

2

1

0

30 (primera o segunda inspecciones)

c)

Explotaciones sin reproductores

2

1

30 (6) (primera o segunda inspecciones)

0

Últimos dos años del período de vigilancia

a)

Explotaciones con reproductores

2

2

30 (primera inspección)

0 (segunda inspección)

0 (primera inspección)

30 (segunda inspección)

b)

Explotaciones que solo contienen reproductores

2

2

 

30 (primera y segunda inspecciones)

c)

Explotaciones sin reproductores

2

2

30 (6) (primera y segunda inspecciones)

 

Número máximo de peces por muestra conjunta: 10


Cuadro 1.C

Sistemas de vigilancia de zonas o compartimentos para mantener la calificación de libre de SHV o NHI con arreglo al punto I.3

Nivel de riesgo

Número de inspecciones sanitarias

Número de peces de la muestra (9)

Alto

2 cada año

30 (7)  (8)

Medio

1 cada año

30 (7)

Bajo

1 cada dos años

30 (7)

Número máximo de peces por muestra conjunta: 10

PARTE 2

MÉTODOS DE VIGILANCIA Y CONTROL DE LA HERPESVIROSIS DE LA CARPA KOI (HCK)

I.   Requisitos aplicables a los programas de vigilancia y erradicación para obtener y mantener la calificación sanitaria de libre de HCK y para confinar la infección por el herpesvirus de la carpa koi (HVK)

I.1.   Requisitos generales

Cuando sea precisa una vigilancia específica de las poblaciones salvajes de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE, se determinarán el número y la distribución geográfica de los puntos de muestreo para obtener una cobertura razonable del Estado miembro, zona o compartimento. Los puntos de muestreo también serán representativos de los diferentes ecosistemas en los que se encuentren las poblaciones salvajes sensibles, como sistemas fluviales y lagos.

La vigilancia específica se basará en el seguimiento regular de los lugares con especies sensibles. Los lugares serán sometidos a seguimiento cuando las temperaturas del agua hayan alcanzado niveles que permitan el desarrollo de la enfermedad (> 15 °C) y como muy pronto dos semanas después de la fecha en que se alcancen dichas temperaturas. Todos los peces enfermos o con comportamiento anómalo que se encuentren en el lugar serán sometidos a muestreo y ensayo.

Siempre que sea posible, serán sometidos a muestreo los peces que se hayan mantenido durante un tiempo prolongado (de dos a tres semanas) en el intervalo de temperaturas que permite el desarrollo del virus, es decir, entre 15 y 26 °C. No obstante, podrá aceptarse el siguiente enfoque:

a)

recoger una subpoblación en el momento del traslado de los estanques de invierno a los de verano y conservar los peces en la misma masa de agua del estanque de verano hasta que se obtengan los requisitos mínimos de temperatura, o

b)

recoger muestras en el momento de la recolección o durante otras manipulaciones de los peces que formen parte de las prácticas normales de gestión. Si es posible, las muestras se recogerán entre 24 y 72 horas después de este tipo de prácticas de gestión, a fin de aumentar las posibilidades de detección del HVK.

Cuando las explotaciones o las poblaciones salvajes vayan a ser sometidas a inspecciones sanitarias o muestreo más de una vez al año, los intervalos entre las inspecciones sanitarias o las tomas de muestras serán lo más largos posible en la estación en la que sea más probable que el agua alcance sus temperaturas máximas anuales, sin rebasar el límite de 28 °C.

Todas las unidades de producción, como estanques y tanques, serán sometidas a inspecciones sanitarias para detectar la presencia de peces muertos, débiles o con comportamiento anómalo.

Cyprinus carpio y sus híbridos, como Cyprinus carpio × Carassius auratus, se recogerán cuando estén presentes en la explotación.

Los peces que vayan a recogerse como muestras se seleccionarán como sigue:

i)

si hay peces débiles, con comportamiento anómalo o recién muertos pero no descompuestos, se seleccionarán,

ii)

si se utiliza más de una fuente de agua para la producción piscícola, se incluirán en la muestra peces que representen todas las fuentes de agua,

iii)

los peces se seleccionarán de modo que estén representadas proporcionalmente en la muestra todas las partes de la explotación y todas las clases anuales.

I.2.   Requisitos específicos para obtener la calificación sanitaria de libre de HCK (categoría I)

I.2.1.   Programas de vigilancia

a)

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III con respecto a la HCK podrá obtener la calificación sanitaria de la categoría I cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento cumplan los requisitos para la calificación de libre de enfermedad establecidos en el anexo V de dicha Directiva y todas esas explotaciones y, en caso de que lo exija la parte I, punto 2, párrafo segundo, de dicho anexo, los puntos de muestreo de poblaciones salvajes seleccionados de conformidad con dicha parte, hayan sido sometidos a uno de los siguientes programas de vigilancia:

i)

Modelo A. Programa de vigilancia de dos años:

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 2.A de la sección III.

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta al HVK y cualquier sospecha de HCK habrá sido descartada de conformidad con los métodos de diagnóstico del punto III.2.

ii)

Modelo B. Programa de vigilancia de cuatro años con una muestra reducida:

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de cuatro años consecutivos, conforme a lo establecido en el cuadro 2.B de la sección III.

Durante ese período de cuatro años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta al HVK y cualquier sospecha de HCK habrá sido descartada de conformidad con los métodos de diagnóstico del punto III.2.

b)

Si durante los cuatro años de aplicación del programa de vigilancia establecido en la letra a) queda confirmada la infección por el HVK en una explotación incluida en este programa de vigilancia y, por tanto, le ha sido retirada su calificación sanitaria de la categoría II, la explotación podrá recuperar inmediatamente la calificación sanitaria de la categoría II y seguir aplicando el programa de vigilancia para obtener la calificación de libre de enfermedad sin aplicar un programa de erradicación con arreglo al punto I.2.2 a condición de que cumpla las siguientes condiciones:

i)

es una explotación continental cuya calificación con respecto a la HCK es independiente de la calificación sanitaria de las poblaciones de animales acuáticos de las aguas naturales circundantes con respecto a dicha enfermedad de la lista, de conformidad con la parte II, punto 3 del anexo V de la Directiva 2006/88/CE,

ii)

haya sido vaciada, limpiada, desinfectada y puesta en barbecho; la duración del barbecho será de al menos seis semanas,

iii)

ha sido repoblada con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la HCK.

I.2.2.   Programas de erradicación

I.2.2.1.   Requisitos generales

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la HCK podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de erradicación:

a)

Las medidas de control mínimas establecidas en el capítulo V, sección 4, de la Directiva 2006/88/CE han sido aplicadas eficazmente y se ha establecido una zona de confinamiento conforme al artículo 32, letra b), de dicha Directiva que incluye una zona de protección y una zona de vigilancia en las inmediaciones de las explotaciones oficialmente declaradas infectadas por el HVK.

La zona de confinamiento debe haber sido definida caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de la HCK a los peces de piscicultura y salvajes, como son: el número de peces muertos y la tasa y distribución de la mortalidad de peces en la explotación infectada por el HVK; la distancia y densidad de las explotaciones vecinas; la proximidad a mataderos; las explotaciones en contacto; las especies presentes en las explotaciones; las prácticas de cría aplicadas en las explotaciones afectadas y vecinas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos en lo que respecta a la delimitación geográfica de dichas zonas:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación oficialmente declarada infectada por el HVK, que corresponderá a toda la cuenca hidrográfica de la explotación oficialmente declarada infectada por el HVK; la autoridad competente podrá limitar la extensión de la zona a partes de la cuenca hidrográfica, a condición de que no se vea comprometida la prevención de la propagación de la HCK.

ii)

Se establecerá una zona de vigilancia fuera de la zona de protección, que corresponderá a una zona ampliada circundante de la zona de protección establecida.

b)

Todas las explotaciones no oficialmente declaradas infectadas por el HVK que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos los siguientes elementos:

i)

la toma de muestras para pruebas de 10 peces cuando se observen signos clínicos o post mortem compatibles con la HCK, o de 30 peces cuando no se observen signos clínicos o post mortem,

ii)

una inspección sanitaria en las explotaciones en las que las pruebas contempladas en el punto III.2 hayan dado resultados negativos; las inspecciones sanitarias continuarán una vez al mes en la estación en la que la temperatura del agua alcance probablemente más de 15 °C, hasta que se retire la zona de protección de conformidad con el punto I.2.2.1, letra c).

c)

Todas las explotaciones oficialmente declaradas infectadas por el HVK serán vaciadas, limpiadas, desinfectadas y puestas en barbecho. La duración del barbecho será de al menos seis semanas. Cuando todas las explotaciones situadas dentro de la misma zona de protección que estén oficialmente declaradas infectadas hayan sido vaciadas, se dejarán en barbecho de forma sincronizada durante al menos tres semanas. El presente apartado se aplicará también a las nuevas explotaciones oficialmente declaradas infectadas durante la aplicación del programa de erradicación.

Cuando se pongan en barbecho las explotaciones oficialmente declaradas infectadas, las zonas de protección se convertirán en zonas de vigilancia.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración del barbecho tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones oficialmente declaradas infectadas por el HVK y todas las demás explotaciones puestas en barbecho dentro de las zonas de protección y vigilancia establecidas serán repobladas:

i)

con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la HCK, o bien

ii)

durante un período transitorio hasta el 31 de diciembre de 2020, con peces procedentes de Estados miembros, zonas o compartimentos con un programa de vigilancia aprobado de la HCK.

La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas por el HVK hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2.1, letra c).

e)

Todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación y, cuando se exija la vigilancia de poblaciones salvajes, los puntos de muestreo seleccionados con arreglo al punto I.1, se someterán posteriormente, al menos, al programa de vigilancia establecido en el punto I.2.1.

I.2.2.2.   Requisitos para que recuperen la calificación de libre de enfermedad los compartimentos continentales que consten de una sola explotación previamente declarada libre de HCK

Un compartimento continental que conste de una sola explotación con calificación sanitaria de la categoría I respecto a la HCK, cuya calificación sanitaria en lo que se refiere a esta enfermedad sea independiente de las aguas naturales circundantes con arreglo a la parte II, punto 3, del anexo V de la Directiva 2006/88/CE y cuya calificación de la categoría I haya sido retirada con arreglo al artículo 53, apartado 3, de dicha Directiva podrá recuperar la calificación sanitaria de la categoría I con respecto a la HCK inmediatamente después de que la autoridad competente haya confirmado que se cumplen las siguientes condiciones:

a)

ha sido vaciado, limpiado, desinfectado y puesto en barbecho; la duración del barbecho será de al menos seis semanas;

b)

ha sido repoblado con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I o de compartimentos con un programa de vigilancia de la HCK aprobado (calificación sanitaria de la categoría II).

I.3.   Requisitos específicos para mantener la calificación de la categoría I con respecto a la HCK

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro del Estado miembro, la zona o el compartimento en cuestión serán sometidas a una inspección sanitaria y se tomarán muestras de conformidad con el cuadro 2.B de la sección III de la presente parte, teniendo en cuenta el nivel de riesgo que presente la explotación de contraer el HVK.

La frecuencia de las inspecciones sanitarias de los compartimentos de la categoría I con respecto a la HCK situados en zonas continentales y que comprendan una o varias explotaciones cuya calificación sanitaria con respecto a la HCK dependa de la calificación sanitaria con respecto a dicha enfermedad de la lista de las aguas naturales circundantes, de conformidad con la parte II, punto 2, del anexo V de la Directiva 2006/88/CE, estará en consonancia con el número fijado para el nivel de riesgo alto en el cuadro 2.C.

En los Estados miembros, zonas o compartimentos en los que el número de explotaciones sea limitado y la vigilancia específica de estas explotaciones no proporcione suficientes datos epidemiológicos, los sistemas de vigilancia para mantener la calificación de libre de enfermedad incluirán puntos de muestreo seleccionados con arreglo a los requisitos establecidos en el punto I.1.

Esos puntos de muestreo serán inspeccionados y muestreados por rotación del 50 % de los puntos de muestreo de cada año. El muestreo se efectuará de conformidad con el cuadro 2.C de la sección III. Las muestras serán seleccionadas, preparadas y examinadas con arreglo a lo descrito en la sección II y los exámenes de laboratorio serán negativos por lo que respecta al HVK.

La calificación de libre de enfermedad solo se mantendrá mientras todas las muestras analizadas utilizando los métodos de diagnóstico del punto II.2 den resultados negativos por lo que respecta a la HCK y cualquier sospecha de HCK quedará descartada de conformidad con los métodos de diagnóstico del punto III.2.

I.4.   Requisitos específicos para el levantamiento de las medidas de confinamiento establecidas en el artículo 39 de la Directiva 2006/88/CE a fin de obtener la calificación sanitaria de la categoría III con respecto a la HCK en Estados miembros, zonas o compartimentos que tengan la calificación sanitaria de la categoría V

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la HCK podrá obtener la calificación sanitaria de la categoría III con respecto a dicha enfermedad de la lista a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2.1, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones serán sometidas a una medida alternativa que proporcione una garantía similar de exterminio del HVK desde el entorno de la explotación;

b)

todas las explotaciones oficialmente declaradas infectadas y todas las demás explotaciones puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a la HCK;

c)

la repoblación solo se haya efectuado cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a).

II.   Métodos de diagnóstico y muestreo para la vigilancia a fin de obtener y mantener la calificación de libre de HCK

II.1.   Muestras

El material tisular que deberá examinarse consistirá en partes de las branquias y del riñón. Podrán mezclarse trozos de órganos de un máximo de dos peces.

II.2.   Métodos de diagnóstico para la vigilancia a fin de obtener y mantener la calificación de libre de HCK

El método de diagnóstico para obtener o mantener la calificación de libre de HCK será la PCR en directo (qPCR), de conformidad con los métodos y procedimientos detallados de diagnóstico de la parte 2, punto II, del anexo II.

III.   Métodos de diagnóstico y muestreo para las investigaciones oficiales a fin de confirmar o descartar una sospecha de HCK

III.1.   Muestras

El material tisular que deberá examinarse consistirá en partes de las branquias y del riñón. Podrán mezclarse trozos de órganos de un máximo de dos peces.

III.2.   Investigación oficial y métodos de diagnóstico para descartar o confirmar la infección por el HVK

Cuando sea preciso confirmar o descartar una sospecha de HCK de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicará el siguiente procedimiento de inspección, muestreo y ensayo:

a)

La investigación oficial incluirá al menos una inspección sanitaria y un muestreo de 10 peces cuando se observen signos clínicos o post mortem compatibles con una infección por el HVK, o de 30 peces cuando no se observen signos clínicos o post mortem. Las muestras se examinarán utilizando los métodos de diagnóstico que se establecen en la letra b), de acuerdo con los métodos y procedimientos detallados de diagnóstico de la parte 2, punto II, del anexo II.

b)

La infección por el HVK se considerará confirmada si se detecta el HVK mediante PCR.

La sospecha de HCK podrá descartarse si este ensayo no aporta ninguna otra prueba de la presencia del HVK.

Cuadro 2.A

Sistema de vigilancia de zonas y compartimentos con arreglo al punto I.2.1 para el período de control de dos años anterior a la obtención de la calificación de libre de HCK

 

 

Número de inspecciones clínicas anuales (dos años)

Número de exámenes de laboratorio anuales (dos años)

Número de peces de la muestra

Explotaciones o zonas de muestreo

Primeros dos años del período de vigilancia

2

2

75 (10)

 

Número máximo de peces por muestra conjunta: 2


Cuadro 2.B.

Sistema de vigilancia de zonas y compartimentos con arreglo al punto I.2.1 para el período de control de cuatro años anterior a la obtención de la calificación de libre de HCK

 

 

Número de inspecciones clínicas anuales

Número de exámenes de laboratorio anuales

Número de peces de la muestra

Explotaciones o zonas de muestreo

Primeros dos años del período de vigilancia

1

1

30

Explotaciones o zonas de muestreo

Últimos dos años del período de vigilancia

2

2

30

 

Número máximo de peces por muestra conjunta: 2


Cuadro 2.C

Sistemas de vigilancia de zonas o compartimentos con arreglo al punto I.3 para mantener la calificación de libre de HCK

Nivel de riesgo

Número de inspecciones sanitarias

Número de peces de la muestra

Alto

2 cada año

30

Medio

1 cada año

30

Bajo

1 cada dos años

30

Número máximo de peces por muestra conjunta: 2


Cuadro 2.D

Sistema de vigilancia con arreglo al punto I.3 para mantener la calificación de libre de HCK en los Estados miembros, zonas o compartimentos en los que el número de explotaciones es limitado y la vigilancia específica en estas explotaciones no proporciona suficientes datos epidemiológicos

 

Número de inspecciones clínicas anuales

Número de exámenes de laboratorio anuales

Número de peces de la muestra

Puntos de muestreo

1 cada dos años

1 cada dos años

30

Número máximo de peces por muestra conjunta: 2

PARTE 3

MÉTODOS DE VIGILANCIA Y CONTROL DE LA ANEMIA INFECCIOSA DEL SALMÓN (AIS)

I.   Requisitos aplicables a los programas de vigilancia y erradicación para obtener y mantener la calificación sanitaria de libre de AIS y para confinar la infección por el VAIS con supresión en la HPR

I.1.   Requisitos generales

Cuando sea preciso efectuar las inspecciones sanitarias y los muestreos de explotaciones de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE más de una vez al año, los intervalos entre las inspecciones sanitarias o las tomas de muestras serán lo más largos posible.

Cuando sea precisa una vigilancia específica de las poblaciones salvajes de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE, se determinarán el número y la distribución geográfica de los puntos de muestreo para obtener una cobertura razonable del Estado miembro, zona o compartimento. Los puntos de muestreo también serán representativos de los diferentes ecosistemas en los que se encuentren las poblaciones salvajes sensibles.

Las inspecciones se efectuarán en todas las unidades de producción, como estanques, tanques y jaulas de red, para detectar la presencia de peces muertos, débiles o con comportamiento anómalo. Se prestará especial atención a la zona de salida de agua, donde tienden a acumularse los peces débiles a causa de las corrientes de agua.

Los peces que vayan a recogerse como muestras se seleccionarán como sigue:

a)

Únicamente se seleccionarán peces moribundos o recién muertos, pero no descompuestos. En particular, se dará prioridad en la toma de muestras a los peces que muestren anemia, hemorragias u otros signos clínicos que indiquen trastornos circulatorios.

b)

Si el salmón del Atlántico es una de las especies sensibles presentes en el lugar, se dará prioridad a las muestras de salmón del Atlántico. Si no hay salmón del Atlántico en la explotación piscícola, se tomarán muestras de otras especies sensibles.

c)

Si se utiliza más de una fuente de agua para la producción piscícola, se incluirán en la muestra peces que representen todas las fuentes de agua.

d)

Los peces se seleccionarán de modo que estén representadas proporcionalmente en la muestra todas las unidades de producción de la explotación, como jaulas de red, tanques y estanques, y todas las clases anuales.

I.2.   Requisitos específicos para obtener la calificación sanitaria de la categoría I con respecto a la AIS

I.2.1.   Programas de vigilancia

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III con respecto a la AIS de conformidad con la parte B del anexo III de la Directiva 2006/88/CE podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro de ese Estado miembro, zona o compartimento cumplan los requisitos pertinentes establecidos en el anexo V de la misma Directiva y todas esas explotaciones y, en caso de que lo exija la parte I, punto 2, párrafo segundo, de su anexo V, todos los puntos de muestreo de poblaciones salvajes seleccionados de conformidad con dicho punto, hayan sido sometidos al siguiente programa de vigilancia:

a)

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 3.A de la sección II.

b)

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta al VAIS con supresión en la HPR y cualquier sospecha de AIS habrá sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

c)

Si durante la aplicación del programa de vigilancia queda confirmada la AIS en una explotación incluida en dicho programa de vigilancia y, por tanto, le ha sido retirada la calificación sanitaria de la categoría II, debe efectuarse un programa de erradicación con arreglo al punto I.2.2.

I.2.2.   Programas de erradicación

I.2.2.1.   Requisitos generales

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la AIS podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos a un programa de erradicación que cumpla las letras a) a e) siguientes:

a)

Las medidas mínimas de control establecidas en el capítulo V, sección 3, de la Directiva 2006/88/CE habrán sido aplicadas eficazmente y, en particular, se ha establecido una zona de confinamiento conforme al artículo 32, letra b), de dicha Directiva que incluye una zona de protección y una zona de vigilancia en las inmediaciones de las explotaciones oficialmente declaradas infectadas por el VAIS con supresión en la HPR o con AIS confirmada.

La zona de confinamiento habrá sido definida caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de la AIS a los peces de piscicultura y salvajes, como son: el número de peces muertos y la tasa y distribución de la mortalidad de peces en la explotación infectada por el VAIS con supresión en la HPR o con AIS confirmada; la distancia y densidad de las explotaciones vecinas; la proximidad a mataderos; las explotaciones en contacto; las especies presentes en las explotaciones; las prácticas de cría aplicadas en las explotaciones afectadas y vecinas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos en lo que respecta a la delimitación geográfica de dichas zonas:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación oficialmente declarada infectada por la AIS que corresponderá:

1)

en las zonas costeras: a una zona incluida en un círculo de un radio mínimo de una amplitud de marea, o al menos 5 km, con su centro en la explotación oficialmente declarada infectada por AIS, o a una zona equivalente determinada conforme a datos hidrodinámicos o epidemiológicos adecuados;

2)

en zonas interiores: a toda la cuenca hidrográfica de la explotación oficialmente declarada infectada por la AIS; la autoridad competente podrá limitar la extensión de la zona a partes de la cuenca hidrográfica, a condición de que no se vea comprometida la prevención de la propagación de la AIS.

ii)

Se establecerá una zona de vigilancia fuera de la zona de protección que corresponderá:

1)

en las zonas costeras: a una zona circundante de la zona de protección donde se superpongan varias amplitudes de marea; o a una zona circundante de la zona de protección e incluida en un círculo de 10 km de radio desde el centro de la zona de protección; o a una zona equivalente determinadas conforme a datos hidrodinámicos o epidemiológicos adecuados, o bien

2)

en zonas interiores: a una zona ampliada fuera de la zona de protección establecida;

b)

Todas las explotaciones no oficialmente declaradas infectadas por la AIS que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos los siguientes elementos:

i)

la toma de muestras para pruebas de 10 peces moribundos como mínimo cuando se observen signos clínicos o post mortem compatibles con la AIS, o de 30 peces como mínimo cuando no se observen signos clínicos o post mortem;

ii)

una inspección sanitaria en las explotaciones en las que las pruebas del inciso i) hayan dado resultados negativos, las inspecciones sanitarias continuarán una vez al mes hasta que se retire la zona de protección con arreglo al punto I.2.2.1, letra c).

c)

Todas las explotaciones oficialmente declaradas infectadas por el VAIS con supresión en la HPR o con AIS confirmada serán vaciadas, limpiadas, desinfectadas y puestas en barbecho durante un período de al menos tres meses. Las zonas de protección y de vigilancia podrán levantarse cuando todas las explotaciones situadas dentro de la zona de protección hayan sido vaciadas, limpiadas, desinfectadas y, posteriormente, puestas en barbecho de forma sincronizada durante al menos seis semanas.

Cuando se pongan en barbecho las explotaciones oficialmente declaradas infectadas, las zonas de protección se convertirán en zonas de vigilancia.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración del barbecho de dichas explotaciones tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones oficialmente declaradas infectadas por el VAIS con supresión en la HPR o con AIS confirmada y todas las demás explotaciones puestas en barbecho dentro de las zonas de protección y vigilancia establecidas serán repobladas con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la AIS.

La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2.1, letra c).

e)

Todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación y, cuando se exija la vigilancia de poblaciones salvajes, los puntos de muestreo seleccionados con arreglo al punto I.1, se someterán posteriormente al sistema de vigilancia establecido en el punto I.2.1.

I.2.2.2.   Requisitos relativos a la recuperación de la calificación de libre de enfermedad por los compartimentos continentales que consten de sola explotación que fue previamente declarada con la calificación sanitaria de la categoría I

Un compartimento continental que conste de una sola explotación con calificación sanitaria de la categoría I respecto a la AIS, cuya calificación sanitaria sea independiente de las aguas naturales circundantes con arreglo a la parte II, punto 3, del anexo V de la Directiva 2006/88/CE y cuya calificación sanitaria de la categoría I haya sido retirada con arreglo al artículo 53, apartado 3, de dicha Directiva podrá recuperarla inmediatamente después de que la autoridad competente haya confirmado que cumple las siguientes condiciones:

a)

ha sido vaciado, limpiado, desinfectado y puesto en barbecho; la duración del barbecho será de al menos seis semanas;

b)

ha sido repoblado con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la AIS.

I.3.   Medidas mínimas de control para mantener la calificación de la categoría I con respecto a la AIS

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de la categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro del Estado miembro, la zona o el compartimento en cuestión serán sometidas a inspecciones sanitarias y se tomarán muestras de conformidad con el cuadro 3.B (11) de la sección II de la presente parte, teniendo en cuenta el nivel de riesgo que presente la explotación de contraer la AIS.

Al determinar la frecuencia de las inspecciones sanitarias para la calificación sanitaria de la categoría con respecto a la AIS en los compartimentos situados en las zonas continentales y cuya calificación sanitaria con respecto a la AIS depende de la calificación sanitaria de las aguas naturales circundantes donde vive el salmón del Atlántico (Salmo salar), el riesgo de contraer la AIS se considerará alto.

La calificación de libre de AIS solo podrá mantenerse mientras todas las muestras analizadas utilizando los métodos de diagnóstico del punto II.2 hayan dado resultados negativos por lo que respecta al VAIS con supresión en la HPR y cualquier sospecha de AIS haya sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

I.4.   Requisitos específicos para obtener la calificación sanitaria de la categoría III con respecto al VAIS con supresión en la HPR en Estados miembros, zonas o compartimentos que tenían anteriormente la calificación sanitaria de la categoría V

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la AIS podrá obtener la calificación de la categoría III a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2.1, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones se someterán a una medida alternativa que proporcione una garantía similar de exterminio del VAIS desde el entorno de la explotación;

b)

todas las explotaciones oficialmente declaradas infectadas y todas las demás explotaciones en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con peces procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a la AIS;

c)

dicha repoblación solo se haya efectuado después de que todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a);

d)

no se haya confirmado el VAIS con supresión en la HPR durante el período de dos años que sigue a la finalización de las medidas mencionadas en las letras a), b) y c) y las sospechas durante este período hayan sido descartadas con arreglo a los procedimientos establecidos en el punto II.3.

II.   Métodos de diagnóstico e investigaciones oficiales

II.1.   Muestras

El material tisular que deberá examinarse será:

a)

estudio histológico: riñón anterior, hígado, corazón, páncreas, intestino, bazo y branquias;

b)

pruebas inmunohistoquímicas: riñón medio y corazón, incluidos válvulas y bulbus arteriosus;

c)

pruebas de RT-qPCR: riñón medio y corazón;

d)

cultivo del virus: riñón medio, corazón, hígado y bazo.

Podrán mezclarse trozos de órganos de un máximo de cinco peces.

II.2.   Métodos de diagnóstico para obtener o mantener la calificación de libre de AIS

El método de diagnóstico que debe utilizarse para obtener o mantener la calificación de libre de AIS con arreglo a los puntos I.2 y I.3 será la RT-qPCR, seguida de la secuenciación de muestras positivas de conformidad con los métodos y procedimientos detallados establecidos en la parte 3 del anexo II.

En caso de resultado positivo de la RT-qPCR, se someterán a ensayo otras muestras antes de aplicar las medidas de control iniciales contempladas en el artículo 28 de la Directiva 2006/88/CE.

Tales muestras se someterán a las siguientes pruebas de conformidad con los métodos y procedimientos detallados establecidos en la parte 3 del anexo II:

a)

cribado de las muestras mediante RT-qPCR, incluida la secuenciación del gen HE para verificar la supresión en la HPR;

y

b)

examen en preparaciones tisulares mediante anticuerpos específicos contra el VAIS (a saber, IHC en cortes fijados o IFAT en improntas tisulares); o

c)

aislamiento e identificación del VAIS en cultivo celular de al menos una muestra de cualquier pez muestreado de la explotación.

II.3.   Investigación oficial y métodos de diagnóstico para descartar o confirmar la AIS

Cuando se deba confirmar o descartar una sospecha de AIS de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicará el siguiente procedimiento de inspección, muestreo y ensayo:

a)

La investigación oficial, que incluirá al menos una inspección sanitaria y un muestreo de 10 peces moribundos, cuando se observen signos clínicos o post mortem compatibles con la AIS. Si no se observan signos clínicos o post mortem compatibles con la AIS, la inspección sanitaria irá seguida de un muestreo selectivo de como mínimo treinta peces moribundos o recién muertos con constitución normal, de conformidad con el punto I.1. Las muestras se someterán a ensayo de conformidad con los métodos de diagnóstico que se establecen en la letra b).

b)

En caso de resultado positivo de la RT-qPCR para la detección del VAIS con supresión en la HPR, se someterán a ensayo otras muestras antes de aplicar las medidas de control iniciales contempladas en el artículo 28 de la Directiva 2006/88/CE. Un caso sospechoso de infección por VAIS se confirmará de conformidad con los siguientes criterios, utilizando los métodos y procedimientos detallados establecidos en la parte 3 del anexo II:

i)

detección del VAIS mediante RT-qPCR, incluida la secuenciación del gen HE para verificar la supresión en la HPR, y detección del VAIS en preparaciones tisulares mediante anticuerpos específicos contra dicho virus (a saber, IHC en cortes fijados o IFAT en improntas tisulares),

o

ii)

detección del VAIS mediante RT-qPCR, incluida la secuenciación del gen HE para verificar la supresión en la HPR, y

aislamiento e identificación del VAIS en cultivo celular de al menos una muestra de cualquier pez procedente de la explotación.

c)

Cuando se observen signos clínicos, alteraciones patológicas macroscópicas o constataciones histopatológicas compatibles con la AIS, las conclusiones serán corroboradas por la detección del virus mediante dos métodos de diagnóstico con principios de detección independientes, como RT-qPCR e IHC, de conformidad con la parte 3 del anexo II.

La sospecha de AIS podrá descartarse si se constata que, a lo largo de doce meses a partir de la fecha de la sospecha, los ensayos y las inspecciones no aportan ninguna otra prueba de la presencia de AIS.

Cuadro 3.A

Sistema de vigilancia de zonas y compartimentos para el período de control de dos años anterior a la obtención de la calificación de libre de AIS con arreglo al punto I.2.1

Año de vigilancia

Número de inspecciones sanitarias anuales (dos años)

Número de exámenes de laboratorio anuales (dos años)

Número de peces de los que deben tomarse muestras por año

Año 1

6

2 (12)

2 * 75 (13)

Año 2

6

2 (12)

2 * 75 (13)


Cuadro 3.B.

Sistemas de vigilancia de zonas o compartimentos para mantener la calificación de libre de AIS con arreglo al punto I.3  (15)

Nivel de riesgo

Número de inspecciones sanitarias anuales

Número de exámenes de laboratorio anuales

Número de peces de los que deben tomarse muestras por año

Alto

2

2 (14)

2 * 30

Medio

1

1 (14)

30

Bajo

1 cada dos años

1 cada dos años

30 cada dos años

PARTE 4

MÉTODOS DE VIGILANCIA Y CONTROL DE LA INFECCIÓN POR MARTEILIA REFRINGENS

I.   Requisitos aplicables a los programas de vigilancia y erradicación para obtener y mantener la calificación sanitaria de libre de infección por Marteilia refringens

I.1.   Requisitos generales

Las inspecciones sanitarias y, en su caso, la toma de muestras para exámenes de laboratorio se efectuarán durante el período del año en el que se sepa que la prevalencia del parásito en el Estado miembro, zona o compartimento es máxima. Cuando esta información no esté disponible, el muestreo se efectuará inmediatamente después de que la temperatura del agua haya superado los 17 °C.

Cuando los moluscos deban muestrearse con arreglo a los requisitos establecidos en la parte 4, se aplicarán los criterios siguientes:

a)

Si Ostrea spp. y Mytilus spp. están presentes en las unidades de producción o en la zona de producción, ambos géneros tendrán la misma presencia en el tamaño de la muestra. Si solo uno de ellos está presente, ese género será objeto de muestreo. Si no están presentes los géneros Ostrea ni Mytilus, la muestra será representativa de todas las demás especies sensibles presentes.

b)

Si en las unidades de producción hay moluscos débiles, moribundos o recién muertos pero no descompuestos, se seleccionarán estos principalmente. Si no los hay, se seleccionarán los moluscos sanos de más edad.

c)

Al tomar muestras en explotaciones que utilicen más de una fuente de agua para la producción de moluscos, se incluirán en el muestreo moluscos que representen todas las fuentes de agua, de modo tal que todas las partes de la explotación estén proporcionalmente representadas en la muestra.

d)

Al tomar muestras en zonas de cría de moluscos, se incluirán en la muestra moluscos de un número suficiente de puntos de muestreo, de modo tal que todas las partes de la zona de cría estén proporcionalmente representadas en la muestra. Los principales factores que deben considerarse para seleccionar estos puntos de muestreo son los anteriores puntos de muestreo donde se detectó Marteilia refringens, la densidad de cría, los flujos de agua, la presencia de especies sensibles, la presencia de especies portadoras, la batimetría y las prácticas de gestión. Los bancos naturales se incluirán en el muestreo.

I.2.   Requisitos específicos para obtener la calificación sanitaria de la categoría I con respecto a Marteilia refringens

I.2.1.   Programas de vigilancia

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III con respecto a la infección por Marteilia refringens podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones o zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de vigilancia, que incluye inspecciones sanitarias y la toma de muestras para pruebas.

Programa de vigilancia de dos años:

a)

Las explotaciones o zonas de cría de moluscos habrán sido sometidas a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 4.A de la sección II.

b)

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta a Marteilia refringens y cualquier sospecha de Marteilia refringens habrá sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

c)

Cuando vayan a incluirse en la muestra Ostrea edulis, Mytilus edulis o Mytilus galloprovincialis procedentes de un Estado miembro, zona o compartimento de calificación sanitaria de la categoría I, habrán sido introducidos en la explotación o zona de cría de moluscos al menos en la primavera inmediatamente anterior al período en el que se lleve a cabo el programa de vigilancia.

I.2.2.   Programas de erradicación

La erradicación de Marteilia refringens se considera imposible en la mayoría de los casos; no obstante, cuando el Estado miembro la juzgue viable, se aplicará el siguiente modelo de programa de erradicación.

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la infección por Marteilia refringens podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones o zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de erradicación:

a)

Las medidas del capítulo V, sección 3, de la Directiva 2006/88/CE habrán sido aplicadas eficazmente y, en particular, se habrá establecido una zona de confinamiento conforme al artículo 32, letra b), de la Directiva 2006/88/CE, que incluya una zona de protección y una zona de vigilancia, en las inmediaciones de las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas por Marteilia refringens.

La zona de confinamiento se definirá caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de Marteilia refringens, como son: el número de moluscos muertos, su edad y la tasa y distribución de la mortalidad de moluscos en la explotación o zona de cría de moluscos infectada por Marteilia refringens, incluidos los moluscos salvajes; la distancia y densidad de las explotaciones o zonas de cría vecinas, incluidos los moluscos salvajes; la proximidad a centros de transformación, explotaciones en contacto o zonas de cría de moluscos; las especies, en particular las sensibles y portadoras, presentes en las explotaciones o zonas de cría de moluscos; las prácticas de cría aplicadas en las explotaciones y zonas de cría de moluscos afectadas y vecinas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación o zona de cría de moluscos oficialmente declarada infectada por Marteilia refringens, que corresponderá a una zona determinada conforme a datos hidrodinámicos o epidemiológicos adecuados.

ii)

Se establecerá una zona de vigilancia fuera de la zona de protección, que corresponderá a una zona circundante de la zona de protección determinada conforme a datos hidrodinámicos o epidemiológicos adecuados.

b)

Todas las explotaciones y zonas de cría de moluscos no oficialmente declaradas infectadas por Marteilia refringens que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos la recogida de muestras para pruebas de 150 moluscos después del comienzo del período de transmisión de Marteilia refringens. Cuando se desconozca el período de transmisión, el muestreo comenzará después de que la temperatura del agua supere los 17 °C.

c)

todas las explotaciones y zonas de cría de moluscos oficialmente declaradas infectadas por Marteilia refringens serán vaciadas, puestas en barbecho y, de ser posible, limpiadas y desinfectadas.

La duración del barbecho será de al menos:

i)

dos meses en el caso de explotaciones y zonas de cría de moluscos con comunicaciones limitadas con las aguas circundantes, como los criaderos y viveros,

ii)

dos meses en el caso de explotaciones y zonas de cría de moluscos con comunicaciones ilimitadas con las aguas circundantes, siempre que los moluscos de especies sensibles que estén infectados o tengan lazos epidemiológicos con la explotación o zona de cría de moluscos infectada hayan sido recolectados o sacados antes del período del año en el que se sepa que la prevalencia de Marteilia refringens es máxima o, cuando dicho período no se conozca, antes de que la temperatura del agua supere los 17 °C,

iii)

catorce meses en el caso de explotaciones y zonas de cría de moluscos con comunicaciones ilimitadas con las aguas circundantes, siempre que los moluscos de especies sensibles que estén infectados o tengan lazos epidemiológicos con la explotación o zona de cría de moluscos infectada no hayan sido recolectados ni sacados antes del período del año en el que se sepa que la prevalencia de Marteilia refringens es máxima o, si no se conoce esta información, cuando los moluscos de especies sensibles no hayan sido recolectados ni sacados antes de que la temperatura del agua supere los 17 °C;

Cuando todas las explotaciones y zonas de cría de moluscos oficialmente declaradas infectadas hayan sido vaciadas, se dejarán en barbecho de forma sincronizada durante al menos cuatro semanas.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones o zonas de cría de moluscos dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración del barbecho tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas y todas las demás explotaciones o zonas de cría de moluscos puestas en barbecho dentro de las zonas de protección y vigilancia establecidas serán repobladas con moluscos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la infección por Marteilia refringens.

La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2, letra c).

e)

Todas las explotaciones y zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación se someterán posteriormente al sistema de vigilancia establecido en el punto I.2.1.

I.3.   Requisitos específicos para mantener la calificación sanitaria de libre de la enfermedad (categoría I) con respecto a la infección por Marteilia refringens

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de la categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones o zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, la zona o el compartimento en cuestión serán sometidas a inspecciones sanitarias y se tomarán muestras de conformidad con el cuadro 4.B de la sección II, teniendo en cuenta el nivel de riesgo que presente la explotación o zona de cría de moluscos de infectarse por Marteilia refringens.

La calificación de libre de enfermedad solo se mantendrá mientras todas las muestras analizadas utilizando los métodos de diagnóstico del punto II.2 hayan dado resultados negativos por lo que respecta a Marteilia refringens y cualquier sospecha de Marteilia refringens haya sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

I.4.   Requisitos para el levantamiento de las medidas de confinamiento establecidas en el artículo 39 de la Directiva 2006/88/CE (cambio de la calificación sanitaria de la categoría V a la categoría III) con respecto a la infección por Marteilia refringens

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a Marteilia refringens podrá obtener la calificación sanitaria de la categoría III con respecto a dicha enfermedad de la lista a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones serán sometidas a una medida alternativa que proporcione una garantía similar de exterminio de Marteilia refringens desde el entorno de la explotación;

b)

todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas y todas las demás explotaciones o zonas de cría de moluscos puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con moluscos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a Marteilia refringens;

c)

la repoblación solo se haya efectuado cuando todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a);

d)

no se haya confirmado la infección por Marteilia refringens durante el período de dos años que sigue a la finalización de las medidas mencionadas en las letras a), b) y c) y las sospechas durante este período hayan sido descartadas con arreglo a los procedimientos establecidos en el punto II.3.

II.   Métodos de diagnóstico e investigaciones oficiales

II.1.   Muestras

Para la realización de las pruebas de diagnóstico establecidas en los puntos II.2 y II.3 se presentará al laboratorio el animal entero.

II.2.   Métodos de diagnóstico para obtener o mantener la calificación de libre de infección por Marteilia refringens

Los métodos de diagnóstico que deben utilizarse para obtener o mantener la calificación de libre de infección por Marteilia refringens con arreglo a los métodos y procedimientos detallados de diagnóstico establecidos en la parte 4 del anexo II serán la histopatología, las improntas tisulares o la PCR.

II.3.   Investigación oficial y métodos de diagnóstico para confirmar o descartar la sospecha de infección por Marteilia refringens

Cuando sea preciso confirmar o descartar una sospecha de infección por Marteilia refringens de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicará el siguiente procedimiento de inspección, muestreo y ensayo:

a)

La investigación oficial incluirá al menos un muestreo de 30 moluscos de las especies sensibles si la sospecha se basa en un informe de mortalidad o, en caso contrario, de 150 moluscos de las especies sensibles después del comienzo del período de transmisión de Marteilia refringens. Cuando se desconozca el período de transmisión, el muestreo comenzará después de que la temperatura del agua supere los 17 °C.

b)

Las muestras se examinarán utilizando los métodos de diagnóstico que se establecen en el inciso i), de acuerdo con los métodos y procedimientos detallados de diagnóstico que figuran en la parte 4, sección I, del anexo II:

i)

La presencia de Marteilia refringens se considerará confirmada cuando un resultado positivo obtenido mediante histopatología, improntas tisulares o hibridación in situ se combine con un resultado positivo en la PCR completada por una secuenciación.

ii)

La sospecha de infección por Marteilia refringens podrá descartarse si los ensayos contemplados en el inciso i) no aportan ninguna otra prueba de la presencia de Marteilia refringens.

Cuadro 4.A

Sistema de vigilancia de Estados miembros, zonas o compartimentos en el período de control anterior a la obtención de la calificación de libre de Marteilia refringens con arreglo al punto I.2.1

 

Número de inspecciones sanitarias anuales

Número de exámenes de laboratorio anuales

Número de moluscos de la muestra

Explotaciones/zonas de cría de moluscos

1

1

150


Cuadro 4.B

Sistemas de vigilancia de Estados miembros, zonas o compartimentos para mantener la calificación de libre de Marteilia refringens con arreglo al punto I.3

Nivel de riesgo

Número de inspecciones sanitarias

Número de exámenes de laboratorio

Número de moluscos de la muestra

Alto

1 cada año

1 cada dos años

150

Medio

1 cada dos años

1 cada dos años

150

Bajo

1 cada dos años

1 cada cuatro años

150

PARTE 5

MÉTODOS DE VIGILANCIA Y CONTROL DE LA INFECCIÓN POR BONAMIA OSTREAE

I.   Requisitos aplicables a los programas de vigilancia y erradicación para obtener y mantener la calificación sanitarias de libre de infección por Bonamia ostreae

I.1.   Requisitos generales

Las inspecciones sanitarias y, en su caso, la toma de muestras en las unidades de producción se efectuarán durante el período del año en el que se sabe que la prevalencia de Bonamia ostreae en el Estado miembro, zona o compartimento es máxima. Cuando esta información no esté disponible, el muestreo se efectuará en invierno o al principio de la primavera.

Cuando los moluscos vayan a muestrearse con arreglo a los requisitos establecidos en la parte 5, se aplicarán los criterios siguientes:

a)

Si Ostrea edulis está presente, solo se seleccionarán para muestreo las ostras de esta especie. Si Ostrea edulis no está presente, la muestra será representativa de todas las demás especies sensibles presentes.

b)

Si hay moluscos débiles, moribundos o recién muertos pero no descompuestos, se seleccionarán estos principalmente. Si no los hay, se seleccionarán los moluscos sanos de más edad.

c)

Al tomar muestras en explotaciones que utilicen más de una fuente de agua para la producción de moluscos, se incluirán en el muestreo moluscos que representen todas las fuentes de agua, de modo tal que todas las partes de la explotación estén proporcionalmente representadas en la muestra.

d)

Al tomar muestras en zonas de cría de moluscos, se incluirán en la muestra moluscos de un número suficiente de puntos de muestreo. Los principales factores que deben considerarse para seleccionar dichos puntos de muestreo son los anteriores puntos de muestreo donde se detectó Bonamia ostreae, la densidad de cría, los flujos de agua, la presencia de especies sensibles, la presencia de especies portadoras, la batimetría y las prácticas de gestión. Los bancos naturales que se encuentren dentro de las zonas de cría o contiguos a estas se incluirán en el muestreo.

I.2.   Requisitos específicos para obtener la calificación sanitaria de la categoría I con respecto a Bonamia ostreae

I.2.1.   Programas de vigilancia

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III con respecto a la infección por Bonamia ostreae podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de vigilancia, que incluye inspecciones sanitarias y la toma de muestras para pruebas.

Programa de vigilancia de dos años:

a)

Las explotaciones y zonas de cría de moluscos que crían especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE habrán sido sometidas a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 5.A de la presente parte.

b)

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta a Bonamia ostreae y cualquier sospecha de Bonamia ostreae habrá sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

c)

Cuando vaya a incluirse en la muestra Ostrea edulis procedente de un Estado miembro, zona o compartimento de calificación sanitaria de la categoría I, habrá sido introducida en la explotación o zona de cría de moluscos al menos en el otoño inmediatamente anterior al período en el que se lleve a cabo el programa de vigilancia.

I.2.2.   Programas de erradicación

La erradicación de Bonamia ostreae se considera imposible en la mayoría de los casos; no obstante, cuando el Estado miembro la juzgue viable, se aplicará el siguiente modelo de programa de erradicación.

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a Bonamia ostreae podrá recuperar la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones o zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de erradicación:

a)

Las medidas mínimas de control establecidas en el capítulo V, sección 3, de la Directiva 2006/88/CE habrán sido aplicadas eficazmente y, en particular, se habrá establecido una zona de confinamiento conforme al artículo 32, letra b), de dicha Directiva que incluya una zona de protección y una zona de vigilancia en las inmediaciones de las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas por Bonamia ostreae.

La zona de confinamiento se definirá caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de dicha enfermedad de la lista, como son: el número de moluscos muertos, su edad y la tasa y distribución de la mortalidad de moluscos en la explotación o zona de cría de moluscos infectada por Bonamia ostreae, incluidos los moluscos salvajes; la distancia y densidad de las explotaciones o zonas de cría vecinas, incluidos los moluscos salvajes; la proximidad a centros de transformación, explotaciones en contacto o zonas de cría de moluscos; las especies presentes en las explotaciones o zonas de cría de moluscos, en particular las especies sensibles y las especies portadoras; las prácticas de cría aplicadas en las explotaciones y zonas de cría de moluscos afectadas y vecinas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación o zona de cría de moluscos oficialmente declarada infectada por Bonamia ostreae, que corresponderá a una zona determinada conforme a datos hidrodinámicos o epidemiológicos adecuados;

ii)

Se establecerá una zona de vigilancia fuera de la zona de protección, que corresponderá a una zona circundante de la zona de protección determinada conforme a datos hidrodinámicos o epidemiológicos adecuados.

b)

Todas las explotaciones y zonas de cría de moluscos no oficialmente declaradas infectadas por Bonamia ostreae que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos la recogida de muestras para pruebas de 150 moluscos después del comienzo del período de transmisión de Bonamia ostreae. Cuando se desconozca el período de transmisión, el muestreo comenzará en invierno o al principio de la primavera.

c)

Todas las explotaciones y zonas de cría de moluscos oficialmente declaradas infectadas por Bonamia ostreae serán vaciadas, puestas en barbecho y, de ser posible, limpiadas y desinfectadas. La duración del barbecho será de al menos seis meses.

Cuando todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas hayan sido vaciadas, se dejarán en barbecho de forma sincronizada durante al menos cuatro semanas.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones o zonas de cría de moluscos dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración del barbecho tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas y todas las demás explotaciones o zonas de cría de moluscos puestas en barbecho dentro de las zonas de protección y vigilancia establecidas serán repobladas con moluscos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la infección por Bonamia ostreae. La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2, letra c).

e)

Todas las explotaciones y zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación se someterán posteriormente al programa de vigilancia establecido en el punto I.2.

I.3.   Requisitos específicos para mantener la calificación sanitaria de libre de infección por Bonamia ostreae (categoría I)

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de la categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones o zonas de cría de moluscos que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro del Estado miembro, zona o compartimento en cuestión serán sometidas a inspecciones sanitarias y se tomarán muestras de conformidad con el cuadro 5.B de la sección II de la presente parte, teniendo en cuenta el nivel de riesgo que presente la explotación o zona de cría de moluscos de contraer una infección por Bonamia ostreae.

La calificación de libre de infección por Bonamia ostreae solo podrá mantenerse mientras todas las muestras analizadas utilizando los métodos de diagnóstico del punto II.2 hayan dado resultados negativos por lo que respecta a Bonamia ostreae y cualquier sospecha de Bonamia ostreae haya sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

I.4.   Requisitos para el levantamiento de las medidas de confinamiento establecidas en el artículo 39 de la Directiva 2006/88/CE (cambio de la calificación sanitaria de la categoría V a la categoría III) con respecto a la infección por Bonamia ostreae

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a Bonamia ostreae podrá obtener la calificación sanitaria de la categoría III con respecto a dicha enfermedad a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones serán sometidas a una medida alternativa que proporcione una garantía similar de exterminio de Bonamia ostreae desde el entorno de la explotación;

b)

todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas y todas las demás explotaciones o zonas de cría de moluscos puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con moluscos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a Bonamia ostreae;

c)

la repoblación solo se haya efectuado después de que todas las explotaciones o zonas de cría de moluscos oficialmente declaradas infectadas hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a);

d)

no se haya confirmado la infección por Bonamia ostreae durante el período de dos años que sigue a la finalización de las medidas mencionadas en las letras a), b) y c) y las sospechas durante este período hayan sido descartadas con arreglo a los procedimientos establecidos en el punto II.3.

II.   Métodos de diagnóstico y criterios de diagnóstico

II.1.   Muestras

Para la realización de las pruebas de diagnóstico establecidas en los puntos II.2 y II.3 se presentará al laboratorio el animal entero.

II.2.   Métodos de diagnóstico para obtener o mantener la calificación de libre de infección por Bonamia ostreae

Los métodos de diagnóstico que deben utilizarse para obtener o mantener la calificación de libre de infección por Bonamia ostreae serán la histopatología, las improntas tisulares o la PCR. Al aplicar estos métodos de diagnóstico, se seguirán los correspondientes métodos y procedimientos detallados establecidos en la parte 5 del anexo II.

II.3.   Métodos de diagnóstico para confirmar o descartar la sospecha de infección por Bonamia ostreae

Cuando sea preciso confirmar o descartar una sospecha de infección por Bonamia ostreae de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicará el siguiente procedimiento de inspección, muestreo y ensayo:

La investigación oficial incluirá al menos un muestreo de 30 moluscos de las especies sensibles si la sospecha se basa en un informe de mortalidad o, en caso contrario, de 150 moluscos de las especies sensibles después del comienzo del período de transmisión de Bonamia ostreae. Cuando se desconozca el período de transmisión, el muestreo comenzará en invierno o al principio de la primavera. Las muestras se examinarán utilizando los métodos de diagnóstico que se establecen en el inciso i), de acuerdo con los métodos y procedimientos detallados de diagnóstico que figuran en la parte 5, sección I, del anexo II.

i)

La presencia de Bonamia ostreae se considerará confirmada cuando un resultado positivo obtenido mediante histopatología, improntas tisulares o hibridación in situ se combine con un resultado positivo en la PCR completada por secuenciación, de conformidad con los métodos y procedimientos aprobados establecidos en la parte 5 del anexo II.

ii)

La sospecha de infección por Bonamia ostreae se descartará si dichos ensayos no aportan ninguna otra prueba de la presencia de Bonamia ostreae.

Cuadro 5.A

Sistema de vigilancia de Estados miembros, zonas o compartimentos para el período de control anterior a la obtención de la calificación de libre de Bonamia ostreae con arreglo al punto I.2.1

 

Número de inspecciones sanitarias anuales

Número de exámenes de laboratorio anuales

Número de moluscos de la muestra

Explotaciones/zonas de cría de moluscos

1

1

150


Cuadro 5.B

Sistemas de vigilancia de Estados miembros, zonas o compartimentos para mantener la calificación de libre de Bonamia ostreae con arreglo al punto I.3

Nivel de riesgo

Número de inspecciones sanitarias

Número de exámenes de laboratorio

Número de moluscos de la muestra

Alto

1 cada año

1 cada dos años

150

Medio

1 cada dos años

1 cada dos años

150

Bajo

1 cada dos años

1 cada cuatro años

150

PARTE 6

MÉTODOS DE VIGILANCIA Y CONTROL DE LA ENFERMEDAD DE LAS MANCHAS BLANCAS (EMB)

I.   Requisitos aplicables a los programas de vigilancia y erradicación para obtener y mantener la calificación sanitaria de libre de EMB y para confinar la infección por el VSMB

I.1.   Requisitos generales de inspección y muestreo

El muestreo de los crustáceos para exámenes de laboratorio se efectuará cuando sea más probable que el agua alcance su temperatura máxima anual. Este requisito relativo a la temperatura del agua se aplicará también a las inspecciones sanitarias cuando esto sea viable y adecuado.

Cuando los crustáceos de cría deban muestrearse con arreglo a los requisitos establecidos en la presente parte, se aplicarán los criterios siguientes:

a)

Si en las unidades de producción hay crustáceos débiles o moribundos, se seleccionarán estos principalmente. Si no los hay, se seleccionarán crustáceos de distintos tamaños, es decir, juveniles y adultos de las especies sensibles seleccionadas, representadas proporcionalmente en la muestra.

b)

Si se utiliza más de una fuente de agua para la producción de crustáceos, se incluirán en la muestra crustáceos que representen todas las fuentes de agua.

Cuando sea precisa una vigilancia específica de las poblaciones salvajes de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE, se determinarán el número y la distribución geográfica de los puntos de muestreo para obtener una cobertura razonable del Estado miembro, zona o compartimento. Los puntos de muestreo también serán representativos de los diferentes ecosistemas en los que se encuentren las poblaciones salvajes de especies sensibles, como sistemas marinos, estuarios, ríos y lagos.

Cuando sea precisa una vigilancia específica de las poblaciones salvajes de conformidad con la parte I, punto 2, párrafo segundo, del anexo V de la Directiva 2006/88/CE, los crustáceos de los que deben tomarse muestras se seleccionarán como sigue:

i)

En los sistemas marinos y estuarios, se seleccionarán una o varias de las siguientes especies: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus o gambas de la familia de los peneidos, como Penaeus japonicus, Penaeus kerathurus o Penaeus semisulcatus. Si no están presentes estas especies, la muestra será representativa de otras especies de decápodos sensibles presentes. Habida cuenta de la amplia gama de hospedadores sensibles, los hospedadores podrán ser seleccionados de entre géneros o familias de decápodos cuya sensibilidad haya sido demostrada de forma experimental o natural.

ii)

En los sistemas fluviales y lagos, se seleccionarán una o varias de las siguientes especies: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes o Orconectes limosus. Si no están presentes estas especies, la muestra será representativa de otras especies de decápodos sensibles presentes. Habida cuenta de la amplia gama de hospedadores sensibles, los hospedadores podrán ser seleccionados de entre géneros o familias de decápodos cuya sensibilidad haya sido demostrada de forma experimental o natural.

iii)

Si hay crustáceos débiles o moribundos, se seleccionarán estos principalmente. Si no los hay, se seleccionarán crustáceos de distintos tamaños, es decir, juveniles y adultos de las especies sensibles seleccionadas, representadas proporcionalmente en la muestra.

I.2.   Requisitos específicos para obtener la calificación sanitaria de la categoría I con respecto a la EMB

I.2.1.   Programas de vigilancia

a)

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría III de conformidad con la parte B del anexo III de la Directiva 2006/88/CE con respecto a la EMB podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro de ese Estado miembro, zona o compartimento cumplan los requisitos pertinentes establecidos en el anexo V de la misma Directiva y todas esas explotaciones y, en caso de que lo exija la parte I, punto 2, párrafo segundo, de su anexo V, todos los puntos de muestreo de poblaciones salvajes seleccionados de conformidad con dicho punto, hayan sido sometidos al menos al siguiente programa de vigilancia, que incluye inspecciones sanitarias y la toma de muestras para pruebas:

Las explotaciones o puntos de muestreo habrán sido sometidos a inspecciones sanitarias y muestreo durante un período mínimo de dos años consecutivos, conforme a lo establecido en el cuadro 6.A de la sección II.

Durante ese período de dos años, las pruebas con todas las muestras utilizando los métodos de diagnóstico del punto II.2 habrán dado resultados negativos por lo que respecta a la EMB y cualquier sospecha de EMB habrá sido descartada de conformidad con los métodos de diagnóstico del punto II.3.

b)

En caso de que, durante la aplicación del programa de vigilancia contemplado en la letra a), la infección por el VSMB se confirme en una explotación incluida en dicho programa de vigilancia y, por tanto, le haya sido retirada su calificación sanitaria de la categoría II, la explotación podrá recuperar inmediatamente la calificación sanitaria de la categoría II y seguir aplicando el programa de vigilancia para obtener la calificación de libre de enfermedad sin aplicar programas de erradicación con arreglo al punto I.2.2 a condición de que:

i)

sea una explotación continental cuya calificación sanitaria con respecto a la EMB es independiente de la calificación sanitaria de las aguas naturales circundantes con respecto a dicha enfermedad de la lista con arreglo a la parte II, punto 3, del anexo V de la Directiva 2006/88/CE,

ii)

haya sido vaciada, limpiada, desinfectada y puesta en barbecho; la duración del barbecho será de al menos seis semanas,

iii)

haya sido repoblada con crustáceos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la EMB.

I.2.2.   Programas de erradicación

I.2.2.1.   Requisitos generales

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la EMB podrá obtener la calificación sanitaria de la categoría I con respecto a dicha enfermedad de la lista cuando todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de ese Estado miembro, zona o compartimento hayan sido sometidas al menos al siguiente programa de erradicación:

a)

Las medidas de control mínimas establecidas en el capítulo V, sección 4, de la Directiva 2006/88/CE habrán sido aplicadas eficazmente y se habrá establecido una zona de confinamiento conforme al artículo 32, letra b), de dicha Directiva que incluya una zona de protección y una zona de vigilancia en las inmediaciones de la explotación o explotaciones oficialmente declaradas infectadas por la EMB.

La zona de confinamiento habrá sido definida caso por caso teniendo en cuenta los factores que influyen en los riesgos de propagación de la EMB a los crustáceos de cría y salvajes, como son: el número de crustáceos muertos y la tasa y distribución de su mortalidad en la explotación infectada por la EMB; la distancia y densidad de las explotaciones vecinas; las explotaciones en contacto; las especies presentes en las explotaciones; las prácticas de cría aplicadas en las explotaciones afectadas y vecinas; las condiciones hidrodinámicas y otros factores de importancia epidemiológica.

Para el establecimiento de las zonas de protección y de vigilancia se aplicarán los siguientes requisitos mínimos:

i)

Se establecerá una zona de protección en las inmediaciones de una explotación oficialmente declarada infectada por la EMB que corresponderá:

1)

en las zonas marinas o de estuario: a la zona incluida en un círculo de un radio mínimo de una amplitud de marea, o al menos 5 km, con su centro en la explotación oficialmente declarada infectada por la EMB, o una zona equivalente determinada conforme a datos hidrodinámicos o epidemiológicos adecuados, o

2)

en las aguas dulces: a toda la cuenca hidrográfica de la explotación oficialmente declarada infectada por la EMB; la autoridad competente podrá limitar la extensión de la zona de protección a partes de la cuenca hidrográfica, a condición de que no se vea comprometida la prevención de la propagación de la EMB.

ii)

Se establecerá una zona de vigilancia fuera de la zona de protección que corresponderá:

1)

en las zonas marinas: a una zona circundante de la zona de protección donde se superpongan varias amplitudes de marea; o a una zona circundante de la zona de protección e incluida en un círculo de 10 km de radio desde el centro de la zona de protección; o a una zona equivalente determinadas conforme a datos hidrodinámicos o epidemiológicos adecuados; o

2)

en las aguas dulces: a una zona ampliada fuera de la zona de protección establecida.

b)

Todas las explotaciones no oficialmente declaradas infectadas por la EMB que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro de la zona de protección serán sometidas a una investigación oficial que incluirá al menos los siguientes elementos:

i)

la toma de muestras para pruebas de 10 crustáceos cuando se observen signos clínicos o post mortem compatibles con una infección por la EMB, o de 150 crustáceos cuando no se observen signos clínicos o post mortem, y

ii)

una inspección sanitaria en las explotaciones en las que las pruebas del inciso i) hayan dado resultados negativos, las inspecciones sanitarias continuarán una vez al mes durante la estación en la que sea más probable que el agua alcance sus temperaturas máximas anuales, hasta que haya sido retirada la zona de protección con arreglo al punto I.2.2.1, letra c).

c)

Todas las explotaciones oficialmente declaradas infectadas por la EMB serán vaciadas, limpiadas, desinfectadas y puestas en barbecho. La duración del barbecho será de al menos seis semanas. Cuando todas las explotaciones oficialmente declaradas infectadas hayan sido vaciadas, se dejarán en barbecho de forma sincronizada durante al menos tres semanas. El presente apartado se aplicará también a las nuevas explotaciones oficialmente declaradas infectadas durante la aplicación del programa de erradicación.

Cuando se pongan en barbecho las explotaciones oficialmente declaradas infectadas, las zonas de protección se convertirán en zonas de vigilancia.

La autoridad competente podrá decidir si exige el vaciado, la limpieza, la desinfección y la puesta en barbecho de otras explotaciones dentro de las zonas de protección y vigilancia establecidas. La autoridad competente determinará la duración de dicho barbecho tras una evaluación de riesgos caso por caso.

d)

Todas las explotaciones oficialmente declaradas infectadas y todas las demás explotaciones puestas en barbecho dentro de las zonas de protección y vigilancia establecidas serán repobladas:

i)

con crustáceos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la EMB, o

ii)

durante un período transitorio hasta el 31 de diciembre de 2020, con crustáceos procedentes de Estados miembros, zonas o compartimentos con un programa de vigilancia aprobado de la EMB.

La repoblación solo se efectuará cuando todas las explotaciones oficialmente declaradas infectadas por la EMB hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho con arreglo al punto I.2.2.1, letra c).

e)

Todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE dentro del Estado miembro, zona o compartimento cubiertos por el programa de erradicación y, cuando se exija la vigilancia de poblaciones salvajes, los puntos de muestreo seleccionados con arreglo a la parte I, punto 2, párrafo segundo, del anexo V de dicha Directiva se someterán posteriormente, al menos, al programa establecido en el punto I.2.1.

I.2.2.2.   Requisitos para que recuperen la calificación de libre de EMB los compartimentos continentales que consten de una sola explotación previamente declarada libre de EMB

Un compartimento continental que consten de una sola explotación con calificación sanitaria de la categoría I respecto a la EMB, cuya calificación sanitaria en lo que se refiere a esta enfermedad sea independiente de las aguas naturales circundantes con arreglo a la parte II, punto 3, del anexo V de la Directiva 2006/88/CE y cuya calificación de la categoría I haya sido retirada con arreglo al artículo 53, apartado 3, de dicha Directiva podrá recuperar la calificación sanitaria de la categoría I inmediatamente después de que la autoridad competente haya confirmado que se cumplen las siguientes condiciones:

a)

La explotación con EMB habrá sido vaciada, limpiada, desinfectada y puesta en barbecho. La duración del barbecho habrá sido de al menos seis semanas.

b)

La explotación con EMB habrá sido repoblada con crustáceos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I con respecto a la EMB.

I.3.   Requisitos específicos para mantener la calificación sanitaria de libre de EMB (categoría I)

Cuando sea precisa una vigilancia específica para mantener la calificación sanitaria de la categoría I de conformidad con el artículo 52 de la Directiva 2006/88/CE, todas las explotaciones que críen especies sensibles enumeradas en la parte II del anexo IV de dicha Directiva dentro del Estado miembro, zona o compartimento en cuestión serán sometidas a una inspección sanitaria y se tomarán muestras de conformidad con el cuadro 6.B de la sección II, teniendo en cuenta el nivel de riesgo de contraer la EMB que presente la explotación.

En los Estados miembros, zonas o compartimentos en los que el número de explotaciones sea limitado y la vigilancia específica de estas explotaciones no proporcione suficientes datos epidemiológicos, los programas de vigilancia para mantener la calificación de libre de enfermedad incluirán puntos de muestreo seleccionados con arreglo a los requisitos establecidos en el punto I.1.

Esos puntos de muestreo serán inspeccionados y muestreados por rotación del 50 % de los puntos de muestreo cada año. El muestreo se efectuará de conformidad con el cuadro 6.B de la sección II. Las muestras serán seleccionadas, preparadas y examinadas de conformidad con los métodos de diagnóstico y muestreo establecidos en la sección II y los exámenes de laboratorio habrán dado resultado negativo por lo que respecta al agente de la EMB.

La calificación de libre de enfermedad solo se mantendrá mientras todas las muestras analizadas utilizando los métodos de diagnóstico y muestreo del punto II.2 den resultados negativos por lo que respecta a la EMB y cualquier sospecha de EMB haya sido descartada de conformidad con la investigación oficial y los métodos de diagnóstico del punto II.3.

I.4.   Requisitos para el levantamiento de las medidas de confinamiento establecidas en el artículo 39 de la Directiva 2006/88/CE (cambio de la calificación sanitaria de la categoría V a la categoría III) con respecto a la EMB

Un Estado miembro, zona o compartimento que tenga la calificación sanitaria de la categoría V con respecto a la EMB podrá obtener la calificación sanitaria de la categoría III con respecto a dicha enfermedad de la lista a condición de que:

a)

se cumplan los requisitos establecidos en el punto I.2.2.1, letras a), b) y c); en caso de que no sea técnicamente posible el barbecho, las explotaciones serán sometidas a una medida alternativa que proporcione una garantía similar de exterminio del VSMB desde el entorno de la explotación;

b)

todas las explotaciones oficialmente declaradas infectadas por la EMB y todas las demás explotaciones puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a) dentro de las zonas de protección y vigilancia establecidas hayan sido repobladas con crustáceos procedentes de Estados miembros, zonas o compartimentos con una calificación sanitaria de la categoría I, II o III con respecto a la EMB;

c)

la repoblación solo se haya efectuado cuando todas las explotaciones oficialmente declaradas infectadas por la EMB hayan sido vaciadas, limpiadas, desinfectadas y puestas en barbecho o sometidas a medidas alternativas con arreglo a la letra a);

d)

no se haya detectado la EMB durante el período de dos años que sigue a la finalización de las medidas mencionadas en las letras a) y b) y las sospechas durante este período hayan sido descartadas con arreglo a los procedimientos establecidos en el punto II.3.

II.   Métodos de diagnóstico y muestreo

II.1.   Muestras

Las muestras de epidermis tegumentaria, ya sean disecadas o contenidas en pereiópodos, pleópodos, piezas bucales o branquias del animal, se fijarán en etanol al 95 % antes de la preparación de muestras para la PCR de dos pasos.

Podrán recogerse otras muestras, fijadas para estudio histológico y microscopía electrónica por transmisión, para respaldar los datos de diagnóstico resultantes de la PCR.

II.2.   Métodos de diagnóstico para obtener o mantener la calificación de libre de EMB

El método de diagnóstico que debe utilizarse para obtener o mantener la calificación de libre de EMB con arreglo a los métodos y procedimientos detallados establecidos en la parte 6 del anexo II será la PCR de dos pasos.

En caso de resultado positivo de la PCR de dos pasos, el resultado será corroborado por la secuenciación del amplicón antes de aplicar las medidas de control iniciales contempladas en el artículo 28 de la Directiva 2006/88/CE, si es posible, en condiciones prácticas mediante la demostración de signos patognomónicos de EMB en los hospedadores sensibles seleccionados, mediante estudio histológico y microscopía electrónica por transmisión.

II.3.   Investigación oficial y métodos de diagnóstico para descartar o confirmar la EMB

Cuando sea preciso confirmar o descartar la sospecha de EMB de conformidad con el artículo 28 de la Directiva 2006/88/CE, se aplicará el siguiente procedimiento de inspección, muestreo y ensayo:

a)

La investigación oficial incluirá al menos una inspección sanitaria y un muestreo de 10 crustáceos cuando se observen signos clínicos o post mortem compatibles con la EMB, o de 150 crustáceos cuando no se observen signos clínicos o post mortem. Las muestras se examinarán utilizando el método de diagnóstico establecido en el punto II.2 (PCR de dos pasos).

b)

La EMB se considerará confirmada cuando la PCR de dos pasos, seguida de secuenciación, con arreglo a los métodos y procedimientos detallados establecidos en la presente parte 6 del anexo II, sea positiva al VSMB y cuando los hospedadores seleccionados presenten signos patognomónicos de la EMB.

La sospecha de EMB podrá descartarse si dichos ensayos no aportan ninguna otra prueba de la presencia de la EMB.

Cuadro 6.A

Sistema de vigilancia de Estados miembros, zonas y compartimentos para el período de control de dos años anterior a la obtención de la calificación de libre de EMB con arreglo al punto I.2.1

 

Número de inspecciones clínicas anuales

Número de exámenes de laboratorio anuales

Número de crustáceos de la muestra

Explotaciones o zonas de muestreo

1

1

150


Cuadro 6.B

Sistemas de vigilancia de Estados miembros, zonas o compartimentos para mantener la calificación de libre de EMB con arreglo al punto I.3

Nivel de riesgo

Número de inspecciones sanitarias

Número de exámenes de laboratorio

Número de crustáceos de la muestra

Alto

1 cada año

1 cada dos años

150

Medio

1 cada dos años

1 cada dos años

150

Bajo

1 cada dos años

1 cada cuatro años

150


(1)  Las muestras se recogerán como muy pronto tres semanas después del traslado de los peces de agua dulce a agua salada.

(2)  El fluido ovárico o seminal de los reproductores se recogerá en el momento de la maduración, con ocasión del «stripping» u ordeño.

(3)  Deberán recogerse muestras de un número de peces que garantice la detección del VSHV o del VNHI con una confianza del 95 % si la prevalencia prevista es del 5 %.

(4)  Las muestras se recogerán como muy pronto tres semanas después del traslado de los peces de agua dulce a agua salada.

(5)  El fluido ovárico o seminal de los reproductores se recogerá en el momento de la maduración, con ocasión del «stripping» u ordeño.

(6)  Deberán recogerse muestras de un número de peces que garantice la detección del VSHV o del VNHI con una confianza del 95 % si la prevalencia prevista es del 10 %.

(7)  Las muestras se recogerán como muy pronto tres semanas después del traslado de los peces de agua dulce a agua salada.

(8)  Deberán recogerse muestras de un número de peces que garantice la detección del VSHV o del VNHI con una confianza del 95 % si la prevalencia prevista es del 10 %.

(9)  Se tomará como mínimo una muestra por cada inspección sanitaria.

(10)  Deberán recogerse muestras de un número de peces que garantice la detección del HVK con una confianza del 95 % si la prevalencia prevista es del 5 %.

(11)  Esto no se aplicará a las explotaciones que críen únicamente trucha arco iris (Oncorhynchus mykiss), trucha común (Salmo trutta) o ambas, y cuyo suministro de agua se base exclusivamente en fuentes de agua dulce donde no vive el salmón del Atlántico (Salmo salar).

(12)  Las muestras se recogerán, almacenarán y examinarán durante dos períodos anuales de ensayos de un mes (primavera y otoño), o cuando proceda atendiendo a consideraciones prácticas.

(13)  Número máximo de peces por muestra conjunta: 5.

(14)  Las muestras se recogerán y examinarán durante dos períodos anuales de ensayos de un mes (primavera y otoño), o cuando proceda atendiendo a consideraciones prácticas.

(15)  Esto no se aplicará a las explotaciones que críen únicamente trucha arco iris (Oncorhynchus mykiss), trucha común (Salmo trutta) o ambas, y cuyo suministro de agua se base exclusivamente en fuentes de agua dulce donde no vive el salmón del Atlántico (Salmo salar).


ANEXO II

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS

I.   Introducción

En el presente anexo se establecen los procedimientos detallados de los métodos de diagnóstico que deben utilizarse para los exámenes de laboratorio en el marco de los programas de erradicación y vigilancia del anexo I de la presente Decisión, y para confirmar o descartar la sospecha de las siguientes enfermedades no exóticas enumeradas en la parte II del anexo IV de la Directiva 2006/88/CE (en lo sucesivo, «las enfermedades de la lista»), de conformidad con el artículo 57, letra b), de esa Directiva:

1.

Septicemia hemorrágica viral (SHV)

Parte 1

2.

Necrosis hematopoyética infecciosa (NHI)

Parte 1

3.

Herpesvirosis de la carpa koi (HCK)

Parte 2

4.

Anemia infecciosa del salmón (AIS)

Parte 3

5.

Infección por Marteilia refringens

Parte 4

6.

Infección por Bonamia ostreae

Parte 5

7.

Enfermedad de las manchas blancas (EMB)

Parte 6

II.   Definiciones

A efectos del presente anexo, se entenderá por «medio de transporte» un medio de cultivo celular con un 10 % de suero de ternera y con 200 UI de penicilina, 200 μg de estreptomicina y 200 μg de kanamicina por mililitro, o con otros antibióticos de eficacia demostrada.

PARTE 1

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA NHI Y LA SHV

I.   Métodos de diagnóstico y procedimientos para la vigilancia de la SHV y la NHI

Cuando se tomen muestras y se efectúen exámenes de laboratorio para obtener o mantener la calificación sanitaria de libre de NHI o SHV con arreglo a la parte 1, sección I, del anexo I utilizando los métodos de diagnóstico que se establecen en los puntos II.1 y II.2 de la parte 1 de dicho anexo se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los siguientes puntos I.1 a I.6.

I.1.   Preparación y envío de las muestras de peces

I.1.1.   Tejidos para el examen virológico en cultivo celular

Antes de su embarque o traslado al laboratorio, los trozos de los órganos que vayan a examinarse se retirarán del pez con instrumental de disección estéril y se introducirán en tubos de plástico estériles que contengan medio de transporte.

La cantidad de material de peces idónea para el examen virológico en cultivo celular y mediante RT-qPCR depende del tamaño de los peces. Así, los materiales muestreados serán alevines enteros cuando la longitud del pez sea inferior a 4 cm; vísceras, incluido el riñón, cuando el pez mida entre 4 y 6 cm o, en el caso de peces de mayor tamaño, riñón, bazo, corazón o encéfalo, así como fluido ovárico de reproductores en el momento del desove.

El fluido ovárico o seminal o los trozos de órganos de un máximo de 10 peces podrán ser recogidos en un solo tubo estéril que contenga al menos 4 ml de medio de transporte y constituirán una muestra conjunta. Los tejidos de cada muestra pesarán como mínimo 0,5 g.

El examen virológico en cultivo celular se iniciará cuanto antes y, a más tardar, 48 horas después de la recogida de las muestras. En casos excepcionales, el examen virológico puede empezar a más tardar 72 horas después de la recogida, siempre que el material que vaya a examinarse esté protegido por medio de transporte y que puedan respetarse los requisitos de temperatura durante el transporte.

I.1.2.   Muestras para el análisis por retrotranscripción asociada a reacción en cadena de la polimerasa (RT-PCR o RT-qPCR)

Las muestras de peces se tomarán con arreglo al procedimiento descrito en el punto I.1.1 utilizando un instrumento estéril y se introducirán en un tubo de plástico estéril que contenga medio de transporte. Los tejidos de diez peces podrán recogerse en un solo tubo y representarán una muestra conjunta. No obstante, en caso de que la cantidad de inóculo sea pequeña, solo podrán utilizarse tejidos de hasta cinco peces. Alternativamente, las muestras podrán mezclarse en reactivos de estabilización del ARN, a razón de 0,2 g de tejido/ml de reactivo, con arreglo a las recomendaciones de los fabricantes, si bien cada pez será tratado por separado y no se mezclará en las muestras, debido a la pequeña cantidad de material que se utilizará para la extracción.

También podrán enviarse al laboratorio peces enteros.

I.2.   Envío de muestras de peces

Los tubos que contengan tejidos de los peces en medio de transporte destinados al cultivo celular o los análisis de RT-PCR/RT-qPCR se colocarán en recipientes aislados, como cajas de poliestireno de pared gruesa, junto con suficiente hielo u otro medio con efecto refrigerante similar para garantizar que las muestras se mantengan refrigeradas durante el transporte al laboratorio. No obstante, se evitará la congelación de las muestras. La temperatura de una muestra durante el transporte no superará nunca los 10 °C y quedará hielo en la caja de transporte en el momento de la recepción, o bien uno o varios bloques de hielo seguirán parcial o completamente congelados.

Podrán enviarse peces enteros al laboratorio si durante el transporte pueden respetarse los requisitos de temperatura del párrafo primero. Los peces enteros se envolverán en papel con capacidad absorbente y se enviarán en una bolsa de plástico. También podrán enviarse peces vivos.

I.3.   Recogida de material de diagnóstico suplementario

Cuando lo apruebe el laboratorio de diagnóstico, otros tejidos de peces podrán ser recogidos y preparados para exámenes suplementarios.

I.4.   Preparación de las muestras para examen en cultivo celular y RT-qPCR

I.4.1.   Congelación en casos excepcionales

En caso de que surjan dificultades prácticas que imposibiliten el procesamiento de muestras dentro de las 48 horas siguientes a la recogida de los tejidos de peces, puede ser aceptable que se congelen las muestras de tejido en medio de transporte a una temperatura igual o inferior a – 20 °C y se realice el examen virológico en un plazo de 14 días. No obstante, los tejidos de peces solo se congelarán y descongelarán una vez antes de proceder a su examen. Se mantendrán registros detallando los motivos de cada congelación de muestras de tejidos de peces.

I.4.2.   Homogeneización de órganos

En el laboratorio, los tejidos de peces de los tubos serán completamente homogeneizados en una licuadora, una mezcladora o un mortero con arena estéril y, posteriormente, suspendidos en el medio de transporte original.

Si una muestra consta de un pez entero de menos de 4 cm de longitud, se desmenuzará con unas tijeras o un escalpelo estériles tras eliminar la parte del cuerpo posterior a la cloaca. Si una muestra consta de un pez entero de una longitud comprendida entre 4 y 6 cm, se recogerán las vísceras, sin descartar los riñones. Si una muestra consta de un pez entero de más de 6 cm de longitud, las muestras de tejidos se obtendrán como se describe en el punto I.1. Las muestras de tejidos se desmenuzarán con unas tijeras o un escalpelo estériles, se homogeneizarán como se describe en el párrafo primero del presente punto y se suspenderán en medio de transporte.

La proporción final entre tejido y medio de transporte se ajustará en el laboratorio a 1:10.

I.4.3.   Centrifugación del homogeneizado

El homogeneizado se centrifugará en una centrifugadora refrigerada a una temperatura comprendida entre 2 y 5 °C a entre 2 000 y 4 000 × g durante 15 minutos; el sobrenadante se recogerá y podrá tratarse con antibióticos durante 4 horas a 15 °C o durante una noche a entre 4 y 8 °C. Si la muestra ha sido enviada en medio de transporte, podrá omitirse el tratamiento del sobrenadante con antibióticos.

En caso de que surjan dificultades prácticas, como la rotura de la incubadora o problemas con los cultivos celulares, que impidan inocular las células en las 48 horas siguientes a la recogida de las muestras de tejido de peces, el sobrenadante podrá congelarse a – 80 °C y el examen virológico podrá efectuarse en un plazo de 14 días.

Si el sobrenadante recogido se almacena a – 80 °C en las 48 horas siguientes al muestreo, podrá reutilizarse solo una vez para el examen virológico.

Antes de la inoculación de las células, el sobrenadante se mezclará con partes iguales de una mezcla adecuadamente diluida de antisueros contra los serotipos locales del virus de la necrosis pancreática infecciosa (VNPI), y se incubará durante como mínimo una hora a 15 °C o como máximo 18 horas a 4 °C. El título del antisuero será de al menos 1/2 000 en una prueba de neutralización en placa al 50 %.

El tratamiento de todos los inóculos con antisuero contra el VNPI tiene por objeto evitar que se desarrolle efecto citopático (ECP) debido al VNPI en cultivos celulares inoculados. Esto reducirá la duración de los exámenes virológicos, así como el número de casos en los que el ECP tendría que considerarse potencialmente indicativo del VSHV o del VNHI.

Cuando las muestras procedan de unidades de producción que se consideran libres de NPI, podrá omitirse el tratamiento de los inóculos con antisuero contra el VNPI.

I.4.4.   Preparación de las muestras para los programas de vigilancia basados en RT-PCR y RT-qPCR

Si las muestras han sido recogidas en medio de transporte, se efectuará el procedimiento establecido en los puntos I.4.2 y I.4.3. Después del centrifugado, se recogerá el sobrenadante y se extraerá el ARN. Si no ha de realizarse un nuevo examen directamente después del centrifugado, las muestras se congelarán inmediatamente a una temperatura igual o inferior a – 20 °C.

Para el análisis de los tejidos de peces conservados en reactivo de estabilización del ARN, las tareas posteriores se efectuarán dentro de los siguientes plazos respecto a las muestras almacenadas a distintas temperaturas:

 

muestras almacenadas a 37 °C: un día;

 

muestras almacenadas a 25 °C: una semana;

 

muestras almacenadas a 4 °C: un mes;

 

muestras almacenadas a – 20 °C: indefinidamente.

Las muestras conjuntas en reactivo de estabilización del ARN se tratarán como muestras individuales en reactivo de estabilización del ARN. En lo que respecta a las muestras conjuntas en reactivo de estabilización del ARN, la cantidad de muestra no excederá de lo recomendado por el fabricante para la extracción con kits de ARN, como RNeasy Mini kits (Qiagen) o similares. Si se hacen muestras conjuntas más grandes, los kits o métodos de extracción reflejarán este agrupamiento.

Las muestras recogidas en reactivos de estabilización del ARN no se utilizarán para el cultivo celular.

I.4.5.   Obtención de muestras conjuntas para RT-qPCR

Dado que los protocolos de RT-qPCR dados son de sensibilidad igual o mayor que los métodos de cultivo celular, podrá utilizarse sobrenadante obtenido de material de tejidos de peces homogeneizado de órganos mezclados procedentes de hasta 10 peces en medio de cultivo celular para la PCR. Sin embargo, debido a la cantidad mucho menor de inóculo utilizada para la PCR en comparación con el cultivo celular, todos los tejidos de los peces se homogeneizarán cuidadosamente antes de obtener material para la extracción.

El mismo principio se aplicará también si las muestras se recogen en reactivos de estabilización del ARN. No obstante, en este caso, suele ser difícil obtener material representativo de un máximo de 10 peces en un tubo y, por tanto, el número de peces por muestra conjunta se reducirá a entre 2 y 5.

I.5.   Examen virológico en cultivo celular

I.5.1.   Cultivos celulares y medios

Se cultivarán línea celular 2 de alevín de Lepomis macrochirus (BF-2) o línea celular 2 de gónadas de trucha arco iris (RTG-2) y células de Epithelioma papulosum cyprini (EPC) o de Pimephales promelas (FHM) a entre 20 y 30 °C en medio adecuado, a saber, medio esencial mínimo de Eagle (MEM) o variantes de este, con un suplemento del 10 % de suero bovino fetal y antibióticos en concentraciones habituales.

Cuando las células se cultivan en frascos cerrados, el medio se amortiguará con bicarbonato. El medio utilizado para el cultivo de células en unidades abiertas podrá amortiguarse con tris(hidroximetil)aminometano-HCl (Tris-HCl) (23 mM) y bicarbonato sódico (6 mM). El pH será de 7,6 ± 0,2.

Los cultivos celulares que se utilicen para la inoculación con material de tejidos de peces serán cultivos monocapa jóvenes, normalmente de un día de edad, en la medida de lo posible; no obstante, podrá admitirse una franja de entre 4 y 48 horas de edad. Las células estarán en crecimiento activo en el momento de la inoculación.

I.5.2.   Inoculación de los cultivos celulares

La suspensión de órganos tratada con antibióticos se inoculará en cultivos celulares en dos diluciones, a saber, la dilución primaria y, además, una dilución a 1:10, que darán lugar a diluciones finales de material tisular en el medio de cultivo celular de 1:100 y 1:1 000, respectivamente, a fin de evitar interferencias homólogas. Se inocularán al menos dos líneas celulares tal como se indica en el punto I.5.1. La relación entre la cantidad de inóculo y el volumen de medio de cultivo celular será aproximadamente 1:10.

Para cada dilución y cada línea celular se utilizará al menos un área celular de unos 2 cm2, lo que corresponde a un pocillo en una placa de cultivo celular de 24 pocillos. Se utilizarán placas de cultivo celular en la medida de lo posible.

I.5.3.   Incubación de cultivos celulares

Los cultivos celulares inoculados se incubarán a 15 °C durante 7 a 10 días. Si el color del medio de cultivo celular pasa de rojo a amarillo, lo que indica una acidificación del medio, se ajustará el pH con una solución estéril de bicarbonato o sustancias equivalentes para garantizar la sensibilidad de las células a la infección por el virus.

Al menos cada seis meses, o si se sospecha que la sensibilidad de las células ha descendido, se efectuará la valoración de material congelado de VSHV y VNHI para comprobar la sensibilidad de los cultivos celulares a la infección. Se utilizará, en la medida de lo posible, el procedimiento establecido en la sección III.

I.5.4.   Microscopía

Los cultivos celulares inoculados se observarán periódicamente (al menos tres veces por semana) a 40-150 aumentos para comprobar si se ha producido ECP. Si hay signos evidentes de ECP, se iniciarán inmediatamente los procedimientos de identificación del virus de conformidad con el punto I.6.

I.5.5.   Subcultivo

Si no aparece ECP tras la incubación primaria de entre 7 y 10 días, se efectuará el subcultivo con cultivos celulares nuevos utilizando un área celular similar a la del cultivo primario.

Se reunirán alícuotas del medio (sobrenadante) de todos los cultivos o pocillos que constituyen el cultivo primario, por líneas celulares, 7 a 10 días después de la inoculación. A continuación, dichas mezclas se inocularán en cultivos celulares homólogos no diluidos y diluidos a 1:10 (obteniendo diluciones finales de 1:10 y 1:100, respectivamente, del sobrenadante) según se describe en el punto I.5.2. Como alternativa, se inocularán alícuotas de un 10 % del medio que constituye el cultivo primario directamente en un pocillo con cultivo celular nuevo (subcultivo de pocillo a pocillo). La inoculación puede ir precedida de una preincubación de las diluciones con el antisuero contra el VNPI a una dilución adecuada, como se describe en el punto I.4.3.

A continuación, los cultivos inoculados se incubarán durante 7 a 10 días a 15 °C y se inspeccionarán de conformidad con el punto I.5.4.

Si se produce un ECP tóxico en los primeros tres días tras la incubación, puede realizarse un subcultivo en esa fase, pero después hay que incubar las células 7 días y realizar otro subcultivo con 7 días más de incubación. Si se desarrolla un ECP tóxico pasados tres días, las células se pasarán una vez y se incubarán para lograr el total de 14 días desde la inoculación primaria. En los últimos siete días de incubación no habrá pruebas de toxicidad.

Si a pesar del tratamiento con antibióticos se produce contaminación bacteriana, el subcultivo irá precedido de centrifugación a 2 000 a 4 000 × g durante 15 a 30 minutos a entre 2 y 5 °C, o filtración del sobrenadante por un filtro de 0,45 μm (membrana con baja fijación a las proteínas). Además, el subcultivo seguirá los mismos procedimientos descritos para el ECP tóxico en el párrafo cuarto del presente punto.

Si no se produce ECP, el ensayo podrá declararse negativo.

I.6.   Identificación del virus

Si se observa ECP en un cultivo celular, se recogerá medio (sobrenadante) y se analizará mediante una o varias de las siguientes técnicas: ensayo de inmunoadsorción enzimática (ELISA), inmunofluorescencia (IF), neutralización, RT-PCR o RT-qPCR. Si estas pruebas no han permitido una identificación definitiva del virus en el plazo de una semana, el sobrenadante se enviará al laboratorio nacional de referencia o al laboratorio de referencia de la UE para las enfermedades de los peces a que se refiere el anexo VI de la Directiva 2006/88/CE para su identificación inmediata.

I.6.1.   ELISA

Se efectuará una ELISA tipo sándwich con objeto de identificar la cepa vírica. Las placas de micropocillos se recubrirán con 50 μl/pocillo (0,9 pg) de inmunoglobulinas (Ig) de antisueros de conejo contra VNHI o VSHV de calidad demostrada, purificadas con proteína A, diluidas en solución amortiguadora de carbonato (pH 9,6) con 15 mM de azida de sodio, y se incubarán de 18 horas a 2 semanas a 4 °C.

En una placa de dilución, cada muestra que contenga 1 % de Tritón X-100 y los testigos positivos se diluirá con solución amortiguadora [solución salina fosfatada (PBS)-T-BSA, 1 % BSA] en cuatro grados de dilución: sin diluir, 1:4, 1:16 y 1:64. Las placas ELISA se lavarán en PBS que contenga un 0,05 % de Tween-20 (PBS-T) y 50 μl de cada dilución se transferirán de la placa de dilución a la placa ELISA lavada y recubierta.

A continuación, las placas ELISA se incubarán durante 30 minutos a 37 °C. Luego se lavarán y se incubarán durante 30 minutos a 37 °C con anticuerpos monoclonales específicos (AcM IP5B11 para la identificación del VSHV y Hyb 136-3, para la del VNHI). Se transferirán a la placa ELISA 50μl de anticuerpos antimurinos de conejo conjugados con peroxidasa de rábano, diluidos a 1:1 000 en PBS-T-BSA.

Por último, después de un nuevo lavado, se desencadenarán las reacciones añadiendo 50 μl/pocillo de ortofenilendiamina (OPD). Las placas ELISA se incubarán durante 20 minutos a temperatura ambiente en la oscuridad, y la reacción se detendrá añadiendo 100 μl/pocillo de H2SO4 0,5 M.

Se controlará la absorbancia a una longitud de onda de 492 y 620 nm en un lector ELISA. Las muestras se designarán positivas o negativas tras comparar los resultados de los ensayos con los valores de absorbancia de los testigos positivos y negativos. En general, las muestras con una absorbancia combinada (A) < 0,5 con material no diluido se considerarán negativas, las muestras con valores de A entre 0,5 y 1,0 se considerarán sospechosas y aquellas con A > 1,0 se considerarán positivas.

Podrán utilizarse otras versiones de ELISA con eficacia similar demostrada en lugar de las contempladas en este punto.

I.6.2.   Inmunofluorescencia (IF)

La identificación de los patógenos VSHV y VNHI se efectuará infectando células en placas «Black» de 96 pocillos, placas convencionales de 24 pocillos o cubreobjetos en placas de 24 pocillos. Cuando se identifique el VNHI, el VSHV o ambos infectando células en cubreobjetos, se aplicará el siguiente protocolo:

a)

los cubreobjetos se sembrarán con células a una densidad que lleve a una confluencia de entre 60 % y 90 % después de 24 horas de cultivo. Para esto se utilizarán células de EPC, en la medida de lo posible, debido a su fuerte adherencia a las superficies de vidrio, aunque también pueden usarse otras líneas celulares, como BF-2, RTG-2 o FHM. Se inocularán 150 μl de sobrenadante del cultivo celular en dos diluciones diferentes (1:10 y 1:1 000) por duplicado en monocapas de un día, y se incubará a 15 °C durante 24 horas.

b)

Posteriormente, el medio de cultivo celular se retirará y las monocapas de células infectadas se fijarán con 0,5 ml de solución acuosa de acetona helada (80 % v/v). La fijación se efectuará en campana extractora durante 15 minutos a temperatura ambiente; a continuación se retirará la solución de acetona y se dejarán secar al aire los cubreobjetos durante al menos 30 minutos. En esta fase, las placas se procesarán inmediatamente o se almacenarán a – 20 °C para su uso ulterior.

c)

Los anticuerpos monoclonales específicos (AcM IP5B11 para la identificación del VSHV y Hyb 136-3, para la del VNHI) se diluirán en de PBS-T 0,01 M (pH 7,2) en la dilución recomendada por el proveedor de los anticuerpos monoclonales. Se añadirán de 50 a 100 μl/pocillo a las monocapas fijadas, y las placas se incubarán durante una hora a 37 °C en una cámara húmeda.

d)

Los cubreobjetos se lavarán suavemente tres veces con una PBS que contenga un 0,05 % de Tween-20 (PBS-T), y la solución amortiguadora se eliminará completamente después del último enjuague. A continuación, las células se incubarán durante una hora a 37 °C con anticuerpos contra las inmunoglobulinas de ratón conjugados con isotiocianato de fluoresceína (FITC) o isotiocianato de tetrametilrodamina-5-(y 6) (TRITC), utilizados como anticuerpo primario, diluidos de acuerdo con las instrucciones del proveedor, se lavarán de nuevo con PBS-T y se secarán. Los cultivos teñidos se montarán en portaobjetos utilizando solución salina de glicerol y se examinarán con luz ultravioleta (UV) incidente, utilizando oculares de 10 o 12 aumentos y un objetivo de 25 o 40 aumentos con aperturas numéricas > 0,7 y > 1,3, respectivamente.

Podrán utilizarse, en su lugar, otras técnicas de IF con eficacia similar demostrada por lo que se refiere a los cultivos celulares, la fijación y los anticuerpos de calidad de referencia.

I.6.3.   Neutralización

Las células se retirarán del sobrenadante mediante centrifugado (2 000 a 4 000 × g) o filtración por membrana (0,45 μm) de baja fijación con proteínas, y el sobrenadante se diluirá a 1:100 y 1:10 000 en medio de cultivo celular.

Se mezclarán alícuotas de un mínimo de dos diluciones de sobrenadante y se incubarán durante 60 minutos a 15 °C con partes iguales de los reactivos siguientes, por separado:

a)

suero que contenga un anticuerpo específico del grupo contra el VSHV a una dilución de 1:50 (v/v);

b)

suero que contenga un anticuerpo específico del grupo contra el VNHI a una dilución de 1:50 (v/v);

c)

grupo de antisueros contra los serotipos locales del VNPI a una dilución de 1:50 (v/v);

d)

únicamente medio (testigo positivo).

De cada mezcla de sobrenadante y suero de cada virus, al menos dos cultivos celulares se inocularán con 50 μl cada uno y, a continuación, se incubarán a 15 °C. Se observará si se produce ECP según lo descrito en el punto I.5.4.

Las cepas y aislados de VSHV que no reaccionen en pruebas de neutralización se identificarán mediante IF o ELISA.

Podrán utilizarse, en su lugar, otras pruebas de neutralización con eficacia similar demostrada.

I.6.4.   RT-PCR/RT-qPCR

I.6.4.1.   Preparación de ARN vírico

Todos los trabajos con ARN se realizarán en hielo, utilizando guantes.

El ARN se extraerá utilizando el método del fenol-cloroformo o por columnas de afinidad, de acuerdo con las instrucciones del fabricante. Pueden utilizarse los kits de extracción del ARN disponibles en el comercio, que permiten obtener ARN de alta calidad adecuado para su uso con los protocolos de RT-PCR detallados en los puntos siguientes.

El ARN se volverá a suspender en agua destilada libre de ribonucleasa (es decir, agua tratada con pirocarbonato de dietilo al 0,1 %) o un amortiguador de elución apropiado.

I.6.4.2.   RT-PCR

Se utilizarán los siguientes cebadores para la detección del VNHI:

 

cebador directo 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′;

 

cebador inverso 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.

Se efectuarán los siguientes ciclos (RT-PCR de un paso): 1 ciclo a 50 °C durante 30 minutos; 1 ciclo a 95 °C durante 2 minutos; 30 ciclos a 95 °C durante 30 segundos, 50 °C durante 30 segundos, 72 °C durante 60 segundos; 1 ciclo a 72 °C durante 7 minutos e inmersión a 4 °C.

Se utilizarán los siguientes cebadores para la detección del VSHV:

 

VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′;

 

VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.

Se efectuarán los siguientes ciclos (RT-PCR de un paso): 50 °C durante 30 minutos, 95 °C durante 15 minutos, 35 ciclos a 94 °C durante 30 segundos, 55 °C durante 30 segundos, y 68 °C durante 60 segundos. A continuación, la reacción se mantendrá a 68 °C durante 7 minutos.

La cantidad y la especificidad de las reacciones RT-PCR se evaluarán mediante electroforesis en gel de agarosa al 1,5 % con bromuro de etidio, y se observarán por transiluminación UV. Un amplicón de PCR de 693 bp podrá observarse con respecto al VNHI. En el caso del VSHV, el tamaño será de 505 bp.

Los resultados de la PCR pueden variar en función de las condiciones en las que se efectúe, es decir, puede que sea necesario optimizar los protocolos térmicos, dependiendo del termociclador que se use. Por otra parte, pueden darse falsos positivos, debidos a un error de hibridación del cebador o una contaminación en el laboratorio. Por tanto, se incluirán testigos positivos y negativos adecuados y amplicones de secuencia positiva y negativa, para evitar cualquier duda. En lo que respecta a los cebadores del VSHV, se prestará especial atención al utilizar células de BF-2, ya que dichos cebadores puedan reaccionar con la línea celular de ADN/ARN produciendo falsos positivos de tamaño similar. Al realizar pruebas con sobrenadante de células de BF-2, todos los fragmentos amplificados por PCR serán secuenciados.

I.6.4.3.   RT-qPCR para el VSHV

En relación con el VSHV, la amplificación se efectuará utilizando los siguientes cebadores y sonda:

 

cebador directo: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′;

 

cebador inverso: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′;

 

sonda: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

RT-qPCR de un paso:

En cada serie de placas se incluirán testigos negativos y positivos. Sucesión de ciclos: 50 °C durante 30 minutos, 95 °C durante 15 minutos, 40 ciclos a 94 °C durante 15 segundos, 60 °C durante 40 segundos, 72 °C durante 20 segundos; ajustar en caso necesario. Podrán utilizarse, en su lugar, otras versiones de RT-PCR o RT-qPCR con eficacia similar demostrada.

I.6.4.4.   RT-qPCR para el VNHI

En relación con el VNHI, la amplificación se efectuará utilizando los siguientes cebadores y sonda:

 

cebador directo: 5′- AGA-GCC-AAG-GCA-CTG-TGC-G-3′;

 

cebador inverso: 5′- TTCTTTGCGGCTTGGTTGA – 3′;

 

sonda: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.

RT-qPCR de dos pasos:

Dado que el siguiente ensayo depende de una amplificación en dos pasos, se pondrá especial cuidado al manipular los tubos de una reacción a otra, con el fin de evitar la contaminación.

Sucesión de ciclos (después del paso RT): 50 °C durante 2 minutos, 95 °C durante 10 minutos, seguidos de 40 ciclos a 95 °C durante 15 segundos, y 60 °C durante 1 segundos; se efectuarán ajustes en caso necesario.

Podrán utilizarse, en su lugar, otras versiones de RT-PCR o RT-qPCR con eficacia similar demostrada.

II.   Métodos y procedimientos de diagnóstico detallados para confirmar o descartar la sospecha de SHV, NHI o ambas en brotes sospechosos

Cuando se precise un examen de laboratorio para confirmar o descartar la NHI, la SHV o ambas de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE utilizando los métodos de diagnóstico que se establecen en la parte 1, punto II.3, del anexo I de la presente Decisión, se aplicarán los siguientes métodos y procedimientos de diagnóstico detallados:

a)

aislamiento convencional del virus seguido de seroneutralización e identificación inmunoquímica o molecular del virus;

b)

detección del virus por RT-PCR o RT-qPCR;

c)

otras técnicas de diagnóstico como IFAT, ELISA, RT-PCR, IHC.

II.1.   Aislamiento convencional del virus con posterior identificación del virus

II.1.1.   Selección de las muestras

Se seleccionarán para las pruebas al menos diez peces que presenten signos típicos de NHI o SHV.

II.1.2.   Preparación y envío de las muestras de peces

La preparación y el envío a efectos del aislamiento convencional del virus seguirán los métodos y procedimientos establecidos en el punto I.2.

II.1.3.   Recogida de material de diagnóstico suplementario

La recogida de material suplementario a efectos del aislamiento convencional del virus seguirá los métodos y procedimientos establecidos en el punto I.3.

II.1.4.   Preparación de muestras para el examen en cultivo celular

La preparación de las muestras para el examen en cultivo celular a efectos del aislamiento convencional del virus seguirá los métodos y procedimientos establecidos en el punto I.4.

II.1.5.   Examen virológico en cultivo celular

El examen virológico a efectos del aislamiento convencional del virus seguirá los métodos y procedimientos establecidos en el punto I.5.

II.1.6.   Identificación del virus

La identificación del virus a efectos del aislamiento convencional del virus seguirá los métodos y procedimientos establecidos en el punto I.6.

II.2.   Detección del virus por RT-qPCR

II.2.1.   Selección de las muestras

La selección de las muestras a efectos de la detección del virus mediante RT-qPCR seguirá los métodos y procedimientos establecidos en el punto I.1.2.

II.2.2.   Preparación y envío de las muestras de peces

La preparación y el envío a efectos de la detección del virus mediante RT-qPCR seguirán los métodos y procedimientos establecidos en el punto I.2.

II.2.3.   Recogida de material de diagnóstico suplementario

La recogida de material de diagnóstico suplementario a efectos de la detección del virus mediante RT-qPCR seguirá los métodos y procedimientos establecidos en el punto I.3.

II.2.4.   Preparación de las muestras para RT-qPCR

La preparación de las muestras a efectos de la detección del virus mediante RT-qPCR seguirá los métodos y procedimientos establecidos en el punto I.6.4.1.

II.2.5.   RT-qPCR

La detección de virus por RT-qPCR seguirá los métodos y procedimientos establecidos en los puntos I.6.4.1, I.6.4.3 y I.6.4.4.

II.3.   Otras técnicas de diagnóstico

El sobrenadante preparado como se describe en el punto I.4.3 podrá someterse a una ELISA, una prueba de inmunofluorescencia indirecta (IFAT) o una RT-PCR, de conformidad con los puntos I.6.1, I.6.2 o I.6.4, respectivamente. El material tisular podrá someterse a otras técnicas de diagnóstico, como IFAT en cortes congelados o pruebas inmunohistoquímicas con material tisular fijado en formol. Estas técnicas rápidas se completarán con un examen virológico con arreglo al punto II, letras a) o b), en el plazo de 48 horas después del muestreo, si:

a)

se obtiene un resultado negativo; o bien

b)

se obtiene un resultado positivo con un material que represente el primer caso de NHI o SHV.

III.   Procedimiento de valoración para verificar la sensibilidad de los cultivos celulares a la infección

Cuando se realice una valoración para verificar la sensibilidad de los cultivos celulares a la infección como se indica en el punto I.5.3, se seguirán los procedimientos establecidos en los siguientes apartados del presente punto.

Se utilizarán al menos dos cepas aisladas del VSHV y una del VNHI. Las cepas representarán el mayor grupo de virus dentro de la Unión Europea, es decir, para el VSHV, una cepa patógena procedente de trucha arco iris en agua dulce y una cepa patógena marina de rodaballo y, para el VNHI, una cepa patógena de trucha arco iris de la Unión Europea. Se utilizarán cepas aisladas bien definidas procedentes de los Estados miembros. Los lotes de virus de un número bajo de pasadas en cultivo celular se propagarán en tubos de cultivo celular con células BF-2 o RTG-2, en el caso del VSHV, y con células de EPC o FHM, en el del VNHI. Se utilizará medio de cultivo celular con al menos un 10 % de suero. En la inoculación se utilizará una MOI baja (< 1).

En el momento del ECP total, se recogerá el virus mediante centrifugado del sobrenadante del cultivo celular a 2 000 × g durante 15 minutos, se esterilizará pasándolo por un filtro de membrana de 0,45 μm y se distribuirá en criotubos etiquetados. El virus se mantendrá a – 80 °C.

Una semana después de la congelación, se descongelarán en agua fría tres frascos replicados con cada virus, y se valorarán frente a sus líneas celulares respectivas. Cada cepa de virus será descongelada y valorada al menos cada seis meses, o cuando se sospeche que la sensibilidad de una línea celular ha disminuido.

Los procedimientos de valoración se describirán detalladamente y se seguirá el mismo procedimiento cada vez.

La valoración por dilución hasta el límite incluirá al menos seis réplicas en cada fase de dilución. Los valores se compararán con valores obtenidos con anterioridad. Si la valoración de alguna de las tres cepas víricas decrece en un factor igual o superior a 2 unidades logarítmicas en comparación con la valoración inicial, la línea celular ya no podrá ser utilizada con fines de vigilancia.

Si se guardan en el laboratorio distintas líneas celulares, cada línea se examinará por separado.

Se mantendrán registros durante al menos 10 años.

PARTE 2

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA HERPESVIROSIS DE LA CARPA KOI (HCK)

I.   Métodos y procedimientos de diagnóstico para confirmar o descartar la sospecha de HCK

Cuando se precise un examen de laboratorio para confirmar o descartar la sospecha de HCK de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE, utilizando los métodos de diagnóstico que se establecen en la parte 2, sección III, del anexo I, se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los puntos I.1 y I.2 de la presente parte.

I.1.   Preparación de las muestras de peces

Con fines de diagnóstico, para los ensayos con métodos basados en la PCR convencional o la qPCR podrán utilizarse peces (que se enviarán vivos o muertos y embalados por separado en recipientes asépticos precintados) o, alternativamente, órganos o trozos de órganos congelados conservados en etanol del 80 % a absoluto o en medio de transporte vírico (que serán procesados en las 48 horas siguientes a su recogida).

Para la detección del HVK se recogerán muestras de branquias y riñón; en una muestra separada adicional podrán incluirse bazo, encéfalo e intestinos. En caso de infección aguda, podrá mezclarse material tisular de hasta cinco peces.

Además, en determinados casos podrán utilizarse muestras no letales, como sangre, frotis o biopsias de las branquias o muestras de mucosidad (por tanto, en caso de sospecha de la infección por el HVK pueden usarse ejemplares muy valiosos).

I.1.1.   Extracción del ADN

El ADN se extraerá con arreglo a procedimientos normalizados.

Pueden utilizarse los kits de extracción del ADN disponibles en el comercio, que permiten obtener ADN de alta calidad adecuado para su uso con los protocolos de PCR contemplados en el punto I.2.

I.2.   Detección e identificación del agente mediante métodos basados en la reacción en cadena de la polimerasa (PCR)

I.2.1.   qPCR para la detección del HVK

Para la detección del HVK se efectuará la siguiente prueba de qPCR:

 

Cebador directo (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;

 

Cebador inverso (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;

 

Sonda (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Sucesión de ciclos: un ciclo a 95 °C en 15 minutos, seguido de 40 ciclos a 94 °C en 15 segundos y 60 °C durante 60 segundos. En cada serie de placas se incluirán testigos negativos y positivos. No obstante, podrán utilizarse, en su lugar, otras versiones de qPCR con eficacia similar demostrada.

I.2.2.   PCR convencional para la detección del HVK

Se utilizará la prueba descrita en el presente punto, que tiene por objeto el gen de la timina cinasa (TK) del HVK. Sin embargo, en su lugar podrán emplearse otras pruebas de PCR con sensibilidad y especificidad similares a la de la prueba descrita.

 

Cebador directo (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′.

 

Cebador inverso (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.

Sucesión de ciclos: Un ciclo a 95 °C durante 5 minutos, seguido de 35 ciclos a 95 °C durante 30 segundos, 52 °C durante 30 segundos, 72 °C durante un minuto y un ciclo a 72 °C durante 10 minutos. El producto debe ser de 409 bp.

Los resultados de la PCR pueden variar en función de las condiciones en las que se efectúe, es decir, puede que sea necesario optimizar los protocolos térmicos, dependiendo del termociclador que se use. Por otra parte, pueden darse falsos positivos, debidos a un error de hibridación del cebador o una contaminación. En cada serie de placas se incluirán testigos negativos y positivos. No obstante, podrán utilizarse, en su lugar, otras versiones de PCR con eficacia similar demostrada.

La primera detección en una zona se confirmará mediante secuenciación o se enviará para su identificación inmediata a un laboratorio nacional de referencia o al laboratorio de referencia de la UE para las enfermedades de los peces indicado en el anexo VI de la Directiva 2006/88/CE.

II.   Métodos de diagnóstico y procedimientos detallados para la vigilancia de la HCK

Cuando se tomen muestras y se efectúen exámenes de laboratorio para obtener o mantener determinadas calificaciones sanitarias con respecto a la HCK con arreglo a la parte 2, sección I, del anexo I utilizando los métodos de diagnóstico que se establecen en la parte 2, secciones II o III, de dicho anexo se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los siguientes puntos II.1 y II.2 de la presente parte.

II.1.   Preparación de las muestras de peces

Si es posible, serán sometidos a muestreo los peces que se hayan mantenido durante un tiempo prolongado (de dos a tres semanas) en el intervalo de temperaturas que permite el desarrollo del virus, es decir, entre 15 y 26 °C. Si es posible, las muestras se recogerán una vez transcurridas 24 horas y a más tardar 72 horas después de prácticas de gestión que puedan reactivar el virus en peces vectores, como la captura en redes o el transporte, al fin de aumentar las posibilidades de detección del HVK.

Para la vigilancia de la HCK con métodos basados en la PCR podrán enviarse peces vivos o muertos y embalados por separado en recipientes asépticos precintados o, alternativamente, órganos o trozos de órganos congelados conservados en alcohol al 80-100 % o medio de transporte vírico (que serán procesados en las 48 horas siguientes a su recogida). Para la vigilancia de la HCK se recogerán muestras tisulares de branquias y riñón.

Para esta vigilancia se evitará mezclar muestras en la medida de lo posible. En caso de que sea necesario, podrá mezclarse material tisular de un máximo de dos peces. Las muestras más grandes se homogeneizarán en mortero o en licuadora, y se obtendrán submuestras para la extracción de ADN antes de la aclaración. Alternativamente, podrán obtenerse submuestras de cada tejido incluido en la muestra y colocarse en tubos de lisis.

II.1.1.   Extracción del ADN

El ADN se extraerá con arreglo a procedimientos normalizados. Pueden utilizarse los kits de extracción del ADN disponibles en el comercio, que permiten obtener ADN de alta calidad adecuado para su uso con los protocolos de RT-PCR contemplados en el punto II.2.

La proporción aceptable entre tejido y medio será de 1:9 p/v. En los ensayos se incluirán entre 20 y 25 mg de material tisular.

II.2.   Vigilancia de la HCK con métodos basados en la PCR

Para la vigilancia del HVK se utilizará la qPCR. Si aparecen muestras positivas en una zona sin resultados positivos confirmados previamente, los resultados de los ensayos se confirmarán mediante uno de los siguientes procedimientos:

a)

Secuenciación de un producto de PCR o de PCR con cebadores internos obtenido a partir de las muestras.

La secuencia de consenso clara obtenida debe coincidir (al menos en un 98 %) con las secuencias de referencia.

b)

Alternativamente, las muestras pueden enviarse a un laboratorio nacional de referencia para confirmación.

II.2.1.   qPCR para la detección del HVK

Se utilizará la siguiente qPCR:

 

Cebador directo (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;

 

Cebador inverso (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;

 

Sonda (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Sucesión de ciclos: un ciclo a 95 °C en 15 minutos, seguido de 50 ciclos a 94 °C en 15 segundos y 60 °C durante 60 segundos.

Los resultados de la qPCR pueden variar en función de las condiciones en las que se efectúe, es decir, puede que sea necesario optimizar los protocolos térmicos, dependiendo del termociclador que se use. Por otra parte, pueden darse falsos positivos, debidos a un error de hibridación del cebador o una contaminación en el laboratorio. En cada serie de placas se incluirán testigos negativos y positivos. No obstante, podrán utilizarse, en su lugar, otras versiones de la qPCR con eficacia similar demostrada.

II.2.2.   PCR convencional para la confirmación del HVK

Para confirmar una infección por el HVK se empleará el protocolo genérico de PCR con cebadores internos descrito en el cuadro 2.1, seguido de la secuenciación del producto amplificado.

Cuadro 2.1

Cebadores y condiciones de la PCR con cebadores internos para todos los herpesvirus de los ciprínidos (CyHV-1, CyHV-2 y CyHV-3)

Nombre del cebador

Secuencia

Sucesión de ciclos

Tamaño del producto

CyHVpol-directo

5′-CCAGCAACATGTGCGACGG-3′

Primera serie de PCR

1 ciclo:

95 °C durante 2 minutos

40 ciclos:

 

95 °C durante 30 segundos

 

55 °C durante 30 segundos

 

72 °C durante 45 segundos

1 ciclo:

72 °C durante 10 minutos

362 bp

CyHVpol-inverso

5′-CCGTARTGAGAGTTGGCGCA-3′

CyHVpol-directo interno

5′-CGACGGVGGYATCAGCCC-3′

Segunda serie de RCP

1 ciclo:

95 °C durante 2 minutos

40 ciclos:

 

95 °C durante 30 segundos

 

55 °C durante 30 segundos

 

72 °C durante 45 segundos

1 ciclo:

72 °C durante 10 minutos

339 bp

CyHVpol-inverso interno

5′-GAGTTGGCGCAYACYTTCATC-3′

Los resultados de la PCR pueden variar en función de las condiciones en las que se efectúe, es decir, puede que sea necesario optimizar los protocolos térmicos, dependiendo del termociclador que se use. Por otra parte, pueden darse falsos positivos, debidos a un error de hibridación del cebador o una contaminación en el laboratorio. En cada serie de placas se incluirán testigos negativos y positivos. Podrán utilizarse, en su lugar, versiones de PCR con eficacia similar demostrada.

La secuenciación podrá ser realizada por el laboratorio o en empresas externas especializadas. Los resultados de la secuenciación serán analizados comparando las secuencias con las secuencias de referencia conocidas del HVK (números de acceso a Gen Bank AP008984, DQ657948 y DQ177346). La secuencia de consenso clara obtenida debe coincidir al menos en un 98 % con dichas secuencias de referencia.

PARTE 3

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA ANEMIA INFECCIOSA DEL SALMÓN (AIS)

I.   Procedimientos de muestreo para la vigilancia y el control de la AIS

Cuando se tomen muestras y se efectúen exámenes de laboratorio a los efectos de los programas de vigilancia o erradicación establecidos en la parte 3 del anexo I o a fin de confirmar o descartar la AIS con arreglo al artículo 57, letra b), de la Directiva 2006/88/CE, se aplicarán los métodos y procedimientos detallados establecidos en los puntos I.1, I.2 y I.3 de la presente sección.

I.1.   Preparación de las muestras de peces

A efectos de los exámenes de laboratorio para detectar la AIS, se evitará mezclar muestras de peces en la medida de lo posible. Sin embargo, para la vigilancia de la AIS se aceptará la mezcla de entre dos y cinco peces.

Se tomarán muestras para pruebas de retrotranscripción asociada a PCR (RT-PCR) de todos los peces muestreados. Un trozo de riñón medio del pez se retirará utilizando un instrumento estéril y se introducirá en un tubo de microcentrifugado que contenga 1 ml de solución conservante del ARN de eficacia demostrada. Podrán recogerse tejidos de hasta cinco peces en un solo tubo de solución de transporte y representarán una muestra conjunta. El peso del tejido de una muestra será de 0,5 g. Cuando los peces sean demasiado pequeños para obtener una muestra del peso requerido, podrán tomarse trozos de riñón, corazón, bazo, hígado o ciegos pilóricos, en este orden de preferencia, para obtener 0,5 g.

Los tejidos para el estudio histológico solo se tomarán de peces recién sacrificados con una constitución normal, que presenten signos clínicos o post mortem compatibles con la AIS. Se tomarán con un escalpelo muestras de todas las lesiones externas o internas y, en todo caso, del riñón medio, el corazón, el hígado, el páncreas, el intestino, las branquias y el bazo, y se introducirán en una solución salina amortiguada con formol al 8-10 % (v/v). La proporción entre fijador y tejido será al menos de 20:1, para asegurar una conservación satisfactoria de los tejidos. Para la inmunohistoquímica (IHC) se tomarán muestras de riñón medio y corazón.

Se obtendrán tejidos para el examen virológico en cultivo celular de todos los peces muestreados. Se retirarán trozos de hígado, riñón anterior o medio, corazón y bazo utilizando un instrumento estéril y se introducirán en tubos de plástico que contengan 9 ml de medio de transporte. Podrán recogerse tejidos de hasta cinco peces en un solo tubo con solución de transporte y representarán una muestra conjunta. El peso del tejido de una muestra será de 1,0 ± 0,5 g.

I.2.   Envío de las muestras de peces

Podrán transportarse al laboratorio peces enteros si durante el transporte pueden cumplirse los requisitos de temperatura del apartado 3 del presente punto. Los peces enteros se envolverán en papel absorbente y se enviarán en una bolsa de plástico, refrigerados como se describe en dicho apartado.

También podrán enviarse peces vivos, pero únicamente bajo la supervisión del laboratorio nacional de referencia para las enfermedades de los peces y teniendo en cuenta los aspectos suplementarios de desinfección y bioseguridad aplicables cuando se transportan peces vivos.

Las muestras de sangre y los tubos que contengan tejidos de peces para examen virológico o pruebas de RT-PCR se colocarán en recipientes aislados, como cajas de poliestireno de pared gruesa, junto con suficiente hielo o bloques de congelación para garantizar que las muestras se mantengan refrigeradas durante el transporte al laboratorio. Se evitará la congelación, y quedará hielo en la caja de transporte en el momento de la recepción, o bien uno o varios de los bloques de congelación deben seguir parcial o completamente congelados. En circunstancias excepcionales, las muestras para RT-PCR y las muestras para examen virológico podrán ser congeladas y transportarse al laboratorio a – 20 °C o menor temperatura.

Para el análisis por RT-PCR de los tejidos conservados en reactivo de estabilización del ARN, la extracción del ARN se efectuará dentro de los siguientes plazos en función de la temperatura a la que se almacenen las muestras:

 

muestras almacenadas a 37 °C: un día;

 

muestras almacenadas a 25 °C: una semana;

 

muestras almacenadas a 4 °C: un mes;

 

muestras almacenadas a – 20 °C: indefinidamente.

Si se transportan tejidos de peces en fijador para el estudio histológico, serán enviados en tubos a prueba de fugas dentro de recipientes resistentes a los golpes. Se evitará la congelación de estas muestras.

El examen virológico en cultivo celular se iniciará cuanto antes y, a más tardar, 48 horas después de la recogida de las muestras. En casos excepcionales, el examen virológico puede empezar a más tardar 72 horas después de la recogida, siempre que el material que vaya a examinarse esté protegido por medio de transporte y que puedan respetarse los requisitos de temperatura durante el transporte.

I.3.   Recogida de material de diagnóstico suplementario

A reserva de la aprobación del laboratorio de diagnóstico, podrán extraerse y prepararse para un examen suplementario tejidos de peces distintos de los mencionados en el punto I.1.

II.   Métodos y procedimientos de diagnóstico detallados para la vigilancia y para confirmar o descartar la sospecha de AIS

Cuando se efectúe un examen de laboratorio con el fin de obtener o mantener un determinado estatus sanitario con respecto a la AIS con arreglo a la parte 3, sección I, del anexo I o para confirmar o descartar una sospecha de AIS de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE utilizando los métodos de diagnóstico establecidos en la parte 3, sección II, del anexo I, se aplicarán los métodos y procedimientos detallados establecidos en los siguientes puntos II.1 a II.5.

II.1.   Examen de muestras por RT-PCR

El método de diagnóstico que debe utilizarse para el cribado del VAIS será la RT-qPCR. Dado que los resultados de la RT-qPCR pueden variar en función de las condiciones en las que se efectúa, se incluirán testigos y amplicones positivos y negativos adecuados para evitar cualquier duda.

II.1.1.   Extracción del ARN total

Todos los trabajos con ARN se realizarán en hielo, utilizando guantes.

El ARN total se extraerá utilizando el método del fenol-cloroformo o columnas de afinidad, de acuerdo con las instrucciones del fabricante.

El ARN purificado se volverá a suspender en agua destilada libre de ribonucleasa (es decir, agua tratada con pirocarbonato de dietilo al 0,1 %).

La concentración y la pureza del ARN extraído se estimarán midiendo la densidad óptica a 260 nm y a 280 nm. Un enfoque alternativo podría ser incluir testigos internos dirigidos al genoma del virus, como se indica en el punto II.1.3.

II.1.2.   RT-PCR para la detección del VAIS

Para la amplificación del genoma del VAIS pueden utilizarse varios métodos de RT-PCR. Puede realizarse una prueba de RT-PCR en dos pasos en la que las reacciones RT y PCR se efectúen en dos tubos separados. Sin embargo, también podrá hacerse una reacción en un solo paso, con ambas reacciones en un tubo. Se empleará, siempre que sea posible, el método en un solo paso, ya que el ensayo con un solo tubo minimiza el riesgo de contaminación cruzada, pues no precisa de ningún traslado de contenido y se considera tan sensible como el método en dos pasos.

Se utilizarán los cebadores y el ensayo descritos en el presente punto, a saber, la pareja de cebadores ILA1 o ILA2, dirigidos al segmento 8 y que se han considerado adecuados para detectar el VAIS en brotes y en peces vectores. El cebador inverso ILA2 no se une a cepas procedentes de América del Norte y en estos casos se utilizará un par de cebadores alternativo.

 

Cebador directo (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′.

 

Cebador inverso (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.

Sucesión de ciclos: Un ciclo a 50 °C durante 30 minutos, un ciclo a 94 °C durante 15 minutos, 40 ciclos a 94 °C durante 30 segundos, 55 °C durante 30 segundos, 72 °C durante 60 segundos; un ciclo a 72 °C durante 5 minutos. Tamaño del producto: 155 bp.

Los resultados de la PCR pueden variar en función de las condiciones en las que se efectúe, es decir, puede que sea necesario optimizar los protocolos térmicos, dependiendo del termociclador que se use. Por otra parte, pueden darse falsos positivos, debidos a un error de hibridación del cebador o una contaminación en el laboratorio. En cada serie de placas se incluirán testigos negativos y positivos. No obstante, podrán utilizarse, en su lugar, otras versiones de RT-PCR con eficacia similar demostrada.

II.1.3.   RT-qPCR para la detección del VAIS

El uso de la RT-qPCR puede aumentar la especificidad y probablemente también la sensibilidad. El método puede hacerse más rápidamente, ya que la fase de electroforesis en gel no es necesaria, y reduce el riesgo de contaminación cruzada, pues es posible estimar la cantidad de ARN del genoma del virus dentro del tubo de muestra. Una desventaja del ensayo de RT-qPCR es que a menudo no es posible secuenciar productos amplificados. No obstante, en caso de duda sobre la especificidad del producto amplificado, se realizará otro ensayo específico para el VAIS a fin de verificar el resultado.

Se utilizará el ensayo descrito en el presente punto, dirigido al segmento 8. Este ensayo será válido para las cepas procedentes de la Unión Europea, de países de la Asociación Europea de Libre Comercio y de América del Norte. Se empleará, siempre que sea posible, el método en un solo paso, ya que el ensayo con un solo tubo minimiza el riesgo de contaminación cruzada.

 

Cebador directo: 5′- CTACACAGCAGGATGCAGATGT -3′.

 

Cebador inverso: 5′- CAGGATGCCGGAAGTCGAT -3′.

 

Sonda: 5′-FAM- CATCGTCGCTGCAGTTC — MGBNFQ-3′.

En cada serie de placas se incluirán testigos negativos y positivos. Sucesión de ciclos: Un ciclo a 50 °C durante 30 minutos, un ciclo a 95 °C durante 15 minutos, 40 ciclos a 94 °C durante 15 segundos, 60 °C durante 60 segundos. Se ajustará en caso necesario. Podrán utilizarse, en su lugar, otras versiones de RT-PCR o RT-qPCR con eficacia similar demostrada.

II.1.4.   Secuenciación de los productos de PCR amplificados

 

Cebador directo (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA -3′.

 

Cebador inverso (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA -3′.

En cada serie de placas se incluirán testigos negativos y positivos. Sucesión de ciclos (RT-PCR de dos pasos): un ciclo a 50 °C durante 30 minutos, un ciclo a 94 °C durante 15 minutos, 40 ciclos a 94 °C durante 30 segundos, 55 °C durante 30 segundos, 72 °C durante 60 segundos, un ciclo a 72 °C durante 5 minutos; se ajustará en caso necesario. Podrán utilizarse, en su lugar, otras versiones de RT-PCR o RT-qPCR con eficacia similar demostrada.

Como alternativa, podrá utilizarse el siguiente método para secuenciar la HPR en el segmento 6:

 

Cebador directo: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′.

 

Cebador inverso: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′.

 

Tamaño del producto: 304 nt si HPR0.

También podrán utilizarse ensayos RT-PCR con sensibilidades y especificidades similares a los ensayos descritos en el presente punto.

La pureza del producto de la RT-PCR amplificado se comprobará mediante electroforesis en gel antes de la secuenciación. Si aparece solo un fragmento puro, se purificará directamente a partir de la PCR. Si están presentes múltiples fragmentos amplificados, el fragmento de interés se purificará mediante electroforesis en gel. La purificación de los fragmentos amplificados a partir de soluciones o geles de agarosa se efectuará utilizando columnas de afinidad para fragmentos de PCR, de acuerdo con las instrucciones del fabricante.

La secuenciación se realizará utilizando cebadores de amplificación en empresas externas especializadas. Los resultados se analizarán mediante la herramienta de búsqueda BLAST u las secuencias se compararán a otras secuencias conocidas de la base de datos de nucleótidos del Centro Nacional de Información Biotécnica de los Estados Unidos (NCBI).

La secuenciación eliminará cualquier duda sobre la especificidad de un producto amplificado de RT-PCR.

II.2.   Aislamiento del VAIS en cultivos celulares

II.2.1.   Preparación de las muestras

Los tejidos podrán mantenerse a – 80 °C. Solo podrán congelarse y descongelarse una vez antes de su examen. Con fines de vigilancia y control, el examen se llevará a cabo con la mayor rapidez posible.

Cada muestra conjunta de tejidos en solución de transporte será completamente homogeneizada con un homogeneizador validado y se centrifugará a entre 2 000 y 4 000 × g durante 15 minutos a 0-6 °C; el sobrenadante se filtrará (0,45 μm) y se incubará en un volumen igual de una mezcla adecuadamente diluida de antisueros contra los serotipos locales del VNPI. El valor del antisuero será de al menos 1:2 000 en una prueba de neutralización en placa al 50 %. La mezcla se incubará durante una hora a 15 °C. Esto representará el inóculo.

El tratamiento de todos los inóculos con antisuero contra el VNPI (que en algunas partes de Europa se encuentra en un 50 % de las muestras de peces) tiene por objeto evitar que el VNPI produzca ECP en los cultivos celulares inoculados. Este tratamiento puede realizarse para reducir la duración de los exámenes virológicos, así como el número de casos en los que el ECP tendría que considerarse potencialmente indicativo del VAIS. Cuando las muestras procedan de unidades de producción que se consideran libres de NPI, podrá omitirse el tratamiento de los inóculos con antisuero contra el VNPI.

II.2.2.   Inoculación en cultivos celulares

Para el aislamiento primario del VAIS se utilizarán células de riñón de salmón del Atlántico (ASK). Podrán utilizarse otras líneas celulares de eficacia y sensibilidad demostradas para aislar el VAIS, teniendo en cuenta la variabilidad de las cepas y su capacidad de replicarse en distintas líneas celulares. Las células de ASK parecen soportar el aislamiento y el crecimiento de las cepas de virus conocidas hasta la fecha, en la medida en que se utilice un número poco elevado de pasadas. En las células de ASK puede aparecer un ECP más claro que en otras líneas celulares sensibles, como SHK-1 (riñón anterior de salmón-1).

Las células de ASK (65 pasadas o menos) se cultivarán en un medio L-15 que contenga 10 % de suero bovino fetal, 2 % (v/v) de L-glutamina 200 mM y 0,08 % (v/v) de 2-mercaptoetanol 50 mM, en placas con múltiples pocillos. Se inoculará la suspensión de órganos tratada con antisuero en cultivos celulares jóvenes en crecimiento activo hasta obtener una dilución final del material tisular en el medio de cultivo de 1:1 000. Para cada órgano, 40 μl de la suspensión de inóculo se añadirán a un pocillo que contenga 2 ml de medio de cultivo. Para minimizar el riesgo de contaminación cruzada, se utilizarán placas separadas de doce o veinticuatro pocillos para las muestras procedentes de distintos lugares de las explotaciones piscícolas.

Se dejará una placa sin inocular como testigo negativo. Otra placa se inoculará con una cepa de referencia del VAIS como testigo positivo, conforme al siguiente procedimiento. Se inoculará en el primer pocillo 100 μl de una preparación madre de VAIS (valor mínimo 107 dosis infecciosas del 50 % del cultivo tisular [DICT50 ml– 1]) y se mezclará. Un volumen de este material se trasladará del primer pocillo al segundo para hacer una dilución a 1:10 y se mezclará. Esto se repetirá en toda la placa para hacer seis diluciones a 1:10. La preparación madre de VAIS puede almacenarse a – 80 °C durante al menos dos años, pero una vez descongelada deberá utilizarse en un plazo de tres días. Se tomarán precauciones para evitar la contaminación cruzada de las placas de ensayo con material testigo positivo. Para impedir este riesgo, los testigos positivos se prepararán y manipularán por separado de las placas de ensayo. En lugar de incluir un testigo positivo en cada inoculación, puede optarse por hacer cada seis meses una prueba de sensibilidad de las células de ASK frente al VAIS.

Las muestras se incubarán a 15 ± 2 °C durante un máximo de 15 días. Para observar si se ha producido ECP, los cultivos celulares se examinarán al microscopio en dos ocasiones, entre 5 y 7 días y entre 12 y 14 días después de la inoculación. Si alguna muestra conjunta presenta ECP, se iniciarán inmediatamente los procedimientos de identificación del virus de conformidad con el punto II.2.4. Si no se observa ECP hasta el día 14, se efectuará una prueba de inmunofluorescencia indirecta (IFAT), una hemadsorción o una prueba de RT-PCR.

II.2.3.   Subcultivo

El subcultivo se llevará a cabo entre los días 13 y 15. Se añadirá sobrenadante de cultivo en los pocillos que contengan células frescas en crecimiento activo en una dilución adecuada (1:10) en placas con múltiples pocillos y se incubará a 14 ± 2 °C durante un máximo de 18 días. Para observar si se ha producido ECP, los cultivos celulares se examinarán al microscopio en dos ocasiones, entre 5 y 7 días y entre 14 y 18 días después de la inoculación. Si alguna muestra conjunta presenta ECP, se iniciarán inmediatamente los procedimientos de identificación del virus de conformidad con el punto II.2.4. Si no se observa ECP entre los días 14 y 18, se efectuará una hemadsorción o una prueba de RT-PCR.

Si la citotoxicidad se produce en los primeros siete días de incubación, se realizará un subcultivo en esa fase, y las células se incubarán entre 14 y 18 días y volverán a subcultivarse durante otra período de entre 14 y 18 días. Si la citotoxicidad se produce después de siete días, se realizará un solo subcultivo y las células se incubarán hasta alcanzar el período total de 28 a 36 días de incubación de la inoculación primaria.

Si se produce contaminación bacteriana del cultivo primario, se repetirá la prueba utilizando el homogeneizado de tejidos almacenado a – 80 °C. Antes de la inoculación, el homogeneizado de tejidos se centrifugará a 4 000 × g durante 15 a 30 minutos a entre 0 y 6 °C, y el sobrenadante se filtrará a 0,22 μm. Si se produce contaminación bacteriana durante la fase de subcultivo, el sobrenadante se filtrará a 0,22 μm, se inoculará en células frescas y se incubará durante otros 14 a 18 días.

II.2.4.   Pruebas de identificación del virus

Si se observa ECP en cualquier fase o si la prueba de hemadsorción es positiva, se llevará a cabo la identificación del virus. Los métodos preferibles para la identificación del VAIS serán la de RT-PCR de conformidad con el punto II.1 y la inmunofluorescencia (IF) de conformidad con el punto II.2.6. Si se considera que puede haber otros virus, se realizarán pruebas suplementarias de identificación de virus. En caso de que tales pruebas no proporcionen una identificación definitiva del virus en el plazo de una semana, el sobrenadante se enviará para su identificación inmediata:

a)

al laboratorio de referencia para la AIS de la Organización Mundial de Sanidad Animal (OIE), o

b)

a un laboratorio nacional de referencia o al laboratorio de referencia de la UE para las enfermedades de los peces al que se refiere el anexo VI de la Directiva 2006/88/CE.

II.2.5.   Hemadsorción

Como la replicación del VAIS en cultivos celulares no siempre produce ECP, cada pocillo se someterá a una prueba de RT-PCR o de hemadsorción de conformidad con el presente punto, o a una prueba IF con arreglo al punto II.2.6.

El medio de cultivo celular se retirará de cada pocillo, incluidos los testigos positivos y negativos, y se introducirá en tubos estériles. En cada pocillo se añadirán 500 μl de una suspensión al 0,2 % (v/v) de eritrocitos lavados de conejo o de caballo, o de una suspensión a 0,05 % (v/v) de eritrocitos lavados de trucha arco iris o de salmón del Atlántico, y se incubarán a temperatura ambiente durante 45 minutos. Se retirarán los eritrocitos y los pocillos se lavarán dos veces con medio L-15. Se examinará cada pocillo al microscopio.

La presencia de aglomerados de eritrocitos adheridos a la superficie de las células de ASK se considerará un indicio de presunta infección por un ortomixovirus. Si la prueba de hemadsorción es positiva, se realizará inmediatamente una prueba de identificación del virus de conformidad con el punto II.2.4.

II.2.6.   Inmunofluorescencia (IF)

Las células de ASK (65 pasadas o menos) se cultivarán en un medio L-15 que contenga 10 % de suero bovino fetal, 2 % (v/v) de L-glutamina 200 mM y 0,08 % (v/v) de 2-mercaptoetanol 50 mM en placas con múltiples pocillos y se utilizarán a más del 50 % de confluencia. También podrán utilizarse otras líneas celulares o medio de cultivo de eficacia demostrada. En cada uno de dos pocillos se añadirán 225 μl de sobrenadante de cultivo presuntamente infectado con el virus, se mezclará y se transferirán 225 μl a otros dos pocillos, alcanzando una dilución de 1:5. Otros dos pocillos se dejarán sin inocular como testigos. Las muestras de peces de cada explotación se manipularán en placas separadas, así como el testigo del virus. Se establecerá un testigo utilizando una cepa de referencia del VAIS.

Las placas se incubarán a 14 ± 2 °C y se examinarán al microscopio durante un máximo de 7 días. Cuando el ECP aparezca tempranamente, o si no se observa en 7 días, el próximo paso será la fijación. Los pocillos se lavarán con PBS y se fijarán mediante incubación con un 80 % de acetona durante 20 minutos a temperatura ambiente. Las placas se secarán al aire y se teñirán inmediatamente o se almacenarán a 0-6 °C durante no más de 24 horas antes de realizar la tinción.

Los pocillos replicados se teñirán con una mezcla de anticuerpos monoclonales (AcM) 3H6F8 y 1OC9F5 contra el VAIS, u otros AcM de eficacia y especificidad demostradas, diluidos en PBS, y se incubarán a 37 ± 4 °C durante 30 minutos. Los AcM se retirarán y las placas se lavarán tres veces con Tween 20 al 0,05 % en PBS. Se añadirá en cada pocillo FITC conjugado con anti-IgG de ratón, diluido en PBS, y se incubará a 37 ± 4 °C durante 30 minutos. Las diluciones de diferentes lotes de AcM y conjugado FITC se optimizarán en cada laboratorio. El anticuerpo se retirará y las placas se lavarán tres veces con 0,05 % de Tween 20 en PBS.

Los pocillos se examinarán inmediatamente con un microscopio invertido equipado para microscopía de fluorescencia con un filtro adecuado para la excitación del FITC. La prueba se considerará positiva si se observan células fluorescentes. Para que la prueba sea válida, los testigos positivos deberán dar resultados positivos y los testigos negativos, resultados negativos.

II.3.   Examen de otros tejidos

La técnica del punto II.2.6 podrá aplicarse a otros tejidos de peces como el hígado, el bazo y el corazón, siempre que una cantidad razonable de células endoteliales, leucocitos o linfocitos pueda depositarse en el portaobjetos. El procedimiento de tinción será el mismo para cada tejido, aunque para algunos puede ser preferible omitir la tinción con yoduro de propidio y limitarse a la iluminación en fase para identificar los tipos de células presentes en la impronta.

II.4.   Estudio histológico

Se harán cortes incluidos en parafina de 5 μm y se teñirán con hematoxilina y eosina.

Los cambios histológicos en salmón del Atlántico clínicamente enfermo son variables:

a)

numerosos eritrocitos en el seno venoso central y en los capilares laminares de las branquias, donde también pueden formarse trombos de eritrocitos;

b)

petequias multifocales a confluyentes, necrosis de hepatocitos o ambas a cierta distancia de los vasos más grandes del hígado; acumulación multifocal de eritrocitos en sinusoides hepáticos dilatados;

c)

acumulación de eritrocitos en los vasos sanguíneos de la lámina propia intestinal y, a la larga, hemorragia en la lámina propia;

d)

estroma del bazo distendido por acumulación de eritrocitos;

e)

hemorragia intersticial de ligera y multifocal a extensa y difusa, con necrosis tubular en las zonas hemorrágicas y acumulación de eritrocitos en los glomérulos renales;

f)

eritrofagocitosis esplénica y hemorragias secundarias en hígado y riñón.

II.5.   Inmunohistoquímica (IHC)

Se utilizarán anticuerpos policlonales contra la nucleoproteína del VAIS en cortes de tejidos incluidos en parafina y fijados en formol. Los órganos examinados serán el riñón medio y el corazón (zona de transición, incluidas las tres cámaras y las válvulas). Los casos sospechosos debido a signos patológicos se verificarán con una IHC positiva. Los cortes histológicos se prepararán conforme a métodos normalizados.

1)

Preparación de los cortes de tejidos

Los tejidos se fijarán en formol neutro al 10 % con solución amortiguadora de fosfato durante al menos un día, se deshidratarán en series de etanol escalonadas, se aclararán en xileno y se incluirán en parafina de acuerdo con protocolos normalizados. Los cortes de aproximadamente 5 μm de espesor (colocados para la IHC en portaobjetos cubiertos de poli-L-lisina) se calentarán a 56-58 °C (máximo 60 °C) durante 20 minutos y serán desparafinados en xileno, rehidratados en series de etanol escalonadas y teñidos con hematoxilina y eosina para el estudio anatomopatológico y la IHC con arreglo al punto 2.

2)

Procedimiento de tinción para IHC

Todas las incubaciones se llevarán a cabo a temperatura ambiente sobre una plataforma oscilante, a no ser que se indique lo contrario.

a)

La recuperación del antígeno se hará hirviendo cortes en amortiguador de citrato 0,1 M (pH 6,0) durante 2 × 6 minutos y bloqueándolos a continuación con un 5 % de leche en polvo desnatada y un 2 % de suero de cabra en TBS 50 mM (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH 7,6) durante 20 minutos.

b)

A continuación, los cortes se incubarán durante una noche con anticuerpo primario (anticuerpo de conejo monoespecífico contra la nucleoproteína del VAIS) diluido en TBS con un 1 % de leche en polvo desnatada, y se lavarán tres veces con TBS con Tween 20 al 0,1 %.

c)

Para la detección de anticuerpos unidos, los cortes se incubarán con anticuerpos anti IgG de conejo conjugados con fosfatasa alcalina durante 60 minutos. Tras un lavado final, se añadirá Fast Red (1 mg/ml– 1) y Naphtol AS-MX fosfato (0,2 mg/ml– 1) con levamisol 1 mM en TBS 0,1 M (pH 8,2) para el revelado durante 20 minutos. Después, los cortes se lavarán en agua del grifo antes de aplicar la tinción de contraste con hematoxilina de Harris, y se montarán en medio de montaje acuoso. Se incluirán cortes de tejido positivos y negativos al VAIS como testigos en cada realización.

3)

Interpretación del resultado de la IHC

La interpretación del resultado de la IHC será la que se establece en las letras a) y b):

a)

Los cortes testigo se considerarán positivos si presentan una coloración citoplasmática e intranuclear roja o rojiza claramente visible de las células endoteliales de los vasos sanguíneos o el endocardio. Un corte de muestra de ensayo solo se considerará positivo si se observa esa clara coloración roja intranuclear de las células endoteliales.

b)

Los cortes testigo se considerarán negativos si no presentan ninguna reacción de color importante.

Dado que la localización intranuclear es propia de la nucleoproteína del ortomixovirus durante la fase de replicación del virus, pero a menudo domina una tinción citoplasmática simultánea, las tinciones citoplasmáticas y otros patrones de tinción sin localización intranuclear se considerarán inespecíficos o inconcluyentes.

Las reacciones de tinción positivas más fuertes se suelen obtener en células endoteliales del corazón y el riñón. Las reacciones de tinción endotelial en el interior de lesiones hemorrágicas muy extensas pueden ser ligeras o estar ausentes, posiblemente por lisis de las células endoteliales infectadas.

PARTE 4

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA INFECCIÓN POR MARTEILIA REFRINGENS

I.   Métodos y procedimientos detallados para el diagnóstico de la infección por Marteilia refringens

Cuando se tomen muestras y se efectúen exámenes de laboratorio con el fin de obtener o mantener una calificación sanitaria con respecto a la infección por Marteilia refringens con arreglo a la parte 4, sección I, del anexo I o para confirmar o descartar esta enfermedad de la lista de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE utilizando los métodos de diagnóstico establecidos en la parte 4, sección II, del anexo I, se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los puntos I.1, I.2 y I.3 de la presente parte.

I.1.   Procedimiento de muestreo

Se tomarán prioritariamente muestras de moluscos moribundos o recién muertos, a fin de aumentar las posibilidades de hallar animales infectados.

Las muestras de ostras o mejillones se mantendrán a 4 °C o en hielo refrigerado durante no más de 24 horas si contienen moluscos moribundos, y no más de 72 horas si no, en una bolsa de plástico etiquetada con datos sobre la naturaleza y el origen de las ostras o mejillones. Los moluscos moribundos o recién muertos se mantendrán separados de otros moluscos.

Para el diagnóstico de Marteilia refringens por estudio histológico se utilizará un corte de entre 3 y 5 mm de espesor de tejidos que incluya branquias y tejido cardíaco. Para algunas pruebas, incluidas las improntas y la PCR, se utilizará un fragmento de la glándula digestiva.

I.2.   Técnicas de microscopía

I.2.1.   Citodiagnóstico (por impronta)

Tras el secado de los tejidos de glándula digestiva en papel absorbente, se realizarán varias improntas sobre un portaobjetos de vidrio. Las preparaciones se secarán al aire, se fijarán en metanol o en etanol absoluto y se teñirán utilizando un kit de tinción sanguínea disponible en el comercio, como Diff-Quik® o Hemacolor®, de acuerdo con las instrucciones del fabricante. Tras un lavado con agua del grifo y un secado, se montarán los portaobjetos con un cubreobjetos utilizando una resina sintética apropiada. El examen de los portaobjetos se realizará primero a 200 aumentos, y luego con microscopía de inmersión en aceite a 1 000 aumentos.

Un resultado positivo será la observación de células de un tamaño de hasta 30-40 μm. El citoplasma adquiere una tinción basófila, mientras que la tinción del núcleo es eosinófila. Se observan halos pálidos alrededor de gránulos grandes, intensamente teñidos (refringentes) y, en las células más grandes, disposiciones de células dentro de células.

La técnica no es específica para esta especie de parásito.

I.2.2.   Estudio histológico

Los cortes de tejido, que incluirán branquias, glándula digestiva, manto y gónadas, se fijarán durante al menos 24 horas en fijador de Davidson, tras lo cual se realizará el tratamiento normal para estudio histológico en parafina y la tinción, por ejemplo con hematoxilina y eosina. Las observaciones se efectuarán a aumentos crecientes hasta × 1 000.

Un resultado positivo será la observación de células de un tamaño que va de 4 a 40 μm. Las fases iniciales consisten en células multinucleadas, esféricas a alargadas. Estas se encuentran principalmente en el epitelio del esófago o el estómago y, a veces, en los palpos labiales. La esporulación comporta la división de células dentro de células y tiene lugar en los túbulos y conductos de la glándula digestiva. Aparecen gránulos refringentes en el curso de la esporulación, pero no se observan en las fases iniciales. En las fases avanzadas de la infección se observan esporangios libres en la luz del tubo digestivo. El citoplasma adquiere una tinción basófila, mientras que la tinción del núcleo es eosinófila. Los gránulos pueden adquirir una coloración entre naranja oscuro y rojo oscuro.

La técnica no es específica para esta especie de parásito.

I.3.   Técnicas moleculares

I.3.1.   Extracción del ADN

El ADN se extraerá con arreglo a procedimientos normalizados.

Pueden utilizarse kits de extracción del ADN, que están disponibles en el comercio y suelen producir ADN de alta calidad adecuado para su uso con los protocolos de PCR contemplados en el punto I.3.2.

I.3.2.   Reacción en cadena de la polimerasa (PCR)

Se han elaborado y publicado varios protocolos de PCR.

Se utilizarán los cebadores de PCR dirigidos a la región del ITS1 (espaciador transcrito interno), por su capacidad de amplificar únicamente la especie M. refringens.

La PCR se realizará en un volumen de 50 μl. Las mezclas de PCR contendrán solución amortiguadora (KCl 500 mM, Tris/HCl 100 mM [pH 9,0 a 25 °C] y un 1 % de Triton® X-100), MgCl2 2,5 mM, mezcla de dNTP 0,2 mM, cebadores directo e inverso 1 μΜ, 0,02 unidades μl– 1 de Taq ADN polimerasa y 10 a 100 ng de ADN extraído. Tras la desnaturalización del ADN a 94 °C durante 5 minutos, se realizan 30 ciclos como sigue: desnaturalización a 94 °C durante 1 minuto, hibridación a 55 °C durante 1 minuto y elongación a 72 °C durante 1 minuto por cada par de kilobases. Se realiza un paso final de elongación de 10 minutos a 72 °C. Para la detección de M. refringens, se realiza una PCR con cebadores dirigidos a la región del ITS1 (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ y 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).

Los testigos positivos consistirán en ADN genómico procedente de un hospedador con una infección intensa o ADN plasmídico que contiene la región objetivo.

Los testigos negativos consistirán en ADN genómico procedente de hospedadores no infectados y reactivos de la PCR sin ADN objetivo.

Un resultado positivo será una amplificación de PCR positiva de la magnitud esperada (412 bp), al tiempo que todos los testigos negativos producen resultados negativos y todos los testigos positivos dan resultados positivos.

I.3.3.   Hibridación in situ

Se han elaborado y publicado varios protocolos de hibridación in situ.

Se utilizará una sonda dirigida a la subunidad pequeña (SSU) del complejo génico del ARNr, ya que ha sido validada frente al estudio histológico.

Los cortes de tejido, que incluirán branquias y glándula digestiva, se fijarán durante al menos 24 horas en fijador de Davidson, tras lo cual se realizará el tratamiento normal para estudio histológico en parafina. Los cortes de 5 μm de espesor se colocarán sobre portaobjetos con recubrimiento de aminoalquilsilano, que se hornearán durante una noche a 40 °C. Los cortes se desparafinarán mediante inmersión en xileno durante 10 minutos. Este paso se repetirá una vez y luego se eliminará el disolvente mediante inmersión en dos baños sucesivos de etanol absoluto de 10 minutos cada uno. Luego se deshidratarán los cortes mediante inmersión en series de etanol escalonadas. Los cortes se tratarán con proteinasa K (100 μg ml– 1) en amortiguador TE (Tris [50 mM], EDTA [10 mM]), a 37 °C durante 30 minutos. Los portaobjetos se deshidratarán mediante inmersión en series de etanol escalonadas y luego se secarán al aire. Los cortes se incubarán con 100 μl de amortiguador de hibridación (4 × SSC [citrato salino estándar], 50 % de formamida, 1 × solución de Denhardt, 250 μg ml– 1 de ARNt de levadura, 10 % de sulfato de dextrano) que contengan 10 ng (1 μl del reactante PCR preparado como se describe en el punto I.3.2 y utilizando los cebadores CCG-GTG-CCA-GGT-ATA-TCT-CG y TTC-GGG-TGG-TCT-TGA-AAG-GC) de la sonda marcada con digoxigenina. Los cortes se cubrirán con cubreobjetos de plástico in situ y se colocarán en un bloque de calentamiento a 95 °C durante 5 minutos. A continuación se enfriarán los portaobjetos en hielo durante 1 minuto antes de una hibridación durante una noche a 42 °C en cámara húmeda. Los cortes se lavarán dos veces durante 5 minutos en 2 × SSC a temperatura ambiente y una vez durante 10 minutos en 0,4 × SSC a 42 °C. Los pasos de detección se realizarán de acuerdo con las instrucciones del fabricante. Luego se enjuagarán los portaobjetos en agua destilada (dH2O) estéril. Se aplicará una tinción de contraste a los cortes con Bismarck Brown Yellow; los cortes se enjuagarán en dH2O y se aplicarán cubreobjetos utilizando un medio de montaje acuoso.

Los testigos positivos y negativos serán cortes de hospedadores de los que se sepa, respectivamente, que están infectados y que no están infectados.

Un resultado positivo se mostrará en un marcado de color violeta-negro de las células de M. refringens dentro de los tejidos objetivo conocidos, al tiempo que todos los testigos negativos producen resultados negativos y todos los testigos positivos dan resultados positivos.

I.3.4.   Secuenciación

La secuenciación se llevará a cabo como uno de los pasos finales para el diagnóstico de confirmación. Las regiones objetivo serán la SSU del ADNr y el ITS1.

II.   Métodos y procedimientos detallados para la vigilancia y confirmación de la infección por Marteilia refringens

A los efectos de los programas de vigilancia y para confirmar una infección por Marteilia refringens o descartar una sospecha de dicha enfermedad de la lista de conformidad con los requisitos de la parte 4, sección II, del anexo I, los métodos de diagnóstico y procedimientos correspondientes se ajustarán a las directrices del cuadro 4.1.

Cuadro 4.1

Directrices para el uso de los métodos de diagnóstico en los programas de vigilancia y para descartar o confirmar la infección por Marteilia refringens

Método

Vigilancia específica

Diagnóstico de presunción

Diagnóstico de confirmación

Improntas de glándula digestiva

X

X

X, o

Histopatología

X

 

X, o

Hibridación in situ

 

 

X, y

PCR

X

X

X, y

Secuenciación

 

 

X

PARTE 5

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA INFECCIÓN POR BONAMIA OSTREAE

I.   Procedimientos de diagnóstico de la infección por Bonamia ostreae

Cuando se tomen muestras y se efectúen exámenes de laboratorio con el fin de obtener o mantener una calificación sanitaria con respecto a la infección por Bonamia ostreae con arreglo a la parte 5, sección I, del anexo I o para confirmar o descartar esta enfermedad de la lista de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE utilizando los métodos de diagnóstico establecidos en la parte 5, sección II, del anexo I, se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los siguientes puntos I.1, I.2 y I.3.

I.1.   Proceso de muestreo

Se tomarán prioritariamente muestras de moluscos moribundos o recién muertos, a fin de aumentar las posibilidades de hallar animales infectados.

Las muestras de ostras se mantendrán a 4 °C o en hielo refrigerado durante no más de 24 horas si contienen moluscos moribundos, y 72 horas si no, en una bolsa de plástico etiquetada con datos sobre la naturaleza y el origen de las ostras. Los moluscos moribundos o recién muertos se mantendrán separados de otros moluscos.

Para el diagnóstico de Bonamia ostreae por estudio histológico se utilizará un corte de entre 3 y 5 mm de espesor de tejidos que incluya branquias y tejido cardíaco. Para algunas pruebas, incluidas las improntas y la PCR, se utilizará un fragmento de la glándula digestiva.

I.2.   Técnicas de microscopía

I.2.1.   Citodiagnóstico (por impronta)

Tras el secado de las branquias o el tejido cardíaco en papel absorbente, se realizarán varias improntas sobre un portaobjetos de vidrio. Los portaobjetos se secarán al aire, se fijarán en metanol o en etanol absoluto y se teñirán utilizando un kit de tinción sanguínea disponible en el comercio, como Diff-Quik® o Hemacolor®, de acuerdo con las instrucciones del fabricante. Tras un lavado con agua del grifo y un secado, se montarán los portaobjetos con un cubreobjetos utilizando una resina sintética apropiada. El examen de los portaobjetos se realizará primero a 200 aumentos, y luego con microscopía de inmersión en aceite a 1 000 aumentos.

Un resultado positivo será la presencia de pequeños cuerpos esféricos u organismos ovoides (2-5 μm de anchura) dentro de los hemocitos. No obstante, el parásito también puede ser exterior a las células. Estos organismos muestran un citoplasma basófilo y un núcleo eosinófilo (los colores pueden variar en función de la tinción usada) y, dado que se extienden sobre el portaobjetos, pueden parecer más anchos en las improntas que en el examen histológico. Podrán observarse células multinucleadas. La técnica no es específica para esta especie de parásito.

I.2.2.   Estudio histológico

Los cortes de tejido, que incluirán branquias y glándula digestiva, se fijarán durante al menos 24 horas en fijador de Davidson, tras lo cual se realizará el tratamiento normal para estudio histológico en parafina y la tinción, por ejemplo con hematoxilina y eosina. Las observaciones se efectuarán a aumentos crecientes hasta × 1 000.

Un resultado positivo será la presencia de parásitos como células muy pequeñas de 2 a 5 μm de anchura dentro de los hemocitos o libres en el tejido conjuntivo o los senos de las branquias, el intestino y el epitelio del manto, a menudo asociados con una intensa reacción inflamatoria. Para evitar posibles dudas, el diagnóstico será positivo solo si el parásito se observa dentro del hemocito. La técnica no es específica para esta especie de parásito.

I.3.   Técnicas moleculares

I.3.1.   Extracción del ADN

El ADN se extraerá con arreglo a procedimientos normalizados.

Pueden utilizarse kits de extracción del ADN, que están disponibles en el comercio y suelen producir ADN de alta calidad adecuado para su uso con los protocolos de PCR que más abajo se detallan.

I.3.2.   Reacción en cadena de la polimerasa (PCR)

Se han elaborado y publicado varios protocolos de PCR.

Podrán utilizarse dos protocolos de PCR dirigidos a la SSU del ADNr:

a)

El primero consiste en una PCR convencional que amplifica varios miembros del filo Haplosporidia, incluida Bonamia spp.Los cebadores designados Bo-Boas serán 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ y 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′ respectivamente, y amplificarán un producto de 300 bp. Las mezclas de PCR contendrán solución amortiguadora (KCl 500 mM, Tris/HCl 100 mM [pH 9,0 a 25 °C] y un 1 % de Triton® X-100), MgCl2 2,5 mM, mezcla de dNTP 0,2 mM, cebadores directo e inverso 1 μΜ, 0,02 unidades μl– 1 de Taq ADN polimerasa y 0,2 ng μl– 1 del molde de ADN en un volumen total de 50 μl. Las muestras serán desnaturalizadas en un termociclador durante 5 minutos a 94 °C antes de ser sometidas a 30 ciclos (94 °C durante 1 minuto, 55 °C durante 1 minuto, 72 °C durante un minuto), seguidos de una extensión final de 10 minutos a 72 °C.

Los testigos positivos consistirán en ADN genómico procedente de un hospedador con una infección intensa o ADN plasmídico que contiene la región objetivo.

Los testigos negativos consistirán en ADN genómico procedente de hospedadores no infectados y reactivos de la PCR sin ADN objetivo.

Un resultado positivo será una amplificación de PCR positiva de la magnitud esperada (300 bp), al tiempo que todos los testigos negativos producen resultados negativos y todos los testigos positivos dan resultados positivos.

b)

El segundo protocolo de PCR es un ensayo en tiempo real con SYBR® Green. Permite la detección específica de B. ostreae (descrita abajo) y puede combinarse con un ensayo de PCR en tiempo real con SYBR® Green, que permite la detección específica de B. exitiosa (Ramilo et al. 2013).

Los cebadores BOSTRE-F (5′- TTACGTCCCTGCCCTTTGTA-3′) y BOSTRE-R (5′- TCGCGGTTGAATTTTATCGT-3′) amplifican un producto de 208 bp. Las mezclas de PCR contendrán SYBR® Green Master Mix (1X), 0,3 μm de cebadores directo e inverso y 200 ng de ADN extraído. Las muestras se desnaturalizarán en un sistema de detección en tiempo real durante 10 minutos a 95 °C antes de ser sometidas a 35 ciclos (95 °C durante 30 segundos, 55 °C durante 45 segundos y 72 °C durante 1 minuto). El análisis de la curva de temperatura de fusión se llevará a cabo con incrementos de temperatura de 0,5 °C/s, empezando a 55 °C y finalizando a 95 °C, y registrando la fluorescencia en cada cambio de temperatura.

Los testigos positivos consistirán en ADN genómico procedente de un hospedador con una infección intensa o ADN plasmídico que contenga la región objetivo.

Los testigos negativos consistirán en ADN genómico procedente de hospedadores no infectados y reactivos de la PCR sin ADN objetivo.

Un resultado positivo será una amplificación de PCR con un pico único de temperatura de fusión (78,25 ± 0,25 °C en las condiciones publicadas por Ramilo et al. 2013), al tiempo que todos los testigos negativos producen resultados negativos y todos los testigos positivos dan resultados positivos.

I.3.3.   Hibridación in situ

Se han elaborado y publicado varios protocolos de hibridación in situ.

Se utilizará una sonda dirigida a la SSU del complejo génico del ADNr, si bien se ha demostrado que da lugar a reacciones cruzadas con otros haplosporidios.

Los cortes de tejido, que incluirán branquias y glándula digestiva, se fijarán durante al menos 24 horas en fijador de Davidson, tras lo cual se realizará el tratamiento normal para estudio histológico en parafina. Los cortes de 5 μm de espesor se colocarán sobre portaobjetos con recubrimiento de aminoalquilsilano, que se hornearán durante una noche a 40 °C. Los cortes se desparafinarán mediante inmersión en xileno durante 10 minutos. Este paso se repetirá una vez y luego se eliminará el disolvente mediante inmersión en dos baños sucesivos de etanol absoluto de 10 minutos cada uno. Luego se deshidratarán los cortes mediante inmersión en series de etanol escalonadas. Los cortes se tratarán con proteinasa K (100 μg ml– 1) en amortiguador TE (Tris [50 mM], EDTA [10 mM]), a 37 °C durante 30 minutos. Los portaobjetos se deshidratarán mediante inmersión en series de etanol escalonadas y luego se secarán al aire. Los cortes se incubarán con 100 μl de amortiguador de hibridación (4 × SSC [citrato salino estándar], 50 % de formamida, 1 × solución de Denhardt, 250 μg ml– 1 de ARNt de levadura, 10 % de sulfato de dextrano) que contengan 20 ng (2 μl de la PCR preparada como se describe en el punto I.3.2 utilizando los cebadores Bo y Boas) de la sonda marcada con digoxigenina. Los cortes se cubrirán con cubreobjetos de plástico in situ y se colocarán en un bloque de calentamiento a 95 °C durante 5 minutos. A continuación se enfriarán los portaobjetos en hielo durante 1 minuto antes de una hibridación durante una noche a 42 °C en cámara húmeda. Los cortes se lavarán dos veces durante 5 minutos en 2 × SSC a temperatura ambiente y una vez durante 10 minutos en 0,4 × SSC a 42 °C. Los pasos de detección se realizarán de acuerdo con las instrucciones del fabricante. Luego se enjuagarán los portaobjetos en agua destilada (dH2O) estéril. Se aplicará una tinción de contraste a los cortes con Bismarck Brown Yellow; los cortes se enjuagarán en dH2O y se aplicarán cubreobjetos utilizando un medio de montaje acuoso.

Los testigos positivos y negativos serán cortes de hospedadores de los que se sepa, respectivamente, que están infectados y que no están infectados.

Un resultado positivo corresponderá a parásitos marcados dentro de los hemocitos, al tiempo que todos los testigos negativos dan un resultado negativo y todos los positivos, un resultado positivo.

I.3.4.   Secuenciación

La secuenciación se llevará a cabo como uno de los pasos finales para el diagnóstico de confirmación. Las regiones objetivo serán la SSU del ADNr y el ITS1.

II.   Procedimientos de vigilancia y confirmación de la infección por Bonamia ostreae

A los efectos de la vigilancia y para confirmar o descartar la sospecha de una infección por Bonamia ostreae, de conformidad con los requisitos de la parte 5, sección II, del anexo I, los métodos de diagnóstico y procedimientos correspondientes se ajustarán a las directrices del cuadro 5.1.

Cuadro 5.1

Directrices para el uso de los métodos de diagnóstico en los programas de vigilancia y para descartar o confirmar la infección por Bonamia ostreae

Método

Vigilancia específica

Diagnóstico de presunción

Diagnóstico de confirmación

Improntas de corazón o branquias

X

X

X, o

Histopatología

X

 

X, o

Hibridación in situ

 

 

X, y

PCR

X

X

X, y

Secuenciación

 

 

X

PARTE 6

MÉTODOS Y PROCEDIMIENTOS DE DIAGNÓSTICO DETALLADOS PARA LA VIGILANCIA Y CONFIRMACIÓN DE LA ENFERMEDAD DE LAS MANCHAS BLANCAS (EMB)

1.   Procedimientos de diagnóstico para la detección del VSMB

Cuando se tomen muestras y se efectúen exámenes de laboratorio a los efectos de los programas de vigilancia y erradicación establecidos en la parte 6, sección I, del anexo I y para confirmar o descartar una sospecha de infección por el VSMB de conformidad con el artículo 57, letra b), de la Directiva 2006/88/CE, utilizando los métodos de diagnóstico que se establecen en la parte 6, sección II, del anexo I, se aplicarán los métodos y procedimientos de diagnóstico detallados establecidos en los puntos 2 a 7 de la presente parte.

Los métodos y procedimientos que se describen en la presente parte del anexo II se han adaptado partir de los ensayos acreditados conforme a ISO 17025 en el laboratorio de referencia de la Unión Europea para las enfermedades de los crustáceos. Podrán aplicarse enfoques alternativos en condiciones equivalentes o con kits producidos por distintos fabricantes, si bien deben ofrecer una sensibilidad y especificidad equivalentes a los descritos en la presente parte. En todos los casos, los productos de PCR amplificados serán secuenciados para confirmar su identidad como virus del síndrome de las manchas blancas (VSMB).

2.   Proceso de muestreo

Los tejidos de crustáceos (pleópodos y branquias) que contengan el VSMB podrán almacenarse en etanol o reactivo de estabilización del ARN, o congelarse a – 80 °C. Las fases necesarias para la identificación del VSMB a partir de muestras tisulares serán las siguientes: homogeneización del tejido, extracción del ADN, amplificación específica por PCR del ADN del virus, visualización del producto amplificado en un gel, purificación del ADN y secuenciación para confirmar la identidad del agente patógeno.

3.   Homogeneización de tejidos

La molturación de los tejidos y la preparación de un homogeneizado en una solución amortiguadora adecuada se efectuarán utilizando el molino FastPrep y tubos Lysing matrix A (MP Biomedicals). Los tejidos se pesarán, se introducirán en tubos Lysing matrix A, se diluirán 1 a 10 p/v (o de acuerdo con las instrucciones del fabricante) en una solución amortiguadora adecuada (G2 y 10 μl de proteinasa K para uso con DNA Tissue Kit [Qiagen]) y se homogeneizarán con el homogeneizador FastPrep 24 durante dos minutos. Las muestras homogeneizadas se incubarán a 56 °C durante un mínimo de cuatro horas o durante una noche. Las muestras se mezclarán en vórtex y se centrifugarán a 9 000 rpm durante dos minutos, y 50 μl del sobrenadante o un volumen equivalente a 5 mg de tejidos (peso de tejido óptimo para el kit de extracción) se añadirán a un tubo de muestra para la extracción de ADN; se rellenará hasta 200 μl con solución amortiguadora G2.

4.   Extracción del ADN

El ADN total se extraerá utilizando un kit de extracción del ADN de tejidos y el aparato EZ1 Advanced XL BioRobot (Qiagen), siguiendo las instrucciones del fabricante. Se incluirán un testigo de extracción (ADN de timo de ternera) y un testigo negativo (amortiguador G2) en cada lote de muestras. El ADN se eluirá en 50 μl de volumen. Para garantizar que la extracción ha tenido éxito, la concentración de ADN para todas las muestras y testigos se determinará utilizando una máquina NanoDrop. El ADN extraído se congelará a – 20 °C si no se necesita inmediatamente.

5.   PCR para la detección del VSMB

El método que se utilizará para la detección del VSMB será el protocolo de PCR con cebadores internos que se establece en los siguientes apartados, que amplifica, respectivamente en la primera serie de PCR y en la segunda, un amplicón de 1 447 bp y un amplicón de 848 bp del gen 18s del ARNr.

La primera serie de PCR se efectuará con un volumen de 50 μl que contendrá concentraciones finales de 1 × GoTaq Buffer (Promega), MgCl2 5 mM, 1 pmol/μl de cebador VSMB 146 F1, 1 pmol/μl de cebador VSMB 146 R1 (cuadro 1), dNTP 0,25 mM, 1,25 U de Taq polimerasa y 2,5 μl de ADN. Cada muestra se manipulará por duplicado junto a un testigo de extracción negativo, un testigo negativo de la PCR (con 2,5 μl de H2O añadido en lugar de ADN) y un testigo positivo. El testigo positivo será plásmido diluido del VSMB preparado y validado para uso propio (disponible en el laboratorio de referencia de la UE).

La segunda serie de PCR para el VSMB se efectuará igual que la primera, aunque se utilizará el par de cebadores VSMB 146 F2/R2 y un segundo testigo positivo, para comprobar que esta fase de la PCR ha funcionado.

Cebador

Secuencia

WSSV 146 F1

ACTACTAACTTCAGCCTATCTAG

WSSV 146 R1

TAATGCGGGTGTAATGTTCTTACGA

WSSV 146 F2

GTAACTGCCCCTTCCATCTCCA

WSSV 146 R2

TACGGCAGCTGCTGCACCTTGT

Ambas series de la PCR se realizarán conforme a la siguiente sucesión de ciclos en un termociclador DNA Engine Tetrad 2 Peltier (o equivalente). Un paso inicial de desnaturalización a 94 °C durante dos minutos, seguido de 94 °C durante 30 segundos, 62 °C durante 30 segundos, 72 °C durante 30 segundos, que se repite en 30 ciclos, una extensión a 72 °C durante dos minutos, y serán mantenidos a 4 °C.

6.   Electroforesis en gel

Los productos amplificados de las series primera y segunda de PCR se visualizarán en geles de agarosa al 2 % utilizando un amortiguador TAE. Se pasarán 15 μl de cada muestra a 120 voltios durante 20 minutos aproximadamente, y se observarán con luz ultravioleta. Las muestras positivas producirán una banda de 1 447 bp en la primera serie de PCR y de 848 bp, en la segunda. Las muestras de este tamaño se cortarán y se introducirán en un tubo de microcentrifugado de 1,5 ml. El ADN contenido en los cortes de gel se purificará con el kit Wizard® SV Gel and PCR clean-Up System de Promega con arreglo a las instrucciones del fabricante. La concentración del ADN se estimará utilizando una máquina NanoDrop. El ADN purificado se congelará a – 20 °C si no se utiliza inmediatamente.

7.   Secuenciación de los productos de PCR amplificados

El ADN será secuenciado con Big Dye Terminator Kit v3,1 (Applied Biosystems). El volumen total de cada reacción es 20 μl, y las concentraciones finales son 1 × Big Dye Terminator, 1 × amortiguador de secuenciación, 10 pmol/μl de cebador directo o inverso y 10 μl de ADN purificado (diluido a aproximadamente 10 ng/μl); pasar la siguiente sucesión de ciclos en un termociclador DNA Engine Tetrad 2 Peltier (o equivalente): 94 °C durante 30 segundos, seguido de 96 °C durante 10 segundos, 50 °C durante 10 segundos y 60 °C durante 4 minutos, repitiendo los últimos tres pasos 30 veces.

Los productos de PCR se precipitarán con un método a base de acetato de sodio, en el cual se añaden 20 μl de ADN a 10 μl de NaAc, 70 μl de H2O y 250 μl de etanol, se mezclan en vórtex y se centrifugan a 13 000 rpm durante 20 minutos; el sobrenadante se eliminará y el sedimento se lavará con 200 μl de etanol absoluto, y se centrifugará a 13 000 rpm durante 5 minutos. El sedimento se secará durante cinco minutos a 37 °C. Se le añadirán 25 μl de formamida Hi-Di, se calentará a 95 °C durante dos minutos y se mezclará bien en vórtex. Las muestras se secuenciarán utilizando el analizador ABI3130xl Avant Genetic de acuerdo con las instrucciones del fabricante. Los resultados de la secuenciación se analizarán mediante el programa informático Sequencher y las secuencias se cotejarán con las de la base de datos del NCBI utilizando la función BLAST.


Top