?

23.9.2015    | EN | Official Journal of the European Union | L 247/123.9.2015    | DA | Den Europæiske Unions Tidende | L 247/123.9.2015    | FR | Journal officiel de l'Union européenne | L 247/1
COMMISSION IMPLEMENTING DECISION (EU) 2015/1554KOMMISSIONENS GENNEMFØRELSESAFGØRELSE (EU) 2015/1554DÉCISION D'EXÉCUTION (UE) 2015/1554 DE LA COMMISSION
of 11 September 2015af 11. september 2015du 11 septembre 2015
laying down rules for the application of Directive 2006/88/EC as regards requirements for surveillance and diagnostic methodsom fastlæggelse af regler for anvendelsen af direktiv 2006/88/EF for så vidt angår krav til overvågning og diagnosemetoderportant modalités d'application de la directive 2006/88/CE en ce qui concerne les exigences relatives à la surveillance et aux méthodes de diagnostic
(notified under document C(2015) 6188)(meddelt under nummer C(2015) 6188)[notifiée sous le numéro C(2015) 6188]
(Text with EEA relevance)(EØS-relevant tekst)(Texte présentant de l'intérêt pour l'EEE)
THE EUROPEAN COMMISSION,EUROPA-KOMMISSIONEN HAR —LA COMMISSION EUROPÉENNE,
Having regard to the Treaty on the Functioning of the European Union,under henvisning til traktaten om Den Europæiske Unions funktionsmåde,vu le traité sur le fonctionnement de l'Union européenne,
Having regard to Council Directive 2006/88/EC of 24 October 2006 on animal health requirements for aquaculture animals and products thereof, and on the prevention and control of certain diseases in aquatic animals (1), and in particular Articles 49(3), 50(4), 57(b) and 61(3) thereof,under henvisning til Rådets direktiv 2006/88/EF af 24. oktober 2006 om dyresundhedsbestemmelser for akvakulturdyr og produkter deraf og om forebyggelse og bekæmpelse af visse sygdomme hos vanddyr (1), særlig artikel 49, stk. 3, artikel 50, stk. 4, artikel 57, litra b), og artikel 61, stk. 3, ogvu la directive 2006/88/CE du Conseil du 24 octobre 2006 relative aux conditions de police sanitaire applicables aux animaux et aux produits d'aquaculture, et relative à la prévention de certaines maladies chez les animaux aquatiques et aux mesures de lutte contre ces maladies (1), et notamment son article 49, paragraphe 3, son article 50, paragraphe 4, son article 57, point b) et son article 61, paragraphe 3,
Whereas:ud fra følgende betragtninger:considérant ce qui suit:
(1) | Directive 2006/88/EC lays down minimum preventive measures for the surveillance and early detection in aquatic animals of the listed diseases set out in Annex IV to that Directive (‘the listed diseases’) and the control measures to be applied in the event of the suspicion of or an outbreak of the listed diseases. It also lays down the requirements for the achievement of disease-free status for Member States or for zones or compartments thereof.(1) | Ved direktiv 2006/88/EF er der fastsat forebyggende minimumsforanstaltninger til overvågning og tidlig påvisning hos akvatiske dyr af de listeopførte sygdomme i bilag IV til samme direktiv (i det følgende benævnt »listeopførte sygdomme«) samt bekæmpelsesforanstaltninger, der skal anvendes ved mistanke om eller udbrud af de listeopførte sygdomme. I direktivet fastsættes der tillige krav, som skal være opfyldt, for at medlemsstater eller zoner eller segmenter deri kan opnå status som sygdomsfri.(1) | La directive 2006/88/CE établit les mesures préventives minimales pour la surveillance et la détection précoce, chez les animaux aquatiques, des maladies énumérées à son annexe IV (ci-après les «maladies répertoriées»), ainsi que les mesures de lutte à mettre en œuvre en cas de présence suspectée ou avérée d'un foyer de ces maladies répertoriées. Elle définit également les exigences requises pour l'obtention du statut «indemne de maladie» par des États membres ou des zones ou compartiments de ceux-ci.
(2) | The eradication of the listed diseases and the achievement of disease-free status for a Member State, zone or compartment should be based on the same principles and follow the same scientific approach throughout the Union. For that reason, it is necessary to lay down at Union level specific requirements for eradication and surveillance schemes, and the sampling and diagnostic methods to be used by the Member States to obtain disease-free status for the whole of a Member State or a zone or compartment thereof.(2) | Udryddelse af de listeopførte sygdomme og opnåelse af status som sygdomsfri for en medlemsstat, en zone eller et segment bør være baseret på de samme principper og følge den samme videnskabelige fremgangsmåde i hele Unionen. Det er derfor nødvendigt, at der på EU-plan fastsættes særlige krav vedrørende udryddelses- og overvågningsordninger samt de prøveudtagnings- og diagnosemetoder, medlemsstaterne skal anvende med henblik på at opnå status som sygdomsfri for hele medlemsstaten eller for en zone eller et segment deri.(2) | L'éradication des maladies répertoriées et l'obtention du statut «indemne de maladie» par un État membre, une zone ou un compartiment devraient reposer sur des principes et une démarche scientifique identiques dans toute l'Union. En conséquence, il est nécessaire de définir au niveau de l'Union des exigences spécifiques applicables aux programmes de surveillance et d'éradication, ainsi que les méthodes d'échantillonnage et de diagnostic à utiliser par les États membres pour obtenir le statut «indemne de maladie» à l'échelle de l'État membre ou d'une zone ou compartiment de celui-ci.
(3) | The laboratory examinations to be carried out in the event of the suspicion or confirmation of the presence of the listed diseases, should be the same at Union level and should follow the same scientific standards and protocols. In accordance with Directive 2006/88/EC, it is necessary to establish specific diagnostic methods and procedures to be used by the laboratories designated for that purpose by the competent authority of the Member States.(3) | De laboratorieundersøgelser, der skal udføres i tilfælde af mistanke om eller bekræftet forekomst af de listeopførte sygdomme, bør være de samme i hele Unionen og bør følge de samme videnskabelige standarder og protokoller. Det er nødvendigt, i overensstemmelse med direktiv 2006/88/EF, at fastlægge særlige diagnosemetoder og -procedurer, som skal anvendes af de laboratorier, der er udpeget til formålet af den kompetente myndighed i medlemsstaterne.(3) | Les examens de laboratoire à effectuer en cas de suspicion d'une maladie répertoriée ou pour confirmer la présence d'une telle maladie devraient être identiques dans toute l'Union et respecter les mêmes normes et protocoles scientifiques. Conformément à la directive 2006/88/CE, il est nécessaire d'établir les méthodes et procédures de diagnostic spécifiques à utiliser par les laboratoires désignés à cet effet par l'autorité compétente de chaque État membre.
(4) | The Aquatic Animal Health Code adopted by the World Organisation for Animal Health (OIE) (the ‘Aquatic Code’) sets out standards for improving the health of aquatic animals and the welfare of farmed fish worldwide, including standards for safe international trade in aquatic animals and products thereof. A number of chapters of the Aquatic Code set out recommendations concerning the use of certain diagnostic tests. Such tests provided for by the OIE are laid down in the OIE Manual of Diagnostic Tests for Aquatic Animals (the ‘Aquatic Manual’). In order to ensure that Union's requirements with regard to aquatic animal disease diagnostics are consistent with international standards, the rules laid down in this Decision should take into account the standards and recommendations of the Aquatic Code.(4) | Ved akvatiske dyrs sundhedskodeks som vedtaget af Verdensorganisationen for Dyresundhed (OIE) (i det følgende benævnt »den akvatiske kodeks«) er der fastsat standarder for forbedring af akvatiske dyrs sundhed og opdrættede fisks velfærd på verdensplan, herunder standarder for sikker international handel med akvatiske dyr og produkter deraf. Flere af kapitlerne i den akvatiske kodeks indeholder anbefalinger vedrørende anvendelse af visse diagnostiske test. Sådanne test, som fastsat af OIE, er indeholdt i OIE's Manual of Diagnostic Tests for Aquatic Animals (i det følgende benævnt »den akvatiske manual«). For at sikre, at Unionens krav med hensyn til diagnosticering af sygdomme hos akvatiske dyr er i overensstemmelse med de internationale standarder, bør der med reglerne i denne afgørelse tages hensyn til standarderne og anbefalingerne i den akvatiske kodeks.(4) | Le Code sanitaire pour les animaux aquatiques adopté par l'Organisation mondiale de la santé animale (OIE) (ci-après le «code aquatique») établit des normes pour l'amélioration de la santé des animaux aquatiques et le bien-être des poissons d'élevage dans le monde, y compris des normes de sécurité sanitaire applicables aux échanges internationaux d'animaux aquatiques et des produits qui en sont issus. Un certain nombre de chapitres du code aquatique énoncent des recommandations concernant l'utilisation de certains tests de diagnostic. Ces tests, proposés par l'OIE, sont décrits dans le Manuel des tests de diagnostic pour les animaux aquatiques de l'OIE (ci-après le «manuel aquatique»). Pour garantir la cohérence entre les normes internationales et les exigences de l'Union relatives aux méthodes de diagnostic des maladies des animaux aquatiques, il convient que les règles énoncées dans la présente décision tiennent compte des normes et recommandations figurant dans le code aquatique.
(5) | In this respect, for many of the listed diseases, the Aquatic Manual lists several tests and procedures to be used for the purpose of laboratory examinations. In order to uniform the scientific basis for the diagnostic work for the listed diseases at Union level, it is necessary to choose among the diagnostic tests and procedures recommended by the OIE and to specify which tests should be mandatory for the purpose of laboratory examination when carrying out surveillance programmes and to rule out the suspicion of or to confirm the presence of the listed diseases. While there also will be a need for having alternative methods and procedures available in certain cases, descriptions and some scientific explanations for when and how the alternative methods could be applied should be provided. This is in particular necessary for the more detailed diagnostic procedures.(5) | I denne forbindelse indeholder den akvatiske manual, for mange af de listeopførte sygdomme, flere forskellige test og procedurer, der skal anvendes til laboratorieundersøgelser. Med henblik på at ensarte det videnskabelige grundlag for det diagnostiske arbejde for de listeopførte sygdomme på EU-plan er det nødvendigt at vælge blandt de diagnostiske test og procedurer, der anbefales af OIE, og præcisere, hvilke test der skal være obligatoriske til laboratorieundersøgelser i forbindelse med gennemførelsen af overvågningsprogrammer og til udelukkelse af mistanke om eller bekræftelse af forekomst af de listeopførte sygdomme. Mens der også vil være behov for i visse tilfælde at kunne anvende alternative metoder og procedurer, bør det beskrives og i et vist omfang videnskabeligt forklares, hvornår og hvordan de alternative metoder vil kunne anvendes. Dette er især nødvendigt for de mere detaljerede diagnostiske procedurer.(5) | À cet égard, le manuel aquatique énumère, pour un grand nombre des maladies répertoriées, plusieurs tests et procédures à utiliser aux fins des examens de laboratoire. Afin d'uniformiser, à l'échelle de l'Union, la base scientifique utilisée pour le diagnostic des maladies répertoriées, il est nécessaire de désigner, parmi les tests et procédures de diagnostic recommandés par l'OIE, ceux qui devraient être obligatoires aux fins des examens de laboratoire à réaliser dans le cadre des programmes de surveillance ainsi que pour écarter une suspicion de maladie répertoriée ou confirmer la présence d'une telle maladie. Comme il sera également nécessaire, dans certains cas, de disposer de méthodes et de procédures de substitution, il convient que des descriptions et des explications scientifiques sur les conditions et les modalités d'application de ces méthodes de substitution soient fournies, surtout en ce qui concerne les procédures de diagnostic détaillées.
(6) | In order to produce precise and reproducible diagnostic results, it is important that the detailed procedures and protocols to be used are validated in accordance with the relevant quality standards referred to in Part I of Annex VI to Directive 2006/88/EC. For many of the diagnostic methods provided for in this Decision, the use of commercial test kits is a necessary part of the diagnostic protocols and those test kits have been validated in accredited tests by the European Reference laboratories (EURL) for the respective diseases. In the interest of legal certainty, the commercial names of those validated commercial test kits should be referred to in this Decision.(6) | Med henblik på at sikre nøjagtige og reproducerbare diagnostiske resultater er det vigtigt, at de nærmere beskrevne procedurer og protokoller, der skal anvendes, er valideret i overensstemmelse med de relevante kvalitetsstandarder som omhandlet i del I i bilag VI til direktiv 2006/88/EF. For mange af de diagnosemetoder, der er omhandlet i denne afgørelse, er anvendelse af kommercielle testkit en nødvendig del af de diagnostiske protokoller, og disse testkit er blevet valideret i akkrediterede prøvninger af EU-referencelaboratorierne for de respektive sygdomme. Af hensyn til retssikkerheden bør der i denne afgørelse henvises til de kommercielle navne på disse validerede kommercielle testkit.(6) | Aux fins de l'obtention de diagnostics précis et reproductibles, il importe que les procédures et protocoles détaillés à utiliser soient validés conformément aux normes de qualité pertinentes visées à l'annexe VI, partie I, de la directive 2006/88/CE. Dans un grand nombre des méthodes de diagnostic établies par la présente décision, l'utilisation de kits de diagnostic disponibles dans le commerce est une composante nécessaire des protocoles, et ces kits de diagnostic ont été validés lors d'essais menés dans le cadre de l'accréditation par les laboratoires de référence de l'Union pour les différentes maladies. Pour des raisons de sécurité juridique, la dénomination commerciale des kits de diagnostic qui ont été validés devrait être utilisée dans la présente décision.
(7) | It may be difficult for certain Member States to achieve disease-free status for the whole of the Member State or for a zone or compartment thereof with regard to one or more of the listed diseases. In such situations the Member State may wish not to obtain or regain disease-free status for those listed diseases. The minimum control measures to be applied in cases where the Member State concerned does not wish to obtain or regain disease-free status, should be the same at Union level and should follow the same criteria. It is therefore necessary in accordance with Directive 2006/88/EC to lay down detailed rules for the containment of those listed diseases and the minimum requirements for the lifting of those containment measures.(7) | Det kan være vanskeligt for visse medlemsstater at opnå status som sygdomsfri for hele medlemsstaten eller for en zone eller et segment deri for så vidt angår en eller flere af de listeopførte sygdomme. Medlemsstaten vil i sådanne situationer kunne foretrække ikke at opnå eller generhverve status som sygdomsfri for de pågældende listeopførte sygdomme. De minimumsbekæmpelsesforanstaltninger, der skal gennemføres, i tilfælde af at den pågældende medlemsstat ikke ønsker at opnå eller generhverve status som sygdomsfri, bør være de samme i hele EU og bør opfylde de samme kriterier. Det er derfor nødvendigt i overensstemmelse med direktiv 2006/88/EF at fastlægge nærmere regler vedrørende hindring af spredning af de pågældende listeopførte sygdomme og minimumsbetingelser for ophævelse af de pågældende foranstaltninger mod spredning af sygdom.(7) | Il se peut que certains États membres éprouvent des difficultés à obtenir, pour une ou plusieurs des maladies répertoriées, le statut «indemne de maladie» à l'échelle de l'État membre ou pour une zone ou un compartiment de celui-ci. En pareille situation, l'État membre peut souhaiter ne pas obtenir ou ne pas retrouver le statut «indemne» pour ces maladies répertoriées. Les mesures minimales de lutte à appliquer dans les cas où l'État membre concerné ne souhaite pas obtenir ou retrouver le statut «indemne» devraient être identiques dans toute l'Union et respecter les mêmes critères. Il est donc nécessaire, conformément à la directive 2006/88/CE, de fixer des modalités de confinement pour empêcher la propagation de ces maladies répertoriées, et de définir les conditions minimales requises pour la levée de ces mesures de confinement.
(8) | Commission Decision 2001/183/EC (2) lays down the requirements concerning sampling plans and diagnostic methods for the detection and confirmation of the listed diseases infectious haematopoietic necrosis and viral haemorrhagic septicaemia. Commission Decision 2003/466/EC (3) lays down requirements concerning sampling plans and diagnostic methods for the detection of infectious salmon anaemia, as well as criteria for zoning and official surveillance following suspicion and confirmations of the presence of that disease. Commission Decision 2002/878/EC (4) lays down the requirements concerning the sampling plans and the diagnostic methods for the detection and confirmation of the mollusc diseases Bonamiosis and Marteiliosis. In order to update the requirements, those three Decisions should be replaced by this Decision. Accordingly, Decision 2001/183/EC, Decision 2002/878/EC and Decision 2003/466/EC should be repealed.(8) | Ved Kommissionens beslutning 2001/183/EF (2) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning og bekræftelse af de listeopførte sygdomme infektiøs hæmatopoietisk nekrose og viral hæmoragisk septikæmi. Ved Kommissionens beslutning 2003/466/EF (3) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning af infektiøs lakseanæmi samt kriterier for etablering af zoner og officielt tilsyn ved mistanke om og bekræftet forekomst af denne sygdom. Ved Kommissionens beslutning 2002/878/EF (4) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning og bekræftelse af bløddyrsygdommene bonamiose og marteiliose. Med henblik på at få opdateret kravene bør disse tre beslutninger ophæves og afløses af denne afgørelse. Beslutning 2001/183/EF, 2002/878/EF og 2003/466/EF bør således ophæves.(8) | La décision 2001/183/CE de la Commission (2) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection et la confirmation de la nécrose hématopoïétique infectieuse et de la septicémie hémorragique virale, qui font partie des maladies répertoriées. La décision 2003/466/CE de la Commission (3) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection de l'anémie infectieuse du saumon, ainsi que les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de cette maladie. La décision 2002/878/CE de la Commission (4) fixe les exigences relatives aux plans d'échantillonnage et aux méthodes de diagnostic pour la détection et la confirmation de la bonamiose et de la marteiliose, qui sont des maladies des mollusques. Afin d'actualiser ces exigences, ces trois décisions devraient être remplacées par la présente décision. Les décisions 2001/183/CE, 2002/878/CE et 2003/466/CE devraient dès lors être abrogées.
(9) | As certain Member States require time to update their national reference laboratories in order to comply with the requirements laid down in this Decision, it should apply from 1 April 2016.(9) | Eftersom visse medlemsstater har brug for tid til at opdatere deres nationale referencelaboratorier for at kunne opfylde de krav, der fastsættes ved denne afgørelse, bør denne finde anvendelse fra den 1. april 2016.(9) | Certains États membres ayant besoin de temps pour permettre à leurs laboratoires nationaux de référence de s'adapter afin de se conformer aux exigences de la présente décision, celle-ci devrait être applicable à partir du 1er avril 2016.
(10) | The measures laid down in this Decision are in accordance with the opinion of the Standing Committee on Plants, Animals, Food and Feed,(10) | Foranstaltningerne i denne afgørelse er i overensstemmelse med udtalelse fra Den Stående Komité for Planter, Dyr, Fødevarer og Foder —(10) | Les mesures prévues à la présente décision sont conformes à l'avis du comité permanent des végétaux, des animaux, des denrées alimentaires et des aliments pour animaux,
HAS ADOPTED THIS DECISION:VEDTAGET DENNE AFGØRELSE:A ADOPTÉ LA PRÉSENTE DÉCISION:
Article 1Artikel 1Article premier
Subject matterFormålObjet
This Decision lays down rules for the following:Ved denne afgørelse fastsættes der regler for følgende:La présente décision établit des règles concernant:
(a) | the surveillance, buffer zones, sampling and diagnostic methods to be used by Member States in connection with the disease status of the Member States or zones or compartments thereof for the non-exotic aquatic animal diseases listed in Part II to Annex IV to Directive 2006/88/EC (the ‘listed diseases’);a) | den overvågning, de stødpudezoner, den prøveudtagning og de diagnosemetoder, der skal anvendes af medlemsstaterne i forbindelse med sygdomsstatussen for medlemsstater eller zoner eller segmenter deri for de ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (i det følgende benævnt »listeopførte sygdomme«)a) | la surveillance, les zones tampons, les méthodes d'échantillonnage et de diagnostic à utiliser par les États membres en rapport avec leur statut sanitaire ou celui de zones ou compartiments de ceux-ci en ce qui concerne les maladies non exotiques des animaux aquatiques énumérées à l'annexe IV, partie II, de la directive 2006/88/CE (ci-après dénommées les «maladies répertoriées»);
(b) | the diagnostic methods to be used for laboratory examinations in the case of the suspicion or confirmation of the presence of listed diseases; andb) | de diagnosemetoder, der skal anvendes til laboratorieundersøgelser i tilfælde af mistanke om eller bekræftet forekomst af listeopførte sygdommeb) | les méthodes de diagnostic à utiliser pour les examens de laboratoire en cas de suspicion ou de confirmation de la présence de maladies répertoriées et
(c) | the minimum control measures to be applied in the event of the suspicion or confirmation of a listed disease in a Member State, zone or compartment not declared free of that listed disease.c) | de minimumsbekæmpelsesforanstaltninger, der skal gennemføres, i tilfælde af mistanke om eller bekræftelse af en listeopført sygdom i en medlemsstat, en zone eller et segment, der ikke er erklæret fri(t) for den pågældende listeopførte sygdom.c) | les mesures minimales de lutte à mettre en œuvre en cas de présence suspectée ou confirmée d'une maladie répertoriée dans un État membre, une zone ou un compartiment non déclarés indemnes de cette maladie.
Article 2Artikel 2Article 2
DefinitionsDefinitionerDéfinitions
For the purpose of this Decision, the following definitions shall apply:I denne afgørelse forstås ved:Aux fins de la présente décision, on entend par:
(a) | ‘viral haemorrhagic septicaemia’ (‘VHS’) means a disease caused by the viral haemorrhagic septicaemia virus (VHSV), also known as the Egtved virus, a virus belonging to the genus Novirhabdovirus, within the family Rhabdoviridae;a)   »viral hæmoragisk septikæmi« (»VHS«): en sygdom forårsaget af viral hæmoragisk septikæmi-virus (VHSV), også kendt som Egtved-virus, som er et virus tilhørende slægten Novirhabdovirus i familien Rhabdoviridaea) | «septicémie hémorragique virale (SHV)», une maladie causée par le virus de la septicémie hémorragique virale (VSHV), également dénommé virus d'Egtved, qui appartient au genre Novirhabdovirus et à la famille des Rhabdoviridae;
(b) | ‘infectious haematopoietic necrosis’ (‘IHN’) means a disease caused by infectious hematopoietic necrosis virus (IHNV), a virus belonging to the genus Novirhabdovirus, within the family Rhabdoviridae;b)   »infektiøs hæmatopoietisk nekrose« (»IHN«): en sygdom forårsaget af infektiøs hæmatopoietisk nekrose-virus (IHNV), som er et virus tilhørende slægten Novirhabdovirus i familien Rhabdoviridaeb) | «nécrose hématopoïétique infectieuse (NHI)», une maladie causée par le virus de la nécrose hématopoïétique infectieuse (VNHI), qui appartient au genre Novirhabdovirus et à la famille des Rhabdoviridae;
(c) | ‘koi herpesvirus disease’ (‘KHVD’) means a disease caused by koi herpesvirus (KHV), which belongs to the family of Alloherpesviridae. The scientific name is cyprinid herpesvirus 3 (CyHV-3);c)   »koi-herpesvirus-sygdom« (»KHVD«): en sygdom forårsaget af koi-herpesvirus (KHV), som tilhører familien Alloherpesviridae. Det videnskabelige navn er cyprinid herpesvirus 3 (CyHV-3)c) | «herpèsvirose de la carpe koï (HVCK)», une maladie causée par l'herpèsvirus koï (HVK), qui appartient à la famille des Alloherpesviridae et dont le nom scientifique est «herpèsvirus cyprin 3» (CyHV-3);
(d) | ‘infectious salmon anaemia’ (‘ISA’) means a disease caused by infection with highly polymorphic region (HPR)-deleted salmon anaemia virus (ISAV), a virus belonging to the genus Isavirus, within the family Orthomyxoviridae;d)   »infektiøs lakseanæmi« (»ISA«): en sygdom forårsaget af infektion med highly polymorphic region-deleteret (HPR-deleteret) lakseanæmivirus (ISAV), som er et virus tilhørende slægten Isavirus i familien Orthomyxoviridaed) | «anémie infectieuse du saumon (AIS)», une maladie causée par une infection par des variants délétés dans la région hautement polymorphe (RHP) du virus de l'AIS (VAIS), qui appartient au genre Isavirus et à la famille des Orthomyxoviridae;
(e) | ‘infection with Marteilia refringens’ means a disease caused by an infection with the paramyxean protozoan Marteilia refringens;e)   »infektion med Marteilia refringens«: en sygdom forårsaget af infektion med Marteilia refringens, som er et protozo tilhørende Paramyxeae) | «infection à Marteilia refringens», une infection causée par le protozoaire Marteilia refringens, qui appartient au phylum des Paramyxea;
(f) | ‘infection with Bonamia ostreae’ means a disease caused by an infection with the haplosporidian protozoan Bonamia ostreae;f)   »infektion med Bonamia ostreae«: en sygdom forårsaget af infektion med Bonamia ostreae, som er et protozo tilhørende Haplosporidiaf) | «infection à Bonamia ostreae», une infection causée par le protozoaire Bonamia ostreae, qui appartient au phylum des Haplosporidia;
(g) | ‘white spot disease’ (‘WSD’) means a disease caused by white spot syndrome virus (WSSV), which is a double stranded DNA virus of the genus Whispovirus, in the family Nimaviridae.g)   »white spot disease« (»WSD«): en sygdom forårsaget af white spot syndrome-virus (WSSV), som er et dobbeltstrenget DNA-virus, der tilhører slægten Whispovirus i familien Nimaviridae.g) | «maladie des points blancs (MPB)», une maladie causée par le virus du syndrome des points blancs (VSPB), qui est un virus à ADN double brin qui appartient au genre Whispovirus et à la famille des Nimaviridae.
Article 3Artikel 3Article 3
Minimum requirements for eradication and surveillance programmesMinimumskrav for udryddelses- og overvågningsprogrammerExigences minimales relatives aux programmes d'éradication et de surveillance
Member States shall ensure that the rules on surveillance and eradication programmes, buffer zones, sampling and diagnostic methods set out in Annex I and the specific methods and detailed procedures set out in Annex II are complied with, when disease-free status is to be granted, withdrawn or restored for a Member State or for a zone or compartment thereof for one or more of the listed diseases.Medlemsstaterne sikrer, at de regler vedrørende overvågnings- og udryddelsesprogrammer, stødpudezoner, prøveudtagning og diagnosemetoder, der er fastsat i bilag I, og de specifikke metoder og detaljerede procedurer, der er fastsat i bilag II, overholdes, når status som sygdomsfri skal indrømmes, trækkes tilbage eller generhverves for en medlemsstat eller en zone eller et segment deri for så vidt angår en eller flere af de listeopførte sygdomme.Les États membres veillent à ce que les règles relatives aux programmes de surveillance et d'éradication, aux zones tampons, aux méthodes d'échantillonnage et de diagnostic énoncées à l'annexe I, ainsi qu'aux méthodes spécifiques et aux procédures détaillées énoncées à l'annexe II soient respectées en cas d'octroi, de retrait ou de rétablissement, pour une ou plusieurs des maladies répertoriées, du statut «indemne de maladie» pour un État membre ou une zone ou compartiment de celui-ci.
Article 4Artikel 4Article 4
Minimum requirements for diagnostic methods and specific proceduresMinimumskrav for diagnosemetoder og specifikke procedurerExigences minimales relatives aux méthodes et aux procédures spécifiques de diagnostic
Member States shall ensure that the control methods set out in Annex I and the specific diagnostic methods and detailed procedures set out in Annex II are complied with, when laboratory examinations are carried out in order to confirm or rule out the presence of a listed disease.Medlemsstaterne sikrer, at bekæmpelsesmetoderne i bilag I og de særlige diagnosemetoder og detaljerede procedurer i bilag II følges, når der udføres laboratorieundersøgelser for at bekræfte eller udelukke forekomst af en listeopført sygdom.Les États membres veillent à ce que les méthodes de lutte figurant à l'annexe I, ainsi que les méthodes spécifiques et procédures détaillées de diagnostic énoncées à l'annexe II soient respectées lors des examens de laboratoire réalisés en vue de confirmer ou d'exclure la présence d'une maladie répertoriée.
Article 5Artikel 5Article 5
Minimum control measures for the containment of listed diseases and minimum requirements for the lifting of containment measures in Member States, zones or compartments not declared free of listed diseasesMinimumsbekæmpelsesforanstaltninger for hindring af spredning af listeopførte sygdomme og minimumskrav vedrørende ophævelse af foranstaltninger mod spredning af sygdom i medlemsstater, zoner eller segmenter, som ikke er erklæret frie for listeopførte sygdommeMesures minimales de lutte contre les maladies répertoriées et exigences minimales pour la levée des mesures de confinement dans des État membres, des zones ou des compartiments non déclarés indemnes de maladies répertoriées
Member States shall ensure that the minimum control measures and minimum requirements for the lifting of containment measures set out in Annex I are complied with, when carrying out control measures and the lifting of containment measures for one or more of the listed diseases in a Member State or in a zone or compartment thereof not declared free of those listed diseases.Medlemsstaterne sikrer, at minimumsbekæmpelsesforanstaltningerne og minimumskravene vedrørende ophævelse af foranstaltninger mod spredning af sygdom i bilag I overholdes, når bekæmpelsesforanstaltninger gennemføres og foranstaltninger mod spredning af sygdom ophæves for en eller flere af de listeopførte sygdomme i en medlemsstat eller en zone eller et segment deri, som ikke er erklæret fri(t) for de pågældende listeopførte sygdomme.Les États membres veillent à ce que les mesures minimales de lutte et les exigences minimales pour la levée des mesures de confinement énoncées à l'annexe I soient respectées lors de la mise en œuvre de mesures de lutte et de la levée des mesures de confinement à l'égard d'une ou plusieurs maladies répertoriées dans un État membre ou dans une zone ou un compartiment non déclarés indemnes de ces maladies.
Article 6Artikel 6Article 6
RepealsOphævelseAbrogations
Decisions 2001/183/EC, 2002/878/EC and 2003/466/EC are repealed.Beslutning 2001/183/EF, 2002/878/EF og 2003/466/EF ophæves.Les décisions 2001/183/CE, 2002/878/CE et 2003/466/CE sont abrogées.
Article 7Artikel 7Article 7
Date of applicationAnvendelsesdatoDate de mise en application
This Decision shall apply from 1 April 2016.Denne afgørelse anvendes fra den 1. april 2016.La présente décision est applicable à partir du 1er avril 2016.
Article 8Artikel 8Article 8
AddressesAdressaterDestinataires
This Decision is addressed to the Member States.Denne afgørelse er rettet til medlemsstaterne.Les États membres sont destinataires de la présente décision.
Done at Brussels, 11 September 2015.Udfærdiget i Bruxelles, den 11. september 2015.Fait à Bruxelles, le 11 septembre 2015.
For the CommissionPå Kommissionens vegnePar la Commission
Vytenis ANDRIUKAITISVytenis ANDRIUKAITISVytenis ANDRIUKAITIS
Member of the CommissionMedlem af KommissionenMembre de la Commission
(1)  OJ L 328, 24.11.2006, p. 14.(1)  EUT L 328 af 24.11.2006, s. 14.(1)  JO L 328 du 24.11.2006, p. 14.
(2)  Commission Decision 2001/183/EC of 22 February 2001 laying down the sampling plans and diagnostic methods for the detection and confirmation of certain fish diseases and repealing Decision 92/532/EEC (OJ L 67, 9.3.2001, p. 65).(2)  Kommissionens beslutning 2001/183/EF af 22. februar 2001 om fastlæggelse af prøveudtagningsplaner for og diagnosticeringsmetoder til påvisning og bekræftelse af visse fiskesygdomme og om ophævelse af beslutning 92/532/EØF (EFT L 67 af 9.3.2001, s. 65).(2)  Décision 2001/183/CE de la Commission du 22 février 2001 fixant les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de certaines maladies des poissons et abrogeant la décision 92/532/CEE (JO L 67 du 9.3.2001, p. 65).
(3)  Commission Decision 2003/466/EC of 13 June 2003 establishing criteria for zoning and official surveillance following suspicion or confirmation of the presence of infectious salmon anaemia (ISA) (OJ L 156, 25.6.2003, p. 61).(3)  Kommissionens beslutning 2003/466/EF af 13. juni 2003 om kriterier for etablering af zoner og officielt tilsyn ved mistanke om eller bekræftet forekomst af infektiøs lakseanæmi (ISA) (EUT L 156 af 25.6.2003, s. 61).(3)  Décision 2003/466/CE de la Commission du 13 juin 2003 établissant les critères de zonage et les mesures de surveillance officielle à adopter après suspicion ou confirmation de la présence de l'anémie infectieuse du saumon (AIS) (JO L 156 du 25.6.2003, p. 61).
(4)  Commission Decision 2002/878/EC of 6 November 2002 establishing the sampling plans and diagnostic methods for the detection and confirmation of the presence of the mollusc diseases Bonamiosis (Bonamia ostreae) and Marteiliosis (Marteilia refringens) (OJ L 305, 7.11.2002, p. 57).(4)  Kommissionens beslutning 2002/878/EF af 6. november 2002 om prøveudtagningsplaner og diagnosticeringsmetoder til påvisning og bekræftelse af bløddyrsygdommene bonamiose (Bonamia ostreae) og marteiliose (Marteilia refringens) (EFT L 305 af 7.11.2002, s. 57).(4)  Décision 2002/878/CE de la Commission du 6 novembre 2002 établissant les plans d'échantillonnage et les méthodes de diagnostic pour la détection et la confirmation de la présence de deux maladies des mollusques, la bonamiose (Bonamia ostreae) et la marteiliose (Marteilia refringens) (JO L 305 du 7.11.2002, p. 57).
ANNEX IBILAG IANNEXE I
SURVEILLANCE AND CONTROL METHODSOVERVÅGNING OG BEKÆMPELSESMETODERSURVEILLANCE ET MÉTHODES DE LUTTE
I.   IntroductionI.   IndledningI.   Introduction
This Annex sets out:I dette bilag fastsættes:La présente annexe établit:
(a) | requirements for eradication and surveillance programmes, as provided for in Article 44 of Directive 2006/88/EC, and the sampling and diagnostic methods to be used to declare disease-free status for Member States or zones or compartments thereof as provided for in Chapter VII of that Directive;a) | krav vedrørende udryddelses- og overvågningsprogrammer, jf. artikel 44 i direktiv 2006/88/EF, samt de prøveudtagnings- og diagnosemetoder, der skal anvendes med henblik på at indrømme medlemsstater eller zoner eller segmenter deri status som sygdomsfri, jf. kapitel VII i samme direktiva) | les exigences relatives aux programmes d'éradication et de surveillance prévus à l'article 44 de la directive 2006/88/CE, ainsi que les méthodes d'échantillonnage et de diagnostic à utiliser pour déclarer «indemnes de maladie» des États membres ou des zones ou compartiments de ceux-ci, conformément aux dispositions du chapitre VII de ladite directive;
(b) | sampling and diagnostic methods to be used for laboratory examinations in the case of the suspicion of and to confirm the presence of the non-exotic diseases listed in Part II of Annex IV to Directive 2006/88/EC (the ‘listed diseases’) as provided for in Articles 28(a) and 57(b) of that Directive;b) | de prøveudtagnings- og diagnosemetoder, der skal anvendes til laboratorieundersøgelser, som skal udføres i tilfælde af mistanke om eller med henblik på at bekræfte forekomst af de ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (»listeopførte sygdomme«), jf. artikel 28, litra a), og artikel 57, litra b), i samme direktivb) | les méthodes d'échantillonnage et de diagnostic à utiliser pour les examens de laboratoire en cas de suspicion d'une ou plusieurs des maladies non exotiques répertoriées à l'annexe IV, partie II, de la directive 2006/88/CE (ci-après les «maladies répertoriées») ou pour confirmer la présence de telles maladies, conformément à l'article 28, point a), et à l'article 57, point b), de ladite directive;
(c) | the containment measures to be taken in the case of confirmation of the presence of a listed disease, as provided for in Article 39 of Directive 2006/88/EC, and the measures to be taken in order to obtain Category III health status for a Member State, zone or compartment that has Category V health status.c) | de foranstaltninger mod spredning af sygdom, der skal træffes i tilfælde af bekræftet forekomst af en listeopført sygdom, jf. artikel 39 i direktiv 2006/88/EF, og de foranstaltninger, der skal træffes, for at en medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V, opnår en sundhedsstatus i kategori III.c) | les mesures de confinement à prendre en cas de confirmation de la présence d'une maladie répertoriée, conformément à l'article 39 de la directive 2006/88/CE, et les mesures à prendre en vue de l'obtention d'un statut sanitaire de catégorie III pour un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V.
The requirements set out in this Annex cover the following listed diseases:Kravene i bilaget omfatter følgende listeopførte sygdomme:Les exigences établies dans la présente annexe concernent les maladies répertoriées suivantes:
1. | Viral haemorrhagic septicaemia (VHS) | Part 11. | Viral hæmoragisk septikæmi (VHS) | Del 11. | la septicémie hémorragique virale (SHV) | Partie 1
2. | Infectious haematopoietic necrosis (IHN) | Part 12. | Infektiøs hæmatopoietisk nekrose (IHN) | Del 12. | la nécrose hématopoïétique infectieuse (NHI) | Partie 1
3. | Koi herpesvirus (KHV) disease | Part 23. | Koi-herpesvirus-sygdom (KHV) | Del 23. | l'herpèsvirose de la carpe koï (HVCK) | Partie 2
4. | Infectious salmon anaemia (ISA) | Part 34. | Infektiøs lakseanæmi (ISA) | Del 34. | l'anémie infectieuse du saumon (AIS) | Partie 3
5. | Infection with Marteilia refringens | Part 45. | Infektion med Marteilia refringens | Del 45. | l'infection à Marteilia refringens | Partie 4
6. | Infection with Bonamia ostreae | Part 56. | Infektion med Bonamia ostreae | Del 56. | l'infection à Bonamia ostreae | Partie 5
7. | White spot disease (WSD) | Part 67. | White spot disease (WSD) | Del 67. | la maladie des points blancs (MPB) | Partie 6
II.   DefinitionsII.   DefinitionerII.   Définitions
For the purpose of Annex I and II, the following definitions shall apply:I bilag I og II forstås ved:Aux fins des annexes I et II, on entend par:
(a) | ‘continental compartment’ means one or more farm(s) situated on the continental part of one or more Member State(s), being under a common biosecurity system and containing an aquatic animal population with a distinct health status with respect to a specific disease;a)   »indlandssegment«: et eller flere akvakulturbrug beliggende i indlandsområdet i en eller flere medlemsstater, tilhørende samme biosikkerhedssystem og med en population af akvatiske dyr med en bestemt sundhedsstatus med hensyn til en given sygdoma)   «compartiment continental»: une ou plusieurs fermes aquacoles situées dans la partie continentale du territoire d'un ou de plusieurs États membres, qui relèvent d'un dispositif commun de biosécurité et abritent une population d'animaux aquatiques dotée d'un statut zoosanitaire qui lui est propre au regard d'une maladie particulière;
(b) | ‘continental farm’ means a farm keeping aquaculture animals situated on the continental part of the territory of one Member State;b)   »indlandsbrug«: et akvakulturbrug med hold af akvakulturdyr beliggende i en medlemsstats indlandsområdeb)   «ferme aquacole continentale»: une ferme aquacole située dans la partie continentale du territoire d'un État membre;
(c) | ‘continental zone’ means a precise geographic area situated on the continental part of one or more Member State(s) with a homogenous hydrological system comprising parts of a water catchment area from the source(s) to a natural or artificial barrier that prevents the upward migration of aquatic animals from lower stretches of the water catchment area, an entire water catchment area from its source(s) to its estuary, or more than one water catchment area, including their estuaries, due to the epidemiological link between the catchment areas through the estuary;c)   »indlandszone«: et klart defineret geografisk område beliggende i indlandsområdet i en eller flere medlemsstater med et homogent hydrologisk system, som omfatter dele af et afvandingsområde fra vandløbenes kilder til en naturlig eller kunstig forhindring, der standser akvatiske dyrs vandring opstrøms fra de lavereliggende dele af afvandingsområdet, et helt afvandingsområde fra vandløbenes kilder til udmundingen i havet eller flere afvandingsområder, inkl. deres udmunding i havet, idet afvandingsområderne er epidemiologisk forbundet via udmundingsområdetc)   «zone continentale»: un secteur géographique précis situé dans la partie continentale du territoire d'un ou de plusieurs États membres, caractérisé par un système hydrographique homogène comprenant des parties de bassin hydrographique (depuis la ou les sources jusqu'à une barrière naturelle ou artificielle empêchant toute remontée d'animaux aquatiques à partir des parties du bassin situées en aval), un bassin hydrographique entier (depuis la ou les sources jusqu'à l'estuaire) ou encore plusieurs bassins hydrographiques, estuaires compris, en raison du lien épidémiologique qui existe entre les bassins hydrographiques au travers de l'estuaire;
(d) | ‘officially declared infected farm’ means a farm keeping aquatic animals where one or more of the listed diseases has been confirmed by the competent authority in accordance Articles 28(a), Article 29 and Article 57(b) of Directive 2006/88/EC.d)   »akvakulturbrug, der officielt er erklæret inficeret«: et akvakulturbrug med hold af akvatiske dyr, hvor en eller flere af de listeopførte sygdomme er blevet bekræftet af den kompetente myndighed i overensstemmelse med artikel 28, litra a), artikel 29 og artikel 57, litra b), i direktiv 2006/88/EFd)   «ferme aquacole officiellement déclarée infectée»: une ferme aquacole dans laquelle la présence d'une ou de plusieurs des maladies répertoriées a été confirmée par l'autorité compétente, conformément à l'article 28, point a), à l'article 29 et à l'article 57, point b), de la directive 2006/88/CE.
(e) | ‘contact farm’ means a farm keeping aquatic animals which in any way is demonstrated or strongly suspected to have been contaminated by infectious material from an officially declared infected farm.e)   »kontaktbrug«: et akvakulturbrug med hold af akvatiske dyr, på hvilket der på en eller anden måde er påvist eller er stærk mistanke om kontaminering med inficeret materiale fra et akvakulturbrug, der officielt er erklæret inficeret.e)   «ferme aquacole en contact»: une ferme aquacole qui, de toute évidence, a été contaminée par du matériel infectieux provenant d'une ferme aquacole officiellement déclarée infectée, ou qui est fortement suspectée d'avoir été ainsi contaminée.
PART 1DEL 1PARTIE 1
SURVEILLANCE AND CONTROL METHODS FOR VIRAL HAEMORRHAGIC SEPTICAEMIA (VHS) AND INFECTIOUS HEMATOPOIETIC NECROSIS (IHN)OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR VIRAL HÆMORAGISK SEPTIKÆMI (VHS) OG INFEKTIØS HÆMATOPOIETISK NEKROSE (IHN)SURVEILLANCE DE LA SEPTICÉMIE HÉMORRAGIQUE VIRALE (SHV) ET DE LA NÉCROSE HÉMATOPOÏÉTIQUE INFECTIEUSE (NHI) ET MÉTHODES DE LUTTE CONTRE CES MALADIES
I.   Requirements for surveillance and eradication programmes to obtain and maintain disease free-health statuses with regard to VHS and IHN and containment measures for those listed diseasesI.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår VHS og IHN og foranstaltninger mod spredning af disse listeopførte sygdommeI.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la SHV et la NHI ainsi que des mesures de confinement destinées à lutter contre ces maladies répertoriées
I.1.   General requirements for health inspections and sampling for VHS and IHN:I.1.   Generelle krav til sundhedsinspektioner og prøveudtagning for så vidt angår VHS og IHN:I.1.   Exigences générales relatives aux inspections sanitaires et à l'échantillonnage en ce qui concerne la SHV et la NHI:
(a) | the health inspections and, where appropriate, the sampling shall be carried out during the period of the year when the water temperature is below 14 °C or whenever the water temperature is likely to reach its lowest annual points;a) | Sundhedsinspektionerne og, hvis det er relevant, prøveudtagningen skal foretages på den tid af året, hvor vandtemperaturen er under 14 °C, eller hvor vandtemperaturen forventes at være lavest.a) | les inspections sanitaires et, s'il y a lieu, l'échantillonnage doivent être effectués pendant la période de l'année où la température de l'eau est inférieure à 14 °C ou à tout moment, lorsque la température de l'eau est susceptible d'atteindre les minima annuels;
(b) | when targeted surveillance in wild populations is required in accordance with the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the number and geographical distribution of sampling points shall be determined to obtain a reasonable coverage of the Member State, zone or compartment. The sampling points shall be representative of the different ecosystems where wild populations of susceptible species are located;b) | Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende populationer af modtagelige arter.b) | lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent être représentatifs des différents écosystèmes abritant des populations sauvages des espèces sensibles;
(c) | when farms or wild populations are to be subject to health inspections or sampled more than once per year, the intervals between the health inspections and between the collection of samples shall be at least 4 months and as long as possible, taking into account the temperature requirements provided for in point (a);c) | Hvis akvakulturbrug eller vildtlevende populationer skal være omfattet af sundhedsinspektioner eller prøveudtagninger mere end én gang om året, skal der være så lang tid som muligt og mindst fire måneder mellem sundhedsinspektionerne og mellem udtagningen af prøverne, idet der tages hensyn til temperaturkravene i litra a).c) | lorsque des fermes aquacoles ou des populations sauvages doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires ou d'échantillonnages, l'intervalle entre les inspections sanitaires et entre chaque prélèvement d'échantillons doit être d'au moins quatre mois et doit être aussi long que possible compte tenu des conditions de température définies au point a);
(d) | all production units, such as ponds, tanks and net cages, shall be subject to health inspections for the presence of dead, weak or abnormally behaving fish. Particular attention shall be paid to the water outlet area where weak fish tend to accumulate because of the water current;d) | Alle produktionsenheder som f.eks. damme, tanke og netbure skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd. Opmærksomheden skal navnlig rettes mod vandudledningsområdet, hvor de svage fisk har tendens til at samles på grund af vandstrømmen.d) | toutes les unités de production, telles que les étangs, les viviers et les cages en filet doivent faire l'objet d'inspections sanitaires destinées à établir la présence de poissons morts, faibles ou au comportement anormal. Une attention particulière doit être accordée au point d'évacuation des eaux, où les poissons faibles ont tendance à s'accumuler en raison du courant;
(e) | fish of susceptible species to be collected as samples shall be selected as follows: | (i) | if rainbow trout are present, only fish of that species shall be selected for sampling, except where other susceptible species are present which show typical signs of VHS or IHN; if rainbow trout are not present, the sample must be representative of all other susceptible species which are present; | (ii) | if weak, abnormally behaving or freshly dead but not decomposed fish are present, such fish shall be selected; if more than one water source is utilised for fish production, fish representing all water sources shall be included in the sample; | (iii) | the fish selected shall include fish collected in such a way that all parts of the farm, as well as all year classes, are proportionally represented in the sample.e) | Fisk af modtagelige arter, som skal indsamles som prøver, udvælges på følgende måde: | i) | Hvis der forekommer regnbueørred, må kun fisk af denne art udvælges til prøveudtagning, undtagen hvis der forekommer andre modtagelige arter med typiske tegn på VHS eller IHN; hvis der ikke forekommer regnbueørred, skal prøven være repræsentativ for alle andre modtagelige arter på stedet. | ii) | Hvis der forekommer svage fisk, fisk med unormal adfærd eller nyligt døde fisk (som ikke er gået i opløsning), skal disse udvælges; ved benyttelse af mere end én vandkilde til fiskeproduktion skal der medtages fisk fra alle vandkilder i prøven. | iii) | De udvalgte fisk skal omfatte fisk, der er indsamlet på en sådan måde, at alle dele af akvakulturbruget og alle årgange er proportionalt repræsenteret i prøven.e) | les poissons des espèces sensibles devant faire l'objet d'un échantillonnage sont sélectionnés comme suit: | i) | si des truites arc-en-ciel sont présentes, seuls des poissons de cette espèce doivent être sélectionnés pour l'échantillonnage, sauf dans les cas où d'autres espèces sensibles présentant des signes typiques de la SHV ou de la NHI sont présentes; en l'absence de truites arc-en-ciel, l'échantillon doit être représentatif de toutes les autres espèces sensibles présentes; | ii) | en présence de poissons faibles, au comportement anormal ou qui viennent de mourir mais ne sont pas encore décomposés, ces poissons doivent être sélectionnés; si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentant toutes les sources d'eau doivent être inclus dans l'échantillon; | iii) | les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les parties de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.
I.2.   Specific requirements to obtain disease-free health status (category I) with regard to VHS and IHNI.2.   Særlige krav vedrørende opnåelse af status som sygdomsfri (kategori I) for så vidt angår VHS og IHNI.2.   Exigences spécifiques pour l'obtention du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la SHV et la NHI
I.2.1.   Surveillance programmes:I.2.1.   Overvågningsprogrammer:I.2.1.   Programmes de surveillance:
(a) | a Member State, zone or compartment that has Category III health status as referred to in Part B of Annex III to Directive 2006/88/EC with regard to VHS or IHN or both, may achieve Category I health status with regard to those listed diseases provided that all farms keeping susceptible species listed in Part II of Annex IV to that Directive within that Member State, zone or compartment comply with the requirements laid down in Annex V to that Directive and all those farms and, when required by the second paragraph of point 2 of Part I of Annex V thereto, sampling points in wild populations selected in accordance with that Part, have been subject to one of the following surveillance programmes: | (i) | model A — 2-year surveillance programme: | The farms or sampling points must have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 1.A set out in Section II. | During that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 must have produced negative results for either VHS or IHN or both, and any suspicion of either VHS or IHN or both must have been ruled out in accordance with the sampling and diagnostic methods set out in point II.3; | (ii) | model B — 4-year surveillance programme with reduced sample size: | The farms or sampling points must have been subject to health inspections and sampled for a minimum period of four consecutive years as laid down in Table 1.B set out in Section II. | During that 4-year period, the testing of all samples using the diagnostic methods set out in point II.2 must have produced negative results for either VHS or IHN or both and any suspicion of either VHS or IHN or both must have been ruled out in accordance with the sampling and diagnostic methods set out in point II.3;a) | En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår VHS eller IHN eller begge, kan opnå en sundhedsstatus i kategori I for så vidt angår disse listeopførte sygdomme, forudsat at alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i denne medlemsstat, denne zone eller dette segment opfylder kravene i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktivet, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte del, har været omfattet af et af følgende overvågningsprogrammer: | i) | Model A — toårigt overvågningsprogram: | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 1.A i afsnit II. | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for enten VHS eller IHN eller begge, og enhver mistanke om enten VHS eller IHN eller begge skal være blevet udelukket i overensstemmelse med prøveudtagnings- og diagnosemetoderne i punkt II.3. | ii) | Model B — fireårigt overvågningsprogram med reduceret prøvestørrelse: | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst fire på hinanden følgende år som fastsat i tabel 1.B i afsnit II. | I løbet af denne fireårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for enten VHS eller IHN eller begge, og enhver mistanke om enten VHS eller IHN eller begge skal være blevet udelukket i overensstemmelse med prøveudtagnings- og diagnosemetoderne i punkt II.3.a) | un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III tel que visé à l'annexe III, partie B, de la directive 2006/88/CE en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir le statut sanitaire de catégorie I pour ces maladies répertoriées à condition que toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment respectent les exigences fixées à l'annexe V de ladite directive, et que toutes ces fermes aquacoles ainsi que, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de cette directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément à cette partie, aient fait l'objet d'un des programmes de surveillance suivants: | i) | modèle A — programme de surveillance sur deux ans: | Les fermes aquacoles ou les points de prélèvement doivent avoir été soumis à des inspections sanitaires et fait l'objet d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 1.A de la section II. | Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2. doivent s'être révélés négatifs pour la SHV ou la NHI, ou pour les deux, et toute suspicion de SHV ou de NHI doit avoir été écartée conformément aux méthodes d'échantillonnage et de diagnostic établies au point II.3; | ii) | modèle B — programme de surveillance sur quatre ans avec taille d'échantillon réduite | Les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de quatre années consécutives, comme indiqué dans le tableau 1.B de la section II. | Au cours de cette période de quatre ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour la SHV ou la NHI, ou pour les deux, et toute suspicion de SHV ou de NHI, ou des deux maladies, doit avoir été écartée conformément aux méthodes d'échantillonnage et de diagnostic établies au point II.3;
(b) | if during the implementation of the surveillance programme referred to in point (a), infection with either VHS or IHN or both is confirmed in a farm included in that surveillance programme, and therefore the farm's Category II health status has been withdrawn, that farm may immediately regain its Category II health status and continue the implementation of the surveillance programme to obtain disease-free status without implementing an eradication programme as set out in point I.2.2 provided that the farm complies with the following conditions: | (i) | it is a continental farm whose health status regarding either VHS or IHN or both is independent of the health status of aquatic animal populations in the surrounding natural waters as regards those listed diseases in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC; | (ii) | it is emptied, cleansed, disinfected and fallowed; the duration of the fallowing period shall be at least 6 weeks; | (iii) | it has been restocked with fish sourced from Member States, zones or compartments with a Category I health status with regard to either VHS or IHN or both.b) | Hvis det i forbindelse med gennemførelsen af det overvågningsprogram, der er omhandlet i litra a), bekræftes, at der er infektion med enten VHS eller IHN eller begge på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som fastsat i punkt I.2.2, forudsat at bruget opfylder følgende betingelser: | i) | Det er et indlandsbrug, hvis sundhedsstatus vedrørende enten VHS eller IHN eller begge er uafhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder for så vidt angår disse listeopførte sygdomme i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF. | ii) | Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger. | iii) | Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge.b) | si, au cours de la mise en œuvre du programme de surveillance visé au point a), une infection par la SHV ou la NHI, ou par les deux à la fois, est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre un programme d'éradication tel qu'établi au point I.2.2, à condition de satisfaire aux conditions suivantes: | i) | il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne la SHV ou la NHI, ou les deux, est indépendant du statut zoosanitaire des populations d'animaux aquatiques vivant dans les eaux naturelles avoisinantes par rapport à ces maladies répertoriées conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE; | ii) | elle a été vidée de ses poissons, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée; | iii) | elle a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
I.2.2.1.   General requirementsI.2.2.1.   Generelle kravI.2.2.1.   Exigences générales
A Member State, zone or a compartment with Category V health status with regard to either VHS or IHN or both may achieve Category I health status with regard to those listed diseases, provided that all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within that Member State, zone or compartment have been subject to an eradication programme that complies with points (a) to (e):En medlemsstat, en zone eller et segment med en sundhedsstatus i kategori V for så vidt angår enten VHS eller IHN eller begge kan opnå en sundhedsstatus i kategori I for så vidt angår disse listeopførte sygdomme, forudsat at alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af et udryddelsesprogram, som opfylder litra a)-e):Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir un statut sanitaire de catégorie I pour ces maladies répertoriées à condition que toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment aient fait l'objet d'un programme d'éradication conforme aux points a) à e) suivants:
(a) | the minimum control measures laid down in Section 4 of Chapter V of Directive 2006/88/EC must have been effectively applied and a containment area, as referred to in Article 32(b) of that Directive comprising a protection zone and surveillance zone, must have been established in the vicinity of the farm(s) officially declared infected with either VHS or IHN or both those listed diseases. | The containment area must have been defined on a case-by-case basis taking into account factors influencing the risks for the spread of the listed disease to farmed and wild fish, such as: the number, rate and distribution of the mortalities of fish on the farm infected with either VHS or IHN or both; the distance and density of neighbouring farms; the proximity to slaughterhouses; contact farms; species present at the farms; the farming practices applied in the affected farms and in the neighbouring farms to the affected farms; the hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply as regards the geographical demarcation of those zones: | (i) | a protection zone shall be established in the immediate vicinity of a farm officially declared infected with either VHS or IHN or both those listed disease and shall correspond to: | (1) | in coastal areas: an area included in a circle with a radius of at least one tidal excursion or at least 5 km, whichever is larger, centred on the farm officially declared infected with either VHS or IHN or both, or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; | (2) | in inland areas: the entire water catchment area of the farm officially declared infected with VHS or IHN or both; the competent authority may limit the extension of the zone to parts of the water catchment area, or the area of the farm, provided that the prevention of the spread of either VHS or IHN or both is not compromised; | (ii) | a surveillance zone shall be established by the competent authority outside the protection zone and shall correspond to: | (1) | in coastal areas: an area, surrounding the protection zone, of overlapping tidal excursion zones; or an area, surrounding the protection zone, and included in a circle of radius 10 km from the centre of the protection zone; or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; | (2) | in inland areas: as an extended area outside the established protection zone;a) | De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af den listeopførte sygdom til opdrættede og vildtlevende fisk som f.eks.: antallet, procentdelen og fordelingen af døde fisk på det akvakulturbrug, der er inficeret med enten VHS eller IHN eller begge, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på brugene, opdrætspraksis på de berørte akvakulturbrug og på de brug, der ligger nærmest de berørte brug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme, og den skal svare til: | 1) | i kystområder: et område i en cirkel med en radius, der mindst svarer til en tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum i det akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data | 2) | i områder inde i landet: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med VHS eller IHN eller begge; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet eller akvakulturbrugets område, forudsat at dette ikke forringer forebyggelsen af spredningen af enten VHS eller IHN eller begge. | ii) | Den kompetente myndighed skal oprette en overvågningszone uden om beskyttelseszonen, og den skal svare til: | 1) | i kystområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data | 2) | i områder inde i landet: et udvidet område uden om den oprettede beskyttelseszone.a) | les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE doivent avoir été effectivement appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, doit avoir été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par ces deux maladies répertoriées. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de la maladie répertoriée aux poissons d'élevage et aux poissons sauvages, à savoir la mortalité, le taux de mortalité et la distribution de la mortalité dans la ferme aquacole infectée par la SHV ou la NHI, ou par les deux à la fois, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par ces deux maladies répertoriées, et doit correspondre: | 1. | dans les zones côtières: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par les deux, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées; | 2. | à l'intérieur des terres: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par la SHV ou la NHI, ou par les deux à la fois; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique ou de la superficie occupée par la ferme aquacole à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de la SHV ou de la NHI, ou des deux à la fois; | ii) | l'autorité compétente met en place un périmètre de surveillance, qui s'étend au-delà du périmètre de protection et qui correspond: | 1. | dans les zones côtières: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées | 2. | à l'intérieur des terres: à une zone étendue qui se situe au-delà du périmètre de protection établi;
(b) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with either VHS or IHN or both shall be subject to an official investigation comprising at least the following elements: | (i) | the collection of samples for testing of 10 fish, when clinical signs or post-mortem signs consistent with infection with either VHS or IHN or both are observed or minimum 30 fish, when clinical or post-mortem signs are not observed; | (ii) | one health inspection: in those farms where the tests referred to in (i) have produced negative results; health inspections shall continue once per month during the period when the water temperature is below 14 °C, except when fish ponds or net cages are covered with ice, until the protection zone is withdrawn in accordance with point I.2.2.1(c);b) | På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med enten VHS eller IHN eller begge, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer: | i) | indsamling af prøver med henblik på undersøgelse af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med enten VHS eller IHN eller begge, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund | ii) | én sundhedsinspektion: på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater; der skal fortsat foretages sundhedsinspektioner én gang om måneden på den tid af året, hvor vandtemperaturen er under 14 °C, undtagen når fiskedamme eller netbure er dækket med is, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).b) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par la SHV ou la NHI, ou par les deux, doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants: | i) | un prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par la SHV ou la NHI, ou par les deux, ou sur au moins 30 poissons en l'absence de signes cliniques ou de signes post mortem; | ii) | une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une par mois pendant la période durant laquelle la température de l'eau est inférieure à 14 °C, sauf lorsque les étangs ou les cages en filet sont couverts de glace, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);
(c) | all farms officially declared infected with either VHS or IHN or both shall be emptied, cleansed, disinfected and fallowed. The duration of the fallowing period shall be at least 6 weeks. When all farms officially declared infected within the same protection zone are emptied, at least 3 weeks of synchronised fallowing shall be carried out. This paragraph also applies to new farms officially declared infected during the implementation of the eradication programme. | When fallowing of the officially declared infected farms is carried out, the protection zones shall be converted into surveillance zones. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms within the established protection and surveillance zones. The length of the fallowing period for those farms shall be determined by the competent authority following a case-by-case risk evaluation;c) | Alle akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Hvis alle akvakulturbrug, der officielt er erklæret inficeret, inden for samme beskyttelseszone tømmes, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet. | Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse akvakulturbrug skal være udtaget af drift.c) | toutes les fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par les deux, doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'une durée minimale de six semaines doit être observée. Lorsque toutes les fermes aquacoles officiellement déclarées infectées à l'intérieur d'un même périmètre de protection ont été vidées de leurs poissons, un vide sanitaire synchronisé d'au moins trois semaines doit être respecté. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication. | Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. Pour ces fermes, la durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas;
(d) | all farms officially declared infected with either VHS or IHN or both those listed diseases and all other farms fallowed within the established protection and surveillance zones as referred to in point (c), shall be restocked with fish sourced from Member States, zones or compartments with a disease-free health status (Category I) with regard to either VHS or IHN or both. | Restocking shall only take place when all farms officially declared infected have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2.1(c);d) | På alle akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme, og på alle andre akvakulturbrug, der er udtaget af drift, inden for de oprettede beskyttelses- og overvågningszoner, jf. litra c), skal nytilførslen af fisk ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus som sygdomsfri (kategori I) for så vidt angår enten VHS eller IHN eller begge. | Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).d) | toutes les fermes aquacoles officiellement déclarées infectées par la SHV ou la NHI, ou par ces deux maladies répertoriées, ainsi que toutes les autres fermes aquacoles soumises à un vide sanitaire situées à l'intérieur des périmètres de protection et de surveillance établis qui sont visées au point c), doivent être repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire «indemne de maladie» (catégorie I), en ce qui concerne la SHV ou la NHI, ou les deux. | Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été évacuées, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);
(e) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment covered by the eradication programme and when surveillance in wild populations is required, sampling points selected in accordance with point I.1, shall subsequently be subject to the surveillance scheme laid down in point I.2.1.e) | Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1.e) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1.
I.2.2.2.   Requirements for regaining disease-free status for continental compartments comprising one single farm previously being declared free of either IHN or VHS or bothI.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for enten IHN eller VHS eller beggeI.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole qui ont précédemment été déclarés indemnes de la NHI ou de la SHV, ou des deux, puissent retrouver le statut «indemne de maladie»
A continental compartment comprising one single farm previously declared free of either VHS or IHN or both of those listed diseases, whose health status with regard to those listed diseases is independent of the surrounding natural waters in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC, and whose Category I health status has been withdrawn in accordance with Article 53(3) of that Directive, may regain Category I health status immediately after the competent authority has confirmed that the following conditions have been complied with:Et indlandssegment, der omfatter et enkelt akvakulturbrug, som tidligere har været erklæret frit for enten VHS eller IHN eller begge disse listeopførte sygdomme, og hvis sundhedsstatus for så vidt angår disse listeopførte sygdomme er uafhængig af de omkringliggende naturlige vandområder i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at følgende betingelser er opfyldt:Un compartiment continental comprenant une seule ferme aquacole qui a précédemment été déclaré indemne de la SHV ou de la NHI, ou de ces deux maladies répertoriées, dont le statut sanitaire en ce qui concerne ces maladies répertoriées est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver le statut de catégorie I dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:
(a) | the officially confirmed infected farm with either VHS or IHN or both must have been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period must be at least 6 weeks;a) | Det akvakulturbrug, der officielt er bekræftet inficeret med enten VHS eller IHN eller begge, er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.a) | la ferme aquacole dont l'infection par la SHV ou la NHI, ou par les deux, a été officiellement confirmée, doit avoir été vidée de ses poissons, nettoyée et désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines doit avoir été observée;
(b) | the officially confirmed infected farm with either VHS or IHN or both has been restocked with fish sourced from Member States, zones or compartments with a category I health status with regard to either VHS or IHN or both.b) | Nytilførslen af fisk på det akvakulturbrug, der officielt er bekræftet inficeret med enten VHS eller IHN eller begge, er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge.b) | la ferme aquacole dont l'infection par la NHI ou la SHV, ou par les deux, a été officiellement confirmée a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux.
I.3.   Specific requirements for the maintenance of disease-free health status (Category I) with regard to either VHS or IHN or bothI.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår enten VHS eller IHN eller beggeI.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la SHV et la NHI, ou les deux
When targeted surveillance is required in order to maintain Category I health status, as provided in Article 52 of Directive 2006/88/EC, all farms keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment concerned shall be subject to health inspection and fish shall be sampled in accordance with Table 1.C set out in Section II of this Part, taking into account the risk level of the farm for the contraction of either VHS or IHN or both of those listed diseases.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning af fisk i overensstemmelse med tabel 1.C i afsnit II i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af enten VHS eller IHN eller begge disse listeopførte sygdomme.Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent être soumises à une inspection sanitaire et les poissons doivent faire l'objet d'un échantillonnage conformément au tableau 1.C figurant à la section II de la présente partie, compte tenu du risque de contamination de la ferme aquacole par la SHV ou la NHI, ou par ces deux maladies répertoriées.
When determining the health inspection frequency for Category I health status compartments with regard to either VHS or IHN or both, which are placed in continental areas and where the health status regarding VHS or IHN is dependent on the health status of the aquatic animal populations in surrounding natural waters in accordance with point 2 of Part II of Annex V to Directive 2006/88/EC, the risk for the contraction of either VHS or IHN or both shall be considered as high.Ved fastlæggelsen af hyppigheden af sundhedsinspektioner for segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge, som er placeret i indlandsområder, og hvis sundhedsstatus for så vidt angår VHS eller IHN er afhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder i overensstemmelse med del II, punkt 2, i bilag V til direktiv 2006/88/EF, anses risikoen for indslæbning af enten VHS eller IHN eller begge for at være høj.Lors de la détermination de la fréquence des inspections sanitaires pour les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne la SHV ou la NHI, ou les deux, qui se trouvent dans des zones continentales et dont le statut sanitaire en ce qui concerne la SHV ou la NHI dépend de la situation sanitaire du statut zoosanitaire des populations d'animaux aquatiques dans les eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 2, de la directive 2006/88/CE, le risque de transmission de la SHV ou de la NHI, ou des deux, doit être considéré comme élevé.
Disease-free status shall only be maintained as long as all samples tested, using the diagnostic methods set out in point II.2., produce negative results for either VHS or IHN or both of those listed diseases and any suspicion of either VHS or IHN or both are ruled out in accordance with the diagnostic methods set out in point II.3.Statussen som sygdomsfri opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 giver negative resultater for enten VHS eller IHN eller begge disse listeopførte sygdomme, og enhver mistanke om enten VHS eller IHN eller begge er udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2. se révèlent négatifs pour la SHV ou la NHI, ou pour ces deux maladies répertoriées, et tant que toute suspicion de SHV ou de NHI, ou des deux, est écartée conformément aux méthodes de diagnostic établies au point II.3.
I.4.   Requirements for the lifting of containment measures provided for in Article 39 of Directive 2006/88/EC, namely the change from Category V to Category III health statusI.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF, dvs. ændring af sundhedsstatus fra kategori V til kategori IIII.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE, c'est-à-dire pour passer du statut sanitaire de catégorie V à celui de catégorie III
A Member State, zone or a compartment which has Category V health status with regard to either VHS or IHN or both may achieve Category III health status with regard to those listed diseases provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår enten VHS eller IHN eller begge, kan opnå en sundhedsstatus i kategori III for så vidt angår disse listeopførte sygdomme, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la SHV ou la NHI, ou les deux, peut obtenir le statut sanitaire de catégorie III pour ces maladies répertoriées à condition que:
(a) | the requirements set out in points I.2.2.1(a), (b) and (c) have been met. In case fallowing is not technically possible, the farms concerned shall be subject to an alternative measure which provides almost similar guarantee for extermination of either IHNV or VHSV or both from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal de berørte akvakulturbrug gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at enten IHNV eller VHSV eller begge er udryddet i brugets miljøa) | les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles concernées doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du virus de la NHI ou du virus de la SHV, ou de ces deux agents, de l'environnement de la ferme aquacole;
(b) | all farms officially declared infected and all other farms fallowed/been subject to alternative measures in accordance with (a) within the established protection and surveillance zones have been restocked with fish sourced from Member States, zones or compartments with a Category I, II or III health status with regard to either VHS or IHN or both;b) | nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre brug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår enten VHS eller IHN eller beggeb) | toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant été soumises à un vide sanitaire ou à d'autres mesures conformément au point a) à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne la SHV ou la NHI, ou les deux à la fois;
(c) | the restocking has only taken place after all farms officially declared infected, have been emptied, cleansed, disinfected and fallowed/been subject to alternative measures in accordance with (a).c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).c) | le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a).
II.   Diagnostic and sampling methodsII.   Diagnose- og prøveudtagningsmetoderII.   Méthodes d'échantillonnage et de diagnostic
II.1.   Organs to be sampled:II.1.   Organer, der skal udtages prøver fraII.1.   Organes à prélever
The tissue material to be examined is spleen, anterior kidney, and either heart or encephalon. When sampling broodstock ovarian or seminal fluid may also be examined.Det vævsmateriale, som skal undersøges, er milt, fornyre og enten hjerte eller hjerne. Hvis der udtages prøver fra gydebestande, kan tillige ovarievæsken eller sædvæsken undersøges.Les tissus à examiner sont la rate, le rein antérieur et soit le cœur, soit l'encéphale. Lorsque l'échantillonnage est effectué sur des géniteurs, les ovaires ou le liquide séminal peuvent également être examinés.
In case of small fry, whole fish less than 4 cm long can be minced with sterile scissors or a scalpel after removal of the body behind the gut opening. If a sample consists of whole fish with a body length between 4 cm and 6 cm, the viscera including kidney shall be collected.Hvis der er tale om småfisk, kan hele fisk på under 4 cm findeles ved hjælp af en steril saks eller skalpel efter fjernelse af kroppen bag gatåbningen. Hvis prøven består af hele fisk på 4-6 cm, indsamles indvoldene, herunder nyre.S'il s'agit de jeunes alevins, les poissons entiers de longueur inférieure à 4 cm peuvent être réduits en petits fragments à l'aide de ciseaux stériles ou d'un scalpel après élimination de la partie du corps située à l'arrière de l'anus. Si un échantillon est constitué de poissons entiers de longueur comprise entre 4 et 6 cm, les viscères, y compris les reins, doivent être prélevés.
Organ pieces from a maximum of 10 fish may be pooled.Organstykker fra højst 10 fisk kan udgøre en samleprøve.Il est possible de regrouper des fragments d'organes provenant de dix poissons au maximum.
II.2.   Diagnostic methods to obtain and maintain disease-free status for either VHS or IHN or bothII.2.   Diagnosemetoder med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår enten VHS eller IHN eller beggeII.2.   Méthodes de diagnostic pour obtenir et conserver le statut «indemne de maladie» en ce qui concerne la SHV ou la NHI, ou les deux
The diagnostic method, in accordance with the approved diagnostic methods and procedures set out in point I. of Part 1 of Annex II, to achieve or to maintain disease-free status for VHS or IHN or both shall be either:Diagnosemetoden, i overensstemmelse med de godkendte diagnosemetoder og -procedurer, der er fastsat i bilag II, del 1, punkt I, med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår VHS eller IHN eller begge, skal enten være:La méthode de diagnostic conforme aux méthodes et procédures de diagnostic approuvées indiquées à l'annexe II, partie 1, point I, pour obtenir ou conserver le statut «indemne de maladie» en ce qui concerne la SHV ou la NHI, ou les deux, est une des deux méthodes suivantes:
(a) | virus isolation in cell cultures followed by identification using enzyme-linked immunosorbent assay (ELISA), indirect fluorescent antibody test (IFAT), virus neutralisation test or real-time reverse transcriptase polymerase chain reaction (RT-qPCR); ora) | virusisolation i cellekulturer efterfulgt af identifikation ved hjælp af enzymbundet immunosorbent assay (ELISA), indirekte fluorescerende antistoftest (IFAT), virusneutralisationstest eller realtids revers transkriptase-polymerasekædereaktion (RT-qPCR) ellera) | isolement du virus en culture cellulaire, puis identification par méthode immuno-enzymatique (ELISA), test d'immunofluorescence indirecte (IFAT), test de neutralisation du virus ou amplification en chaîne par polymérase en présence d'une transcriptase inverse en temps réel (RT-qPCR) ou
(b) | RT-qPCR.b) | RT-qPCR.b) | RT-qPCR.
II.3.   Sampling and diagnostic methods to rule out or to confirm the presence of VHS or IHNII.3.   Prøveudtagnings- og diagnosemetoder med henblik på at udelukke eller bekræfte forekomst af VHS eller IHNII.3.   Méthodes d'échantillonnage et de diagnostic pour exclure ou confirmer la présence de la SHV ou de la NHI
When a suspicion of either VHS or IHN or both is required to be confirmed or ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedures shall be complied with:Hvis mistanke om forekomst af enten VHS eller IHN eller begge skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion de SHV ou de NHI, ou des deux à la fois, conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:
(a) | the farm under suspicion shall be subject to at least one health inspection and one sampling of 10 fish, when clinical signs or post-mortem signs consistent with infection with either VHS or IHN or both are observed or minimum 30 fish, when clinical or post-mortem signs are not observed. Samples shall be tested using one or more of the diagnostic methods set out in points (i) and (ii) in accordance with the detailed diagnostic methods and procedures as set out in Section II of Part 1 of Annex II: | (i) | conventional virus isolation in cell culture with subsequent immunochemical or molecular virus identification; | (ii) | virus detection by RT-qPCR; | (iii) | Other diagnostic techniques of proven similar efficacy such as Indirect fluorescent antibody test (IFAT), Enzyme-linked immuno-sorbent assay (ELISA), RT-PCR and Immunohistochemistry (IHC).a) | På det akvakulturbrug, der er under mistanke, skal der foretages mindst én sundhedsinspektion og én prøveudtagning af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med enten VHS eller IHN eller begge, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af en eller flere af diagnosemetoderne i nr. i) og ii) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 1, afsnit II: | i) | konventionel virusisolation i cellekulturer med efterfølgende immunokemisk eller molekylær virusidentifikation | ii) | viruspåvisning ved hjælp af RT-qPCR | iii) | andre diagnoseteknikker med dokumenteret tilsvarende effektivitet, f.eks. IFAT, ELISA, RT-PCR og immunhistokemi (IHC).a) | la ferme aquacole suspecte doit faire l'objet d'au moins une inspection sanitaire et d'un échantillonnage portant sur dix poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par la SHV ou la NHI, ou par les deux, ou sur au moins 30 poissons en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés à l'aide d'une ou de plusieurs des méthodes de diagnostic indiquées aux points i) et ii), conformément aux méthodes de diagnostic et procédures détaillées figurant à l'annexe II, partie 1, section II, à savoir: | i) | isolement conventionnel du virus en culture cellulaire, suivi de son identification par méthode immunochimique ou moléculaire; | ii) | détection du virus par RT-qPCR; | iii) | autres techniques de diagnostic d'efficacité similaire avérée telles que le test d'immunofluorescence indirecte (IFAT), la méthode immunoenzymatique (ELISA), la RT-PCR et l'immunohistochimie (IHC);
(b) | the presence of VHS shall be considered as confirmed, if one or more of those diagnostic methods are positive for VHSV. The presence of IHN shall be considered as confirmed, if one or more of those diagnostic methods are positive for IHNV. The confirmation of the first case of VHS or IHN in Member States, zones or compartments previously not infected shall be based on conventional virus isolation in cell culture or RT-qPCR;b) | Forekomst af VHS anses for bekræftet, hvis en eller flere af disse diagnosemetoder er positive for VHSV. Forekomst af IHN anses for bekræftet, hvis en eller flere af disse diagnosemetoder er positive for IHNV. Bekræftelse af det første tilfælde af VHS eller IHN i de medlemsstater, zoner eller segmenter, der ikke tidligere har været inficeret, baseres på konventionel virusisolation i cellekulturer eller RT-qPCR.b) | la présence de la SHV est considérée comme confirmée si au moins une de ces méthodes de diagnostic donne des résultats positifs pour le virus de la SHV (VSHV). La présence de la NHI est considérée comme confirmée si au moins une de ces méthodes de diagnostic donne des résultats positifs pour le virus de la NHI (VNHI). La confirmation du premier cas de SHV ou de NHI dans des États membres, des zones ou des compartiments précédemment non infectés doit être obtenue par isolement conventionnel du virus en culture cellulaire ou par RT-qPCR;
(c) | Suspicion of either VHSV or IHNV or both may be ruled out, if cell cultivation or RT-qPCR tests reveal no further evidence of the presence of either VHSV or IHNV or both.c) | Mistanke om enten VHSV eller IHNV eller begge kan udelukkes, hvis celledyrkning eller RT-qPCR-test ikke afslører yderligere tegn på forekomst af enten VHSV eller IHNV eller begge.c) | une suspicion de SHV ou de NHI, ou des deux à la fois, peut être écartée si les résultats de la culture cellulaire ou de la RT-qPCR n'apportent pas d'élément supplémentaire prouvant la présence du virus de la SHV ou de la NHI, ou des deux.
Table 1.ATabel 1.ATableau 1.A
Surveillance scheme for zones and compartments for the 2-year control period referred to in point I.2.1(a)(i) which precedes the achievement of disease-free status for VHS or IHNOvervågningsordning for zoner og segmenter i den toårige kontrolperiode, jf. punkt I.2.1, litra a), nr. i), forud for opnåelse af status som sygdomsfri for så vidt angår VHS eller IHNProgramme de surveillance des zones et compartiments pour la période de deux ans visée au point I.2.1. a) i) qui précède l'obtention du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI
Type of farm | Number of health inspections per year (2 years) | Number of samplings per year (2 years) | Number of fish in the sample (1)Type akvakulturbrug | Antal sundhedsinspektioner pr. år (i to år) | Antal prøveudtagninger pr. år (i to år) | Antal fisk i prøven (1)Type de ferme aquacole | Nombre d'inspections sanitaires par an (sur deux ans) | Nombre de prélèvements par an (sur deux ans) | Nombre de poissons par échantillon (1)
Number of growing fish | Number of broodstock fish (2)Antal fisk i vækst | Antal gydebestandsfisk (2)Nombre de poissons en développement | Nombre de géniteurs (2)
(a) | Farms with broodstock | 2 | 2 | 50 (first inspection) | 75 (second inspection) | 30 (first or second inspection) | 0 (first or second inspection)a) | Akvakulturbrug med gydebestand | 2 | 2 | 50 (1. inspektion) | 75 (2. inspektion) | 30 (1. eller 2. inspektion) | 0 (1. eller 2. inspektion)a) | Fermes aquacoles détenant des géniteurs | 2 | 2 | 50 (première inspection) | 75 (deuxième inspection) | 30 (première ou deuxième inspection) | 0 (première ou deuxième inspection)
(b) | Farms with broodstock only | 2 | 1 | 0 | 75 (first or second inspection)b) | Akvakulturbrug udelukkende med gydebestand | 2 | 1 | 0 | 75 (1. eller 2. inspektion)b) | Fermes aquacoles détenant exclusivement des géniteurs | 2 | 1 | 0 | 75 (première ou deuxième inspection)
(c) | Farms without broodstock | 2 | 2 | 75 (3) (first and second inspection) | 0c) | Akvakulturbrug uden gydebestand | 2 | 2 | 75 (3) (1. og 2. inspektion) | 0c) | Fermes aquacoles ne détenant pas de géniteurs | 2 | 2 | 75 (3) (première et deuxième inspections) | 0
Maximum number of fish per pool: 10Maksimalt antal fisk pr. samleprøve: 10Nombre maximal de poissons par regroupement: 10
Table 1.BTabel 1.BTableau 1.B
Surveillance scheme with a reduced sample size for the 4-year control period referred to in point I.2.1(a)(ii) which precedes the achievement of disease-free status for VHS or IHNOvervågningsordning med reduceret prøvestørrelse i den fireårige kontrolperiode, jf. punkt I.2.1, litra a), nr. ii), forud for opnåelse af status som sygdomsfri for så vidt angår VHS eller IHNProgramme de surveillance avec taille d'échantillon réduite pour la période de quatre ans visée au point I.2.1. a) ii) qui précède l'obtention du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI
Type of farm | Number of health inspections per year | Number of samplings per year | Number of fish in the sample (4)Type akvakulturbrug | Antal sundhedsinspektioner pr. år | Antal prøveudtagninger pr. år | Antal fisk i prøven (4)Type de ferme aquacole | Nombre d'inspections sanitaires par an | Nombre de prélèvements par an | Nombre de poissons par échantillon (4)
Number of growing fish | Number of broodstock fish (5)Antal fisk i vækst | Antal gydebestandsfisk (5)Nombre de poissons en développement | Nombre de géniteurs (5)
First 2 years of the surveillance periodDe første to år i overvågningsperiodenDeux premières années de la période de surveillance
(a) | Farms with broodstock | 2 | 1 | 0 (first inspection) | 30 (second inspection) | 0 (first inspection) | 0 (second inspection)a) | Akvakulturbrug med gydebestand | 2 | 1 | 0 (1. inspektion) | 30 (2. inspektion) | 0 (1. inspektion) | 0 (2. inspektion)a) | Fermes aquacoles détenant des géniteurs | 2 | 1 | 0 (première inspection) | 30 (deuxième inspection) | 0 (première inspection) | 0 (deuxième inspection)
(b) | Farms with broodstock only | 2 | 1 | 0 | 30 (first or second inspection)b) | Akvakulturbrug udelukkende med gydebestand | 2 | 1 | 0 | 30 (1. eller 2. inspektion)b) | Fermes aquacoles détenant exclusivement des géniteurs | 2 | 1 | 0 | 30 (première ou deuxième inspection)
(c) | Farms without broodstock | 2 | 1 | 30 (6) (first or second inspection) | 0c) | Akvakulturbrug uden gydebestand | 2 | 1 | 30 (6) (1. eller 2. inspektion) | 0c) | Fermes aquacoles ne détenant pas de géniteurs | 2 | 1 | 30 (6) (première ou deuxième inspection) | 0
Last 2 years of the surveillance periodDe sidste to år i overvågningsperiodenDeux dernières années de la période de surveillance
(a) | Farms with broodstock | 2 | 2 | 30 (first inspection) | 0(second inspection) | 0 (first inspection) | 30 (second inspection)a) | Akvakulturbrug med gydebestand | 2 | 2 | 30 (1. inspektion) | 0 (2. inspektion) | 0 (1. inspektion) | 30 (2. inspektion)a) | Fermes aquacoles détenant des géniteurs | 2 | 2 | 30 (première inspection) | 0 (deuxième inspection) | 0 (première inspection) | 30 (deuxième inspection)
(b) | Farms with broodstock only | 2 | 2 |   | 30 (first and second inspection)b) | Akvakulturbrug udelukkende med gydebestand | 2 | 2 |   | 30 (1. og 2. inspektion)b) | Fermes aquacoles détenant exclusivement des géniteurs | 2 | 2 |   | 30 (première et deuxième inspections)
(c) | Farms without broodstock | 2 | 2 | 30 (6) (first and second inspection) |  c) | Akvakulturbrug uden gydebestand | 2 | 2 | 30 (6) (1. og 2. inspektion) |  c) | Fermes aquacoles ne détenant pas de géniteurs | 2 | 2 | 30 (6) (première et deuxième inspections) |  
Maximum number of fish per pool: 10Maksimalt antal fisk pr. samleprøve: 10Nombre maximal de poissons par regroupement: 10
Table 1.CTabel 1.CTableau 1.C
Surveillance schemes for zones or compartments to maintain disease-free status for VHS or IHN as referred to in point I.3Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår VHS eller IHN, jf. punkt I.3Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne la SHV ou la NHI visé au point I.3
Risk level | Number of health inspections | Number of fish in the sample (9)Risikoniveau | Antal sundhedsinspektioner | Antal fisk i prøven (9)Niveau de risque | Nombre d'inspections sanitaires | Nombre de poissons par échantillon (9)
High | 2 every year | 30 (7)  (8)Højt | 2 pr. år | 30 (7)  (8)Élevé | Deux par an | 30 (7)  (8)
Medium | 1 every year | 30 (7)Middel | 1 pr. år | 30 (7)Moyen | Une par an | 30 (7)
Low | 1 every 2 years | 30 (7)Lavt | 1 hvert 2. år | 30 (7)Faible | Une tous les deux ans | 30 (7)
Maximum number of fish per pool: 10Maksimalt antal fisk pr. samleprøve: 10Nombre maximal de poissons par regroupement: 10
PART 2DEL 2PARTIE 2
SURVEILLANCE AND CONTROL METHODS FOR KOI HERPESVIRUS DISEASE (KHVD)OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR KOI-HERPESVIRUS-SYGDOM (KHVD)SURVEILLANCE DE L'HERPÈSVIROSE DE LA CARPE KOÏ (HVCK) ET MÉTHODES DE LUTTE CONTRE CETTE MALADIE
I.   Requirements for surveillance and eradication programmes to obtain and maintain disease-free health status with regard to KHVD and to contain infection with koi herpesvirus (KHV)I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår KHVD og foranstaltninger mod spredning af infektion med koi-herpesvirus (KHV)I.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'HVCK ainsi que des mesures de confinement destinées à lutter contre l'infection par l'herpèsvirus koï (HVK)
I.1.   General requirementsI.1.   Generelle kravI.1.   Exigences générales
When targeted surveillance in wild populations is required in accordance with the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the number and geographical distribution of sampling points shall be determined to obtain a reasonable coverage of the Member State, zone or compartment. The sampling points shall also be representative of the different ecosystems where the wild susceptible populations are located, namely, river systems and lakes.Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal også være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende modtagelige populationer, dvs. flodsystemer og søer.Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant les populations sauvages sensibles, à savoir les cours d'eau et les lacs.
Targeted surveillance shall rely on the regular monitoring of sites holding susceptible species. Sites shall be monitored when water temperatures have reached levels that are permissive for the development of the disease (> 15 °C) and no sooner than 2 weeks from the date such temperatures have been reached. Any diseased fish or fish showing abnormal behavior that are found on the site shall be sampled and tested.Den målrettede overvågning skal være baseret på regelmæssig overvågning af steder med modtagelige arter. Stederne skal overvåges, når vandtemperaturerne er tilstrækkelig høje til, at sygdommen kan udvikle sig (> 15 °C), og tidligst to uger fra den dato, hvor sådanne temperaturer er nået. Alle syge fisk eller fisk, der udviser unormal adfærd, som findes på stedet, skal underkastes prøveudtagning og testes.La surveillance ciblée doit reposer sur un suivi régulier des sites détenant des espèces sensibles. Les sites doivent être contrôlés lorsque la température de l'eau a atteint des niveaux propices au développement de la maladie (> 15 °C) et au plus tôt deux semaines après que ces températures ont été atteintes. Tous les poissons malades ou présentant un comportement anormal qui sont observés sur le site doivent faire l'objet d'un échantillonnage et être testés.
Whenever possible, fish that have been kept for a prolonged time period at the virus permissive temperature range, namely 2 to 3 weeks at 15 °C to 26 °C, shall be sampled. The following approach may, however, be accepted:Når det er muligt, skal der udtages prøver af fisk, der i en længere periode har været holdt ved temperaturer, ved hvilke virus udvikler sig, dvs. to til tre uger ved 15-26 °C. Følgende fremgangsmåde kan dog godtages:Dans la mesure du possible, les poissons qui ont été maintenus longtemps à des températures propices au développement du virus, c'est-à-dire entre 15 et 26 °C pendant deux à trois semaines, doivent faire l'objet d'un échantillonnage. L'approche décrite ci-après est toutefois acceptable:
(a) | to collect a sub-population at transfer from winter to summer ponds and hold the fish in the same water body as the summer pond until minimum temperature requirements have been obtained, ora) | at indsamle en delpopulation ved overførslen fra vinterdamme til sommerdamme og holde fisken i samme vandmasse som sommerdammen, indtil den krævede minimumstemperatur er nået, ellera) | recueillir une sous-population au moment du transfert des étangs d'hiver aux étangs d'été et maintenir les poissons dans la même eau que celle des étangs d'été jusqu'à obtention de la température minimale requise, ou
(b) | to collect samples at harvesting or during other fish handling as part of normal management practices. If possible, samples shall be collected between 24 and 72 hours after such management practices to enhance the chance of KHV detection.b) | at indsamle prøver ved høst eller i forbindelse med anden håndtering af fisk som led i almindelig driftspraksis. Om muligt indsamles prøverne mellem 24 og 72 timer efter sådan driftspraksis for at forbedre chancen for påvisning af KHV.b) | prélever les échantillons au moment de la capture ou lors d'autres manipulations des poissons faisant partie des pratiques de gestion normales. Dans la mesure du possible, les échantillons doivent être prélevés entre 24 et 72 heures après ces pratiques de gestion afin d'augmenter les chances de détection de l'herpèsvirus koï.
When farms or wild populations have to be subject to health inspections or sampled more than once per year, the intervals between the health inspections or collections of samples shall be as long as possible within the season when the water temperature is likely to reach its highest annual points without exceeding the limit of 28 °C.Hvis akvakulturbrug eller vildtlevende populationer skal være omfattet af sundhedsinspektioner eller prøveudtagninger mere end én gang om året, skal der være så lang tid som muligt mellem sundhedsinspektionerne eller prøveudtagningerne på den årstid, hvor vandtemperaturen forventes at være højest uden at overskride grænsen på 28 °C.Lorsque des fermes aquacoles ou des populations sauvages doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires ou d'échantillonnages, l'intervalle entre les inspections sanitaires ou entre chaque prélèvement d'échantillons doit être aussi long que possible pendant la saison où la température de l'eau est susceptible d'atteindre les maxima annuels sans pour autant dépasser la limite de 28 °C.
All production units, such as ponds and tanks, must be subject to health inspections for the presence of dead, weak or abnormally behaving fish.Alle produktionsenheder som f.eks. damme og tanke skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd.Toutes les unités de production, telles que les étangs et les viviers, doivent faire l'objet d'inspections sanitaires destinées à établir la présence de poissons morts, faibles ou au comportement anormal.
Cyprinus carpio and its hybrids, such as Cyprinus carpio × Carassius auratus, shall be collected when present in the farm.Cyprinus carpio og hybrider heraf som f.eks. Cyprinus carpio × Carassius auratus skal indsamles, når de er til stede på bruget.Les poissons de l'espèce Cyprinus carpio et ses hybrides, tels que Cyprinus carpio × Carassius auratus, doivent être prélevés lorsqu'ils sont présents dans la ferme aquacole.
The fish to be collected as samples shall be selected as follows:De fisk, der skal indsamles som prøver, udvælges på følgende måde:Les poissons à inclure dans les échantillons sont sélectionnés comme suit:
(i) | if weak, abnormally behaving or freshly dead but not decomposed fish are present, such fish must be selected;i) | Hvis der forekommer svage fisk, fisk med unormal adfærd eller nyligt døde fisk (som ikke er gået i opløsning), skal disse udvælges.i) | en présence de poissons faibles, au comportement anormal ou qui viennent de mourir, mais ne sont pas encore décomposés, ces poissons doivent être sélectionnés;
(ii) | if more than one water source is utilised for fish production, fish representing all water sources must be included for sampling;ii) | Hvis der anvendes mere end én vandkilde til fiskeproduktion, skal der indgå fisk fra alle vandkilder i prøven.ii) | si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentatifs de toutes les sources d'eau doivent être inclus dans l'échantillon;
(iii) | the fish selected must include fish collected in such a way that all parts of the farm, as well as all year classes, are proportionally represented in the sample.iii) | De udvalgte fisk skal omfatte fisk, der er indsamlet på en sådan måde, at alle dele af akvakulturbruget og alle årgange er proportionalt repræsenteret i prøven.iii) | les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les parties de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.
I.2.   Specific requirements to achieve disease-free health status (Category I) with regard to KHVDI.2.   Særlige krav vedrørende opnåelse af status som sygdomsfri (kategori I) for så vidt angår KHVDI.2.   Exigences spécifiques pour l'obtention du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'HVCK
I.2.1.   Surveillance programmesI.2.1.   OvervågningsprogrammerI.2.1.   Programmes de surveillance
(a) | a Member State, zone or a compartment which has Category III health status with regard to KHVD may achieve Category I health status when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within that Member State, zone or compartment comply with the requirements for disease-free status set out in Annex V to that Directive and all those farms, and, when required by the second paragraph of point 2 of Part I of that Annex, sampling points in wild populations selected in accordance with that Part, have been subject to one of the following surveillance programmes: | (i) | model A — 2-year surveillance programme: | The farms or sampling points must have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 2.A set out in Section III. | During that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 must have produced negative results for KHV and any suspicion of KHVD must have been ruled out in accordance with the diagnostic methods set out in point III.2; | (ii) | model B — 4-year surveillance programme with reduced sample size: | The farms or sampling points must have been subject to health inspections and sampled for a minimum period of four consecutive years as laid down in Table 2.B set out in Section III. | During that 4-year period, the testing of all samples using the diagnostic methods set out in point II.2 must have produced negative results for KHV and any suspicion of KHVD must have been ruled out in accordance with the diagnostic methods set out in point III.2;a) | En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori I, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment opfylder kravene vedrørende status som sygdomsfri i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til bilag V, del I, punkt 2, andet afsnit, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte del, har været omfattet af et af følgende overvågningsprogrammer: | i) | Model A — toårigt overvågningsprogram: | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 2.A i afsnit III. | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for KHV, og enhver mistanke om KHVD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2. | ii) | Model B — fireårigt overvågningsprogram med reduceret prøvestørrelse: | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst fire på hinanden følgende år som fastsat i tabel 2.B i afsnit III. | I løbet af denne fireårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for KHV, og enhver mistanke om KHVD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2.a) | Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'HVCK peut obtenir un statut sanitaire de catégorie I lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment respectent les conditions requises pour l'obtention du statut «indemne de maladie» qui sont définies à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de la partie I, point 2, paragraphe 2, de ladite annexe le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément à cette partie, ont fait l'objet de l'un des programmes de surveillance suivants: | i) | modèle A — programme de surveillance sur deux ans | les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 2.A de la section III. | Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour l'HVK et toute suspicion d'HVCK doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point III.2; | ii) | modèle B — programme de surveillance sur quatre ans avec taille d'échantillon réduite | Les fermes aquacoles ou les points de prélèvement doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de quatre années consécutives, comme indiqué dans le tableau 2.B de la section III. | Au cours de cette période de quatre ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour l'HVK et toute suspicion d'HVCK doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point III.2;
(b) | if during the implementation of the 4-year surveillance programme set out in point (a), infection with KHV is confirmed in a farm included in that surveillance programme, and therefore its Category II health status has been withdrawn, that farm may immediately regain the Category II health status and continue the implementation of the surveillance programme to obtain disease- free status without implementing an eradication programme as described in point I.2.2 provided that the farm complies with the following conditions: | (i) | it is a continental farm whose health status regarding KHVD is independent of the health status of aquatic animal populations in the surrounding natural water as regards that listed disease in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC; | (ii) | it has been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period shall be at least 6 weeks; | (iii) | it has been restocked with fish sourced from Member States, zones or compartments with a Category I health status with regard to KHVD.b) | Hvis det i forbindelse med gennemførelsen af det fireårige overvågningsprogram, jf. litra a), bekræftes, at der er infektion med KHV på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som beskrevet i punkt I.2.2, forudsat at bruget opfylder følgende betingelser: | i) | Det er et indlandsbrug, hvis sundhedsstatus vedrørende KHVD er uafhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder for så vidt angår denne listeopførte sygdom, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF. | ii) | Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger. | iii) | Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD.b) | si, au cours de la mise en œuvre du programme de surveillance de quatre ans visé au point a), une infection par l'HVK est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre le programme d'éradication décrit au point I.2.2, à condition de satisfaire aux conditions suivantes: | i) | il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne l'HVCK est indépendant du statut zoosanitaire des populations d'animaux aquatiques dans les eaux naturelles avoisinantes pour cette maladie répertoriée, conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE; | ii) | elle a été vidée de ses poissons, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée; | iii) | elle a été repeuplée avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I en ce qui concerne l'HVCK.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
I.2.2.1.   General requirementsI.2.2.1.   Generelle kravI.2.2.1.   Exigences générales
A Member State, zone or a compartment that has Category V health status with regard KHVD, may achieve Category I health status with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within that Member State, zone or compartment have been subject at least to the following eradication programme:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af mindst følgende udryddelsesprogram:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'HVCK peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme d'éradication suivant:
(a) | the minimum control measures laid down in Section 4 of Chapter V of Directive 2006/88/EC have effectively been applied, and a containment area as referred to in Article 32(b) of that Directive, comprising a protection zone and surveillance zone, has been established in the vicinity of the farm(s) officially declared infected with KHV. | The containment area must have been defined on a case-by-case basis taking into account factors influencing the risks for the spread of KHVD to farmed and wild fish, such as: the number, rate and distribution the mortalities of fish on the farm infected with KHV; the distance and density of neighbouring farms; the proximity to slaughterhouses; contact farms; the species present at the farms; the farming practices applied in the affected and neighbouring farms; the hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply as regards the geographical demarcation of those zones: | (i) | a protection zone shall be established in the immediate vicinity of a farm officially declared infected with KHV and shall correspond to the entire water catchment area of the farm officially declared infected with KHV; the competent authority may limit the extension of the zone to parts of the water catchment area provided that the prevention of the spread of KHVD is not compromised; | (ii) | a surveillance zone shall be established outside the protection zone and shall correspond to an extended area surrounding the established protection zone;a) | De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med KHV. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af KHVD til opdrættede og vildtlevende fisk som f.eks.: antal, procentdel og fordeling af døde fisk på det akvakulturbrug, der er inficeret med KHV, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med KHV, og den skal svare til hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med KHV; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af KHVD. | ii) | Der skal oprettes en overvågningszone uden om beskyttelseszonen, og den skal svare til et udvidet område uden om den oprettede beskyttelseszone.a) | les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE ont effectivement été appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par l'HVK. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de l'HVCK aux poissons d'élevage et aux poissons sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des poissons dans la ferme aquacole infectée par l'HVK; la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par l'HVK et doit correspondre à la totalité du bassin hydrographique de ladite ferme aquacole; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de l'HVCK; | ii) | un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre à une zone étendue située autour du périmètre de protection établi;
(b) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with KHV shall be subject to an official investigation comprising at least the following elements: | (i) | the collection of samples for testing of 10 fish, when clinical signs or post-mortem signs consistent with KHVD are observed or 30 fish, when clinical or post-mortem signs are not observed; | (ii) | one health inspection; in those farms, where the tests referred to in point III.2 have produced negative results; health inspections shall continue once per month during the season when the water temperature is likely to reach > 15 °C until the protection zone is withdrawn in accordance with point I.2.2.1(c);b) | På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med KHV, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer: | i) | indsamling af prøver med henblik på undersøgelse af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på KHVD, eller 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund | ii) | én sundhedsinspektion; på de akvakulturbrug, hvor de i punkt III.2 omhandlede test har givet negativt resultat; der skal fortsat foretages sundhedsinspektioner én gang om måneden på den årstid, hvor vandtemperaturen forventes at nå > 15 °C, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).b) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par l'HVK doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants: | i) | le prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec l'HVCK, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem; | ii) | une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point III.2 ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois pendant la saison durant laquelle la température de l'eau est susceptible de dépasser 15 °C, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);
(c) | all farms officially declared infected with KHV shall be emptied, cleansed, disinfected and fallowed. The duration of the fallowing period shall be at least 6 weeks. When all farms within the same protection zone officially declared infected have been emptied, at least 3 weeks of synchronised fallowing shall be carried out. This paragraph also applies to new farms officially declared infected during the implementation of the eradication programme. | When fallowing of the officially declared infected farms is carried out, the protection zones shall be converted into surveillance zones. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms within the established protection and surveillance zones. The length of the fallowing period shall be determined by the competent authority following a case-by-case risk evaluation;c) | Alle akvakulturbrug, der officielt er erklæret inficeret med KHV, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Når alle akvakulturbrug, der officielt er erklæret inficeret, inden for samme beskyttelseszone er blevet tømt, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet. | Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe brugene skal udtages af drift.c) | toutes les fermes aquacoles officiellement déclarées infectées par l'HVK doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'une durée d'au moins six semaines doit être observée; lorsque toutes les fermes aquacoles officiellement déclarées infectées à l'intérieur d'un même périmètre de protection ont été vidées de leurs poissons, un vide sanitaire synchronisé d'au moins trois semaines doit être respecté. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication. | Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas.
(d) | All farms officially declared infected with KHV and all other farms fallowed within the established protection and surveillance zones shall be restocked: | (i) | with fish sourced from Member States, zones or compartments with a Category I health status with regard to KHVD; or | (ii) | for a transitional period until 31 December 2020, with fish from Member States, zones or compartments with an approved KHVD surveillance programme. | Restocking shall only take place when all farms officially declared infected with KHV have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2.1(c);d) | På alle akvakulturbrug, der officielt er erklæret inficeret med KHV, og på alle andre akvakulturbrug, der er udtaget af drift, inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af fisk: | i) | ske med fisk fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD eller | ii) | i en overgangsperiode indtil 31. december 2020 ske med fisk fra medlemsstater, zoner eller segmenter med et godkendt KHVD-overvågningsprogram. | Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret med KHV, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).d) | Toutes les fermes aquacoles officiellement déclarées infectées par l'HVK et toutes les autres fermes aquacoles soumises à un vide sanitaire qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées: | i) | avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'HVCK ou | ii) | transitoirement jusqu'au 31 décembre 2020, avec des poissons provenant d'États membres, de zones ou de compartiments faisant l'objet d'un programme de surveillance de l'HVCK approuvé. | Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);
(e) | All farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment covered by the eradication programme and, when surveillance in wild populations is required, sampling points selected in accordance with Point I.1., shall have subsequently been subject at least to the surveillance programme laid down in point I.2.1.e) | Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af mindst det overvågningsprogram, der er fastsat i punkt I.2.1.e) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent avoir ensuite été soumis au moins au programme de surveillance décrit au point I.2.1.
I.2.2.2.   Requirements for regaining disease free status for continental compartments comprising one single farm previously declared free of KHVDI.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for KHVDI.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole ayant précédemment été déclarés indemnes de l'HVCK puissent retrouver le statut «indemne de maladie»
A continental compartment comprising one single farm that has Category I health status with regard to KHVD, whose health status with regard to KHVD is independent of the surrounding natural waters in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC, and whose Category I status has been withdrawn in accordance with Article 53(3) of that Directive, may regain Category I health status with regard to KHVD immediately after the competent authority has confirmed that it has complied with the following conditions:Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår KHVD, og hvis sundhedsstatus for så vidt angår KHVD er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I for så vidt angår KHVD, umiddelbart efter at den kompetente myndighed har bekræftet, at det opfylder følgende betingelser:Un compartiment continental comprenant une seule ferme aquacole jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'HVCK, dont le statut sanitaire à l'égard de cette maladie est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver le statut de catégorie I pour l'HVCK dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:
(a) | it has been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period must have been be at least 6 weeks;a) | Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.a) | il a été vidé de ses poissons, nettoyé, désinfecté et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;
(b) | it has been restocked with fish sourced from Member States, zones or compartments with a Category I health status or compartments with an approved KHVD surveillance programme (Category II health status).b) | Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I eller segmenter med et godkendt KHVD-overvågningsprogram (sundhedsstatus i kategori II).b) | il a été repeuplé avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I ou de compartiments faisant l'objet d'un programme de surveillance de l'HVCK approuvé (statut sanitaire de catégorie II).
I.3.   Specific requirements for the maintenance of Category I status with regard to KHVDI.3.   Særlige krav vedrørende opretholdelse af en sundhedsstatus i kategori I for så vidt angår KHVDI.3.   Exigences spécifiques pour le maintien du statut sanitaire de catégorie I en ce qui concerne l'HVCK
When targeted surveillance is required in order to maintain Category I health status, as provided for in Article 52 of Directive 2006/88/EC, all farms keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment concerned shall be subject to health inspection and sampled in accordance with Table 2.B set out in Section III of this Part, taking into account the risk level of the farm for the contraction of KHV.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 2.B i afsnit III i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af KHV.Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 2.B figurant à la section III de la présente partie, compte tenu du risque de contamination de la ferme aquacole par l'HVK.
The inspection frequency for health inspections of Category I compartments with regard to KHVD placed in continental areas and comprising one or more farms whose health status regarding KHVD is dependent on the health status for that listed disease of surrounding natural waters in accordance with point 2 of Part II of Annex V to Directive 2006/88/EC, shall be in accordance with the number set out for high risk level in that Table 2.C.For segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD, som er beliggende i indlandsområder og omfatter et eller flere akvakulturbrug, og hvis sundhedsstatus for så vidt angår KHVD er afhængig af sundhedsstatussen for denne listeopførte sygdom i de omkringliggende naturlige vandområder, jf. del II, punkt 2, i bilag V til direktiv 2006/88/EF, skal hyppigheden af sundhedsinspektioner svare til det antal, der er anført for risikoniveauet højt i tabel 2.C.Dans les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne l'HVCK qui se trouvent dans des zones continentales et comprennent une ou plusieurs fermes aquacoles dont le statut sanitaire en ce qui concerne l'HVCK dépend de celui des eaux naturelles avoisinantes à l'égard de cette maladie répertoriée conformément à l'annexe V, partie II, point 2, de la directive 2006/88/CE, la fréquence des inspections sanitaires doit correspondre au nombre indiqué dans le tableau 2.C pour le niveau de risque élevé.
In Member States, zones or compartments in which the number of farms is limited and targeted surveillance on these farms does not provide sufficient epidemiological data, the surveillance schemes to maintain disease-free status shall include sampling points selected in accordance with the requirements set out in point I.1.I medlemsstater, zoner eller segmenter, i hvilke der er et begrænset antal akvakulturbrug, og hvor målrettet overvågning på disse akvakulturbrug ikke giver tilstrækkelige epidemiologiske data, skal overvågningsordningerne med henblik på opretholdelse af status som sygdomsfri omfatte prøveudtagningssteder udvalgt i overensstemmelse med kravene i punkt I.1.Dans les États membres, les zones ou les compartiments qui comptent un nombre limité de fermes aquacoles dont la surveillance ciblée ne permet pas d'obtenir suffisamment de données épidémiologiques, les programmes de surveillance nécessaires pour maintenir le statut «indemne de maladie» doivent inclure des points de prélèvement sélectionnés conformément aux exigences fixées au point I.1.
Those sampling points shall be inspected and sampled by rotation of 50 % of the sampling points each year. The sampling shall be carried out in accordance with Table 2.C set out in Section III. The samples shall be selected, prepared and examined as described in Section II and the laboratory examinations must be negative with regard to the presence of the agent of KHVD.Disse prøveudtagningssteder skal underkastes inspektioner og prøveudtagninger efter en rotationsordning (50 % af prøveudtagningsstederne pr. år). Prøveudtagningen skal foretages i overensstemmelse med tabel 2.C. i afsnit III. Prøverne skal udvælges, præpareres og undersøges som beskrevet i afsnit II, og laboratorieundersøgelserne skal give negative resultater med hensyn til forekomst af KHVD-agens.50 % de ces points de prélèvement doivent faire l'objet d'inspections et de prélèvements chaque année, par rotation. L'échantillonnage doit être réalisé conformément au tableau 2.C de la section III. Les échantillons doivent être sélectionnés, préparés et examinés comme indiqué à la section II et les résultats des examens de laboratoire doivent être négatifs en ce qui concerne la présence de l'agent de l'HVCK.
Disease-free status shall only be maintained as long as all samples tested using the diagnostic methods set out in point II.2 produce negative results for KHVD and any suspicion of KHVD must be ruled out in accordance with the diagnostic methods set out in point III.2.Statussen som sygdomsfri opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 giver negative resultater for KHVD, og enhver mistanke om KHVD er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2.Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour l'HVCK, et toute suspicion d'HVCK doit être écartée conformément aux méthodes de diagnostic établies au point III.2.
I.4.   Specific requirements for lifting the containment measures provided for in Article 39 of Directive 2006/88/EC to obtain Category III health status with regard to KHVD in Member States, compartments or zones that have Category V health statusI.4.   Særlige krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF, med henblik på at opnå en sundhedsstatus i kategori III for så vidt angår KHVD i medlemsstater, segmenter eller zoner, som har en sundhedsstatus i kategori VI.4.   Exigences spécifiques pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE pour l'obtention du statut sanitaire de catégorie III en ce qui concerne l'HVCK dans des États membres, des zones ou des compartiments ayant un statut sanitaire de catégorie V
A Member State, zone or a compartment that has Category V health status with regard to KHVD may achieve Category III health status with regard to that listed disease provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'HVCK peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:
(a) | the requirements set out in points I.2.2.1(a), (b) and(c) have been met. In case fallowing is not technically possible, the farms concerned shall be subject to an alternative measure which provides almost similar guarantee for extermination of KHV from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal de berørte akvakulturbrug gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at KHV er udryddet i brugets miljøa) | Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles concernées doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de l'HVK de l'environnement de la ferme aquacole;
(b) | all farms officially declared infected and all other farms fallowed/been subject to alternative measures in accordance with (a) within the established protection and surveillance zones have been restocked with fish sourced from Member States, zones or compartments with a Category I, II or III health status with regard to KHVD;b) | nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre akvakulturbrug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår KHVDb) | toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant été soumises à un vide sanitaire ou à d'autres mesures conformément au point a) qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'HVCK;
(c) | the restocking has only taken place when all farms officially declared infected have been emptied, cleansed, disinfected and fallowed/been subject to alternative measures in accordance with (a).c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).c) | le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a).
II.   Diagnostic and sampling methods for surveillance to obtain and maintain disease-free status with regard to KHVDII.   Diagnose- og prøveudtagningsmetoder i forbindelse med overvågning for at opnå og opretholde status som sygdomsfri for så vidt angår KHVDII.   Méthodes de diagnostic et d'échantillonnage pour la surveillance visant à l'obtention et au maintien du statut «indemne de maladie» en ce qui concerne l'HVCK
II.1.   SamplesII.1.   PrøverII.1.   Échantillons
The tissue material to be examined shall be parts of gill and kidney. Organ pieces from a maximum of two fish may be pooled.Det vævsmateriale, der skal undersøges, skal bestå af dele af gæller og nyre. Organstykker fra højst to fisk kan udgøre en samleprøve.Les tissus à examiner sont prélevés sur les branchies et les reins. Il est possible de regrouper des fragments d'organes provenant de deux poissons au maximum.
II.2.   Diagnostic methods for the surveillance to obtain and maintain disease-free status with regard to KHVDII.2.   Diagnosemetoder i forbindelse med overvågning for at opnå og opretholde status som sygdomsfri for så vidt angår KHVDII.2.   Méthodes de diagnostic pour la surveillance visant à l'obtention et au maintien du statut «indemne de maladie» en ce qui concerne l'HVCK
The diagnostic method to achieve or to maintain disease-free status for KHVD shall be Real-time PCR (qPCR) in accordance with the detailed diagnostic methods and procedures as set out in point II of Part 2 of Annex II.Diagnosemetoden med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår KHVD skal være realtids-PCR (qPCR) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 2, punkt II.La méthode de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'HVCK est l'amplification en chaîne par polymérase en temps réel (qPCR), conformément aux méthodes et procédures de diagnostic détaillées qui figurent à l'annexe II, partie 2, point II.
III.   Diagnostic and sampling methods for official investigations for confirmation or to rule out a suspicion of KHVDIII.   Diagnose- og prøveudtagningsmetoder i forbindelse med officielle undersøgelser med henblik på at bekræfte eller udelukke mistanke om KHVDIII.   Méthodes de diagnostic et d'échantillonnage pour les enquêtes officielles destinées à confirmer ou à écarter une suspicion d'HVCK
III.1.   SamplesIII.1.   PrøverIII.1.   Échantillons
The tissue material to be examined shall be parts of gill and kidney. Organ pieces from a maximum of two fish may be pooled.Det vævsmateriale, der skal undersøges, skal bestå af dele af gæller og nyre. Organstykker fra højst to fisk kan udgøre en samleprøve.Les tissus à examiner sont prélevés sur les branchies et les reins. Il est possible de regrouper des fragments d'organes provenant de deux poissons au maximum.
III.2.   Official investigation and diagnostic methods to rule out and to confirm the presence of infection with KHVIII.2.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke og bekræfte forekomst af infektion med KHVIII.2.   Méthodes d'enquête officielle et de diagnostic pour exclure ou confirmer la présence d'une infection par l'HVK
When a suspicion of KHVD is required to be confirmed or ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedure shall be complied with:Hvis mistanke om forekomst af KHVD skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'HVCK conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:
(a) | the official investigation shall include at least one health inspection and one sampling of 10 fish, when clinical signs or post-mortem signs consistent with infection with KHV are observed or 30 fish when clinical or post-mortem signs are not observed. Samples shall be tested using the diagnostic method set out in point (b) in accordance with the detailed diagnostic methods and procedures set out in point II of Part 2 of Annex II;a) | Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med KHV, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af diagnosemetoden i litra b) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 2, punkt II.a) | l'enquête officielle doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 poissons en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par l'HVK, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés à l'aide de la méthode de diagnostic indiquée au point b) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 2, point II;
(b) | the presence of the infection with KHV shall be considered as confirmed if KHV is detected by PCR; | suspicion of KHVD may be ruled out, if this test reveals no further evidence of the presence of KHV.b) | Forekomst af infektion med KHV betragtes som bekræftet, hvis KHV påvises ved PCR; | mistanke om forekomst af KHVD kan udelukkes, hvis denne undersøgelse ikke afslører yderligere tegn på forekomst af KHV.b) | la présence de l'infection par l'HVK doit être considérée comme confirmée si l'HVK est détecté par PCR; | une suspicion d'HVCK peut être écartée si les résultats de cet essai n'apportent aucun élément supplémentaire prouvant la présence de l'HVK.
Table 2.ATabel 2.ATableau 2.A
Surveillance scheme for zones and compartments for the 2-year control period which precedes the achievement of disease-free status for KHVD as referred to in point I.2.1Overvågningsordning for zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår KHVD, jf. punkt I.2.1Programme de surveillance des zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'HVCK visée au point I.2.1
  |   | Number of clinical inspections per year (2 years) | Number of laboratory examinations per year (2 years) | Number of fish in the sample  |   | Antal kliniske inspektioner pr. år (i to år) | Antal laboratorieundersøgelser pr. år (i to år) | Antal fisk i prøven  |   | Nombre d'inspections cliniques par an (sur deux ans) | Nombre d'examens de laboratoire par an (sur deux ans) | Nombre de poissons par échantillon
Farms/sampling sites | First 2 years of the surveillance period | 2 | 2 | 75 (10)Akvakulturbrug/prøveudtagningssteder | De første to år i overvågningsperioden | 2 | 2 | 75 (10)Fermes aquacoles/sites de prélèvement | Deux premières années de la période de surveillance | 2 | 2 | 75 (10)
  | Maximum number of fish per pool: 2  | Maksimalt antal fisk pr. samleprøve: 2  | Nombre maximal de poissons par regroupement: 2
Table 2.BTabel 2.BTableau 2.B
Surveillance scheme for zones and compartments for the 4-year control period which precedes the achievement of disease-free status for KHVD as referred to in point I.2.1Overvågningsordning for zoner og segmenter i den fireårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår KHVD, jf. punkt I.2.1Programme de surveillance des zones et compartiments pour la période de quatre ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'HVCK visée au point I.2.1
  |   | Number of clinical inspections per year | Number of laboratory examinations per year | Number of fish in the sample  |   | Antal kliniske inspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal fisk i prøven  |   | Nombre d'inspections cliniques par an | Nombre d'examens de laboratoire par an | Nombre de poissons par échantillon
Farms/sampling sites | First 2 years of the surveillance period | 1 | 1 | 30Akvakulturbrug/prøveudtagningssteder | De første to år i overvågningsperioden | 1 | 1 | 30Fermes aquacoles/sites de prélèvement | Deux premières années de la période de surveillance | 1 | 1 | 30
Farms/sampling sites | Last 2 years of the surveillance period | 2 | 2 | 30Akvakulturbrug/prøveudtagningssteder | De sidste to år i overvågningsperioden | 2 | 2 | 30Fermes aquacoles/sites de prélèvement | Deux dernières années de la période de surveillance | 2 | 2 | 30
  | Maximum number of fish per pool: 2  | Maksimalt antal fisk pr. samleprøve: 2  | Nombre maximal de poissons par regroupement: 2
Table 2.CTabel 2.CTableau 2.C
Surveillance schemes for zones or compartments to maintain disease-free status for KHVD as referred to in point I.3Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår KHVD, jf. punkt I.3Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'HVCK visé au point I.3
Risk level | Number of health inspections | Number of fish in the sampleRisikoniveau | Antal sundhedsinspektioner | Antal fisk i prøvenNiveau de risque | Nombre d'inspections sanitaires | Nombre de poissons par échantillon
High | 2 every year | 30Højt | 2 pr. år | 30Élevé | Deux par an | 30
Medium | 1 every year | 30Middel | 1 pr. år | 30Moyen | Une par an | 30
Low | 1 every 2 years | 30Lavt | 1 hvert 2. år | 30Faible | Une tous les deux ans | 30
Maximum number of fish per pool: 2Maksimalt antal fisk pr. samleprøve: 2Nombre maximal de poissons par regroupement: 2
Table 2.DTabel 2.DTableau 2.D
Surveillance scheme to maintain KHVD disease-free status in Member States, zones or compartments where the number of farms is limited and targeted surveillance on these farms does not provide sufficient epidemiological data as referred to in point I.3Overvågningsordning med henblik på at opretholde status som sygdomsfri for så vidt angår KHVD i medlemsstater, zoner eller segmenter, hvor der er et begrænset antal akvakulturbrug, og hvor målrettet overvågning på disse brug ikke giver tilstrækkelige epidemiologiske data, jf. punkt I.3Programme de surveillance en vue du maintien du statut «indemne de maladie» en ce qui concerne l'HVCK dans des États membres, zones ou compartiments comptant un nombre limité de fermes aquacoles dont la surveillance ciblée ne permet pas d'obtenir suffisamment de données épidémiologiques visé au point I.3
  | Number of clinical inspections per year | Number of laboratory examinations per year | Number of fish in the sample  | Antal kliniske inspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal fisk i prøven  | Nombre d'inspections cliniques par an | Nombre d'examens de laboratoire par an | Nombre de poissons par échantillon
Sampling points | 1 every 2 years | 1 every 2 years | 30Prøveudtagningssteder | 1 hvert 2. år | 1 hvert 2. år | 30Points de prélèvement | Une tous les deux ans | Un tous les deux ans | 30
Maximum number of fish per pool: 2Maksimalt antal fisk pr. samleprøve: 2Nombre maximal de poissons par regroupement: 2
PART 3DEL 3PARTIE 3
SURVEILLANCE AND CONTROL METHODS FOR INFECTIOUS SALMON ANEMIA (ISA)OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTIØS LAKSEANÆMI (ISA)SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'ANÉMIE INFECTIEUSE DU SAUMON (AIS)
I.   Requirements for surveillance and eradication programmes to obtain and to maintain disease-free health statuses with regard to ISA and to contain infection with HPR deleted ISAVI.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår ISA og foranstaltninger mod spredning af infektion med HPR-deleteret ISAVI.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'AIS ainsi que des mesures de confinement destinées à lutter contre l'infection par des variants délétés dans la région hautement polymorphe (RHP) du virus de l'AIS (VAIS)
I.1.   General requirementsI.1.   Generelle kravI.1.   Exigences générales
When health inspections and sampling of farms in accordance with the second paragraph of point 2 of part I of Annex V to Directive 2006/88/EC is required to be carried out more than once per year, the intervals between the health inspections or collection of samples shall be as long as possible.Hvis der i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF skal foretages sundhedsinspektioner og prøveudtagninger på akvakulturbrug mere end én gang om året, skal der være så lang tid som muligt mellem sundhedsinspektionerne eller prøveudtagningerne.Lorsque des fermes aquacoles doivent, plus d'une fois par an, faire l'objet d'inspections sanitaires et d'échantillonnages conformément aux dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, l'intervalle entre les inspections sanitaires ou entre chaque prélèvement d'échantillons doit être aussi long que possible.
When targeted surveillance in wild populations is required in accordance with the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the number and geographical distribution of sampling points shall be determined to obtain a reasonable coverage of the Member State, zone or compartment. The sampling points shall also be representative of the different ecosystems where the wild susceptible populations are located.Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal ligeledes være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende modtagelige populationer.Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant des populations sauvages sensibles.
The health inspections shall be carried out in all production units, such as ponds, tanks and net cages, for the presence of dead, weak or abnormally behaving fish. Particular attention shall be paid to the water outlet area where weak fish tend to accumulate because of the water current.Alle produktionsenheder som f.eks. damme og tanke skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd. Opmærksomheden skal navnlig rettes mod vandudledningsområdet, hvor de svage fisk har tendens til at samles på grund af vandstrømmen.Des inspections sanitaires doivent être effectuées dans toutes les unités de production, telles que les étangs, les viviers et les cages en filet en vue d'établir la présence de poissons morts, faibles ou au comportement anormal. Une attention particulière doit être accordée au point d'évacuation des eaux, où les poissons faibles ont tendance à s'accumuler en raison du courant.
The fish to be collected as samples shall be selected as follows:De fisk, der skal indsamles som prøver, udvælges på følgende måde:Les poissons à inclure dans les échantillons sont sélectionnés comme suit:
(a) | only moribund or freshly dead fish, but not decomposed fish shall be selected; in particular fish demonstrating anaemia, bleedings or other clinical signs suggesting circulatory disturbances shall be prioritised for collection;a) | Kun døende eller nyligt døde fisk (som ikke er gået i opløsning) udvælges; navnlig fisk med tegn på anæmi, blødninger eller med andre kliniske tegn, der tyder på kredsløbsforstyrrelser, skal prioriteres i forbindelse med udvælgelsen.a) | seuls les poissons moribonds ou qui viennent de mourir et ne sont pas encore décomposés doivent être sélectionnés; en particulier, les poissons présentant une anémie, des saignements ou d'autres signes cliniques évoquant des troubles circulatoires doivent être prélevés en priorité;
(b) | if Atlantic salmon is among the susceptible species on the site, samples from Atlantic salmon shall be prioritised. If there is no Atlantic salmon in the fish farm, other susceptible species must be sampled;b) | Hvis atlantisk laks er blandt de modtagelige arter på stedet, skal prøver fra atlantisk laks prioriteres. Hvis der ikke er atlantisk laks på akvakulturbruget, udtages prøver af andre modtagelige arter.b) | si le saumon de l'Atlantique fait partie des espèces sensibles présentes sur le site, des échantillons de saumon de l'Atlantique doivent être prélevés en priorité. En l'absence de saumon de l'Atlantique dans la ferme piscicole, d'autres espèces sensibles doivent faire l'objet d'un échantillonnage;
(c) | if more than one water source is utilised for fish production, fish representing all water sources shall be included in the sample;c) | Ved benyttelse af mere end én vandkilde til fiskeproduktion skal der medtages fisk fra alle vandkilder i prøven.c) | si plus d'une source d'eau est utilisée pour la production des poissons, des poissons représentatifs de toutes les sources d'eau doivent être inclus dans l'échantillon.
(d) | the fish selected shall include fish collected in such a way that all production units, such as net cages, tanks and ponds, of the farm as well as all year classes are proportionally represented in the sample.d) | De udvalgte fisk skal omfatte fisk, der indsamles på en sådan måde, at alle produktionsenheder som f.eks. netbure, tanke og damme og alle årgange er proportionalt repræsenteret i prøven.d) | les poissons sélectionnés doivent inclure des poissons collectés de telle manière que toutes les unités de production, telles que les cages en filet, les viviers et les étangs, de la ferme aquacole ainsi que toutes les classes d'âge annuelles soient représentées proportionnellement dans l'échantillon.
I.2.   Specific requirements to achieve Category I health status with regard to ISAI.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår ISAI.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne l'AIS
I.2.1.   Surveillance programmesI.2.1.   OvervågningsprogrammerI.2.1.   Programmes de surveillance
A Member State, zone or compartment which has Category III health status in accordance with part B of Annex III to Directive 2006/88/EC with regard to ISA may achieve Category I health status with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment meet the relevant requirements set out in Annex V to that Directive and all those farms and, when required by the second paragraph of point 2 of Part I of Annex V thereto, sampling points in wild populations selected in accordance with that point, have been subject to the following surveillance programme:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår ISA, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i medlemsstaten, zonen eller segmentet opfylder de relevante krav i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktivet, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte punkt, har været omfattet af følgende overvågningsprogram:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III tel que visé à l'annexe III, partie B, de la directive 2006/88/CE en ce qui concerne l'AIS peut obtenir le statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment satisfont aux exigences définies à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe de cette directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément audit point, ont fait l'objet du programme de surveillance suivant:
(a) | the farms or sampling points have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 3.A set out in Section II;a) | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 3.A i afsnit II.a) | les fermes aquacoles ou les points de prélèvement ont fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 3.A de la section II;
(b) | during that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 must have produced negative results for HPR-deleted ISAV and any suspicion of ISA must have been ruled out in accordance with the diagnostic methods set out in point II.3;b) | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for HPR-deleteret ISAV, og enhver mistanke om ISA skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.b) | au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour les variants délétés dans la RHP du VAIS et toute suspicion d'AIS doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3.
(c) | if during the implementation of the surveillance programme, ISA is confirmed in a farm included in that surveillance programme, and therefore its Category II health status has been withdrawn, an eradication programme in accordance with point I.2.2 must have been carried out.c) | Hvis det i forbindelse med gennemførelsen af overvågningsprogrammet bekræftes, at der er ISA på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og dets sundhedsstatus i kategori II derfor er blevet trukket tilbage, skal der være blevet gennemført et udryddelsesprogram i overensstemmelse med punkt I.2.2.c) | Si, au cours de la mise en œuvre du programme de surveillance, l'AIS est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, un programme d'éradication doit avoir été mis en œuvre conformément au point I.2.2.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
I.2.2.1.   General requirementsI.2.2.1.   Generelle kravI.2.2.1.   Exigences générales
A Member State, zone or a compartment that has Category V health status with regard to ISA may achieve Category I health status with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment have been subject to an eradication programme that complies with the following points (a) to (e).En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår ISA, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af et udryddelsesprogram, der opfylder følgende litra a)-e):Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'ISA peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet d'un programme d'éradication conforme aux points a) à e) suivants:
(a) | the minimum control measures laid down in Section 3 of Chapter V of Directive 2006/88/EC have effectively been applied, and in particular a containment area as referred to in Article 32(b) of that Directive, comprising a protection zone and surveillance zone, has been established in the vicinity of the farm(s) officially declared infected with HPR-deleted ISAV or confirmed ISA. | The containment area must have been defined on a case-by-case basis taking into account factors influencing the risks for the spread of ISA to farmed or wild fish, such as: the number, rate and distribution of the mortality of fish on the farm infected with HPR-deleted ISAV or confirmed ISA; the distance and density of neighbouring farms; the proximity to slaughterhouses; contact farms; the species present at the farms; the farming practices applied in the affected and neighbouring farms; the hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply as regards the geographical demarcation of those zones: | (i) | a protection zone shall be established in the immediate vicinity of a farm officially declared infected with ISA and shall correspond to: | (1) | in coastal areas: an area included in a circle with a radius of at least one tidal excursion or at least 5 km, whichever is larger, centred on the farm officially declared infected with ISA, or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; | (2) | in inland areas: the entire water catchment area of the farm officially declared infected with ISA; the competent authority may limit the extension of the zone to parts of the water catchment area provided that the prevention of the spread ISA is not compromised; | (ii) | a surveillance zone shall be established outside the protection zone and shall correspond to: | (1) | in coastal areas: an area, surrounding the protection zone, of overlapping tidal excursion zones; or an area, surrounding the protection zone, and included in a circle of radius 10 km from the centre of the protection zone; or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; or | (2) | in inland areas: an extended area outside the established protection zone;a) | De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af ISA til opdrættede eller vildtlevende fisk som f.eks.: antal, procentdel og fordeling af døde fisk på det akvakulturbrug, der er inficeret med HPR-deleteret ISAV eller bekræftet ISA, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med ISA, og den skal svare til: | 1) | i kystområder: et område i en cirkel med en radius, der mindst svarer til én tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum på det akvakulturbrug, der officielt er erklæret inficeret med ISA, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data | 2) | i områder inde i landet: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med ISA; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af ISA. | ii) | Der skal oprettes en overvågningszone uden om beskyttelseszonen, og den skal svare til: | 1) | i kystområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller | 2) | i områder inde i landet: et udvidet område uden om den oprettede beskyttelseszone.a) | les mesures minimales de lutte prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS, ou dans lesquelles la présence de l'AIS a été confirmée. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de transmission de l'AIS aux poissons d'élevage et aux poissons sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des poissons dans la ferme aquacole infectée par des variants délétés dans la RHP du VAIS ou dans laquelle la présence de l'AIS a été confirmée, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, la proximité des abattoirs, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes s'appliquent en ce qui concerne la délimitation géographique de ces périmètres: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par l'AIS, et doit correspondre: | 1. | dans les zones côtières: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par l'AIS, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées; | 2. | à l'intérieur des terres: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par l'AIS; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de l'AIS; | ii) | un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre: | 1. | dans les zones côtières: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées ou | 2. | à l'intérieur des terres: à une zone étendue située au-delà du périmètre de protection établi;
(b) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with ISA shall be subject to an official investigation comprising at least the following elements: | (i) | the collection of samples for testing of minimum 10 moribund fish, when clinical signs or post-mortem signs consistent with ISA are observed, or minimum 30 fish when no clinical or post mortem signs are observed; | (ii) | one health inspection; in those farms where the tests referred to in (i) have produced negative results, the health inspections shall continue once per month until the protection zone is withdrawn in accordance with point I.2.2.1(c);b) | På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med ISA, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer: | i) | indsamling af prøver med henblik på undersøgelse af mindst 10 døende fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på ISA, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund. | ii) | én sundhedsinspektion; på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater, skal der fortsat foretages sundhedsinspektioner én gang om måneden, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).b) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par l'AIS doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants: | i) | un prélèvement d'échantillons en vue de la réalisation de tests sur 10 poissons moribonds en cas de signes cliniques ou de signes post-mortem compatibles avec l'AIS, ou sur 30 poissons en l'absence de signes cliniques ou de signes post mortem; | ii) | une inspection sanitaire; dans les fermes aquacoles dans lesquelles les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);
(c) | all farms officially declared infected with HPR-deleted ISAV or confirmed ISA shall be emptied, cleansed, disinfected and fallowed for a period of at least 3 months. The protection and surveillance zones may be lifted when all farms within the protection zone are emptied, cleaned, disinfected and followed by a synchronized fallowing period of at least 6 weeks. | When fallowing of the officially declared infected farms is carried out, the protection zones shall be converted into surveillance zones. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms within the established protection and surveillance zones. The length of the fallowing period for those farms shall be determined by the competent authority following a case-by-case risk evaluation;c) | Alle akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA, skal tømmes, rengøres, desinficeres og udtages af drift i mindst tre måneder. Beskyttelses- og overvågningszonerne kan ophæves, når alle akvakulturbrug i beskyttelseszonen er tømt, rengjort og desinficeret og derpå samtidigt har været udtaget af drift i mindst seks uger. | Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse akvakulturbrug skal være udtaget af drift.c) | toutes les fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS ou dans lesquelles la présence de l'AIS a été confirmée doivent être vidées de leurs poissons, nettoyées et désinfectées et une période de vide sanitaire d'au moins trois mois doit être observée. Les périmètres de protection et de surveillance peuvent être levés lorsque toutes les fermes aquacoles situées à l'intérieur du périmètre de protection ont été vidées de leurs poissons, nettoyées et désinfectées et qu'une période de vide sanitaire synchronisé d'au moins six semaines a été respectée. | Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs poissons, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. Pour ces fermes, la durée de la période de vide sanitaire est déterminée par l'autorité compétente, sur la base d'une évaluation des risques au cas par cas;
(d) | all farms officially declared infected with HPR-deleted ISAV or confirmed ISA and all other farms fallowed within the established protection and surveillance zones shall be restocked with fish sourced from Member States, zones or compartments with a Category I with regard to ISA. | Restocking shall only take place when all farms officially declared infected have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2.1(c);d) | På alle akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA, og på alle andre akvakulturbrug, der er udtaget af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af fisk ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår ISA. | Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).d) | toutes les fermes aquacoles officiellement déclarées infectées par des variants délétés dans la RHP du VAIS ou dans lesquelles la présence de l'AIS a été confirmée et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire situées à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'ISA. | Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1 c);
(e) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the member State, zone or compartment covered by the eradication programme and when surveillance in wild populations is required, sampling points selected in accordance with point I.1, shall subsequently be subject to the surveillance scheme set out in point I.2.1.e) | Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1.e) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément au point I.1 doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1.
I.2.2.2.   Requirements concerning regaining disease-free status for continental compartments comprising one single farm that was previously declared as having Category I health statusI.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, som tidligere har haft en sundhedsstatus i kategori II.2.2.2.   Exigences à respecter pour retrouver le statut «indemne de maladie» dans le cas des compartiments continentaux comptant une seule ferme aquacole ayant précédemment bénéficié du statut sanitaire de catégorie I
A continental compartment comprising one single farm that has Category I health status with regard to ISA, whose health status is independent of the surrounding natural waters in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC, and whose Category I health status has been withdrawn in accordance with Article 53(3) of that Directive, may regain it again immediately after the competent authority has confirmed that it complies with the following conditions:Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår ISA, og hvis sundhedsstatus er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at det opfylder følgende betingelser:Un compartiment continental comptant une seule ferme aquacole jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'AIS, dont le statut sanitaire est indépendant de celui des eaux naturelles avoisinantes conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer le statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de cette directive, peut retrouver ce statut dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:
(a) | it has been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period shall be at least 6 weeks;a) | Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.a) | il a été vidé de ses poissons, nettoyé, désinfecté et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;
(b) | it has been restocked with fish sourced from Member States, zones or compartments with a Category I health status as regards ISA.b) | Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår ISA.b) | il a été repeuplé avec des poissons provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'AIS.
I.3.   Minimum control measures for the maintenance of Category I status with regard to ISAI.3.   Minimumsbekæmpelsesforanstaltninger for opretholdelse af en sundhedsstatus i kategori I for så vidt angår ISAI.3.   Exigences minimales pour le maintien du statut sanitaire de catégorie I en ce qui concerne l'AIS
When targeted surveillance is required to maintain Category I health status, as provided for in Article 52 of Directive 2006/88/EC, all farms keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment concerned shall be subject to health inspections and sampled in accordance with Table 3.B (11) set out in Section II of this Part, taking into account the risk level of the farm for the contraction of ISA.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 3.B (11) i afsnit II i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af ISA.Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 3.B (11) figurant à la section II de la présente partie, compte tenu du risque de propagation de l'AIS à la ferme aquacole.
When determining the health inspection frequency for category I health status with regard to ISA for compartments which are placed in continental areas and where the health status with regard to ISA is dependent of the health status of surrounding natural waters that are housing Atlantic salmon (Salmo salar), the risk for the contraction of ISA shall be regarded as high.Ved fastlæggelsen af hyppigheden af sundhedsinspektioner for segmenter med en sundhedsstatus i kategori I for så vidt angår ISA, som er placeret i indlandsområder, og hvis sundhedsstatus for så vidt angår ISA er afhængig af sundhedsstatussen i de omkringliggende naturlige vandområder, der huser atlantisk laks (Salmo salar), anses risikoen for indslæbning af ISA for at være høj.Lors de la détermination de la fréquence des inspections sanitaires dans les compartiments jouissant du statut sanitaire de catégorie I en ce qui concerne l'AIS qui se trouvent dans des zones continentales et dont le statut sanitaire en ce qui concerne l'AIS dépend du statut sanitaire des eaux naturelles avoisinantes abritant le saumon de l'Atlantique (Salmo salar), le risque de transmission de l'AIS doit être considéré comme élevé.
Disease-free status with regard to ISA may only be maintained as long as all samples tested using the diagnostic methods set out in point II.2 have produced negative results for HPR-deleted ISAV and any suspicion of ISA has been ruled out in accordance with the diagnostic methods set out in point II.3.Statussen som sygdomsfri for så vidt angår ISA opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for HPR-deleteret ISAV, og enhver mistanke om ISA er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.Le statut «indemne de maladie» en ce qui concerne l'AIS ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour les variants délétés dans la RHP du VAIS, et que toute suspicion d'AIS a été écartée conformément aux méthodes de diagnostic établies au point II.3.
I.4.   Specific requirements to achieve Category III health status with regard to HPR-deleted ISAV in Member States, zones or compartments that previously held Category V health statusI.4.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori III for så vidt angår HPR-deleteret ISAV i medlemsstater, zoner eller segmenter, der hidtil har haft en sundhedsstatus i kategori VI.4.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie III en ce qui concerne l'infection par des variants délétés dans la RHP du VAIS dans des États membres, des zones ou des compartiments ayant un statut sanitaire de catégorie V
A Member State, zone or compartment that has Category V health status with regard to ISA may achieve Category III status provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår ISA, kan opnå en sundhedsstatus i kategori III, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'AIS peut obtenir le statut sanitaire de catégorie III à condition que:
(a) | the requirements set out in point I.2.2.1 (a), (b) and (c) have been met. In case fallowing is not technically possible, the farms shall be subject to an alternative measure which provides almost similar guarantee for extermination of ISAV from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at ISAV er udryddet i brugets miljøa) | Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du VAIS de l'environnement de la ferme aquacole;
(b) | all farms officially declared infected and all other farms fallowed or been subject to alternative measures in accordance with (a) within the protection and surveillance zones established, have been restocked with fish sourced from Member States, zones or compartments with a Category I, II or III health status with regard to ISA;b) | nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre brug, der er udtaget af drift eller har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår ISAb) | toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) qui sont situées à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des poissons provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'AIS;
(c) | that such restocking has only taken place after all farms officially declared infected have been emptied, cleansed, disinfected and fallowed/been subject to alternative measures in accordance with (a).c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a)c) | le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées ont été vidées de leurs poissons, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a);
(d) | no confirmation of HPR-deleted ISAV has occurred during the period of 2 years that follows the completion of the measures referred to in (a), (b) and (c), and suspicions during this period have been ruled out in accordance with the procedures established in point II.3.d) | der ikke har været bekræftet HPR-deleteret ISAV i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.d) | aucune infection par des variants délétés dans la RHP du VAIS n'ait pas été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion durant cette période ait été écartée conformément aux procédures établies au point II.3.
II.   Diagnostic methods and official investigationsII.   Diagnosemetoder og officielle undersøgelserII.   Méthodes de diagnostic et enquêtes officielles
II.1.   SamplesII.1.   PrøverII.1.   Échantillons
The tissue material to be examined shall be:Følgende vævsmateriale undersøges:Les tissus à examiner sont:
(a) | Histology: head-kidney, liver, heart, pancreas, intestine, spleen and gill;a) | histologi: hovednyre, lever, hjerte, bygspytkirtel, tarm, milt og gællera) | histologie: rein antérieur, foie, cœur, pancréas, intestins, rate et branchies;
(b) | Immunohistochemistry: mid-kidney and heart including valves and bulbus arteriosus;b) | immunhistokemi: mellemnyre og hjerte inklusive hjerteklapper og bulbus arteriosusb) | immunohistochimie: rein médian et cœur, y compris les valves et le bulbe artériel;
(c) | RT-qPCR analysis: mid-kidney and heart;c) | RT-qPCR-analyse: mellemnyre og hjertec) | analyse par RT-qPCR: rein médian et cœur;
(d) | Virus culture: mid-kidney, heart, liver and spleen.d) | viruskultur: mellemnyre, hjerte, lever og milt.d) | culture du virus: rein médian, cœur, foie et rate.
Organ pieces from a maximum of five fish may be pooled.Organstykker fra højst fem fisk kan udgøre en samleprøve.Il est possible de regrouper des fragments d'organes provenant de cinq poissons au maximum.
II.2.   Diagnostic methods to obtain or maintain disease-free status with regard to ISAII.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår ISAII.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'AIS
The diagnostic method to be used to obtain or to maintain disease-free status with regard to ISA in accordance with points I.2 and I.3 shall be RT-qPCR, followed by sequencing of positive samples in accordance with the detailed methods and procedures set out in Part 3 of Annex II.De diagnosemetoder, der skal anvendes for at opnå eller opretholde status som sygdomsfri for så vidt angår ISA i overensstemmelse med punkt I.2 og I.3, er RT-qPCR efterfulgt af sekventering af positive prøver i overensstemmelse med de detaljerede metoder og procedurer i bilag II, del 3.La méthode de diagnostic à utiliser en vue de l'obtention ou du maintien du statut «indemne de maladie» en ce qui concerne l'AIS conformément aux points I.2 et I.3 est l'analyse par RT-qPCR suivie du séquençage des échantillons positifs conformément aux méthodes et procédures détaillées décrites à l'annexe II, partie 3.
In the case of a positive result to RT-qPCR, further samples shall be tested before the implementation of the initial control measures provided for in Article 28 of Directive 2006/88/EC.I tilfælde af et positivt resultat af RT-qPCR skal yderligere prøver undersøges før gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF.En cas de résultat positif à l'issue de l'analyse par RT-qPCR, d'autres échantillons doivent être testés avant la mise en œuvre des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE.
Those samples shall be tested as follows in accordance with the detailed methods and procedures set out in Part 3 of Annex II:Disse prøver skal undersøges som følger i overensstemmelse med de detaljerede metoder og procedurer, der er fastsat i bilag II, del 3:Ces échantillons doivent être testés comme suit, conformément aux méthodes et procédures détaillées décrites à l'annexe II, partie 3:
(a) | screening of the samples by RT-qPCR, including sequencing of the HE-gene to verify HPR-deletion; | anda) | screening af prøverne ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR | oga) | examen des échantillons par RT-qPCR puis séquençage du gène HE pour vérifier les délétions dans la RHP | et
(b) | examination in tissue preparations by means of specific antibodies against ISAV (namely IHC on fixed sections or IFAT on tissue imprints); orb) | undersøgelse i vævspræparater ved hjælp af specifikke antistoffer mod ISAV (dvs. IHC på fikserede snit eller IFAT på vævsaftryk) ellerb) | examen sur préparations tissulaires à l'aide d'anticorps spécifiques dirigés contre le virus de l'AIS (à savoir IHC sur coupes fixées ou test IFAT sur empreintes tissulaires); ou
(c) | isolation and identification of ISAV in cell culture from at least one sample from any fish sampled from the farm.c) | isolation og identifikation af ISAV i cellekultur fra mindst én prøve af en hvilken som helst fisk på bruget.c) | isolement et identification du virus de l'AIS dans une culture de cellules provenant d'au moins un échantillon prélevé sur n'importe quel poisson issu de la ferme aquacole.
II.3.   Official investigation and diagnostic methods to rule out or to confirm the presence of ISAII.3.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke eller bekræfte forekomst af ISAII.3.   Méthodes d'enquête officielle et de diagnostic pour exclure ou confirmer la présence de l'AIS
When a suspicion of ISA shall be confirmed or ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedure shall be complied with:Når mistanke om forekomst af ISA skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'AIS conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:
(a) | the official investigation which shall include at least one health inspection and one sampling of 10 moribund fish, when clinical signs or post-mortem signs consistent with ISA are observed. If no clinical signs or post-mortem signs consistent with ISA are observed, the health inspection shall be followed by targeted sampling of minimum 30 moribund fish or fresh post-mortems with normal constitution in accordance with point I.1. Samples shall be tested in accordance with the diagnostic methods set out in point (b);a) | Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 døende fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på ISA. Hvis der ikke konstateres kliniske tegn eller obduktionsfund, der tyder på ISA, skal sundhedsinspektionen følges af målrettet prøveudtagning af mindst 30 døende fisk eller nyligt døde fisk med normal konstitution i overensstemmelse med punkt I.1. Prøverne undersøges i overensstemmelse med diagnosemetoderne i litra b).a) | l'enquête officielle, qui doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 poissons moribonds en cas de signes cliniques ou de signes post mortem compatibles avec l'AIS. En l'absence de signe clinique ou post mortem compatible avec l'AIS, l'inspection sanitaire doit être suivie d'un échantillonnage ciblé sur au moins 30 poissons moribonds ou morts depuis peu mais de constitution normale conformément au point I.1. Les échantillons doivent être testés conformément aux méthodes de diagnostic établies indiquées au point b);
(b) | in the case of a positive result of RT-qPCR for HPR-deleted ISAV, further samples shall be tested before the implementation of the initial control measures provided in Article 28 of Directive 2006/88/EC. A suspected case of infection with ISA shall be confirmed in accordance with the following criteria using the detailed methods and procedures set out in Part 3 of Annex II: | (i) | Detection of ISAV by RT-qPCR, including sequencing of the HE-gene to verify HPR-deletion, and detection of ISAV in tissue preparations by means of specific antibodies against ISAV (namely IHC on fixed sections or IFAT on tissue imprints) | or | (ii) | detection of ISAV by RT-qPCR, including sequencing of the HE-gene to verify HPR-deletion, and | isolation and identification of ISAV in cell culture from at least one sample from any fish from the farm;b) | I tilfælde af et positivt resultat af RT-qPCR for HPR-deleteret ISAV skal yderligere prøver undersøges før gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF. Mistanke om infektion med ISA skal bekræftes i overensstemmelse med følgende kriterier ved hjælp af de detaljerede metoder og procedurer, der er fastsat i bilag II, del 3: | i) | påvisning af ISAV ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR, og påvisning af ISAV i vævspræparater ved hjælp af specifikke antistoffer mod ISAV (dvs. IHC på fikserede snit eller IFAT på vævsaftryk) | eller | ii) | påvisning af ISAV ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR, og | isolation og identifikation af ISAV i cellekultur fra mindst én prøve af en hvilken som helst fisk på bruget.b) | en cas de résultat positif pour les variants délétés dans la RHP du VAIS à l'issue de l'analyse par RT-qPCR, d'autres échantillons doivent être testés avant la mise en œuvre des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE. Les suspicions d'infection par le VAIS doivent être confirmées conformément aux critères ci-après, suivant les méthodes et procédures détaillées décrites à l'annexe II, partie 3: | i) | détection du VAIS par RT-qPCR avec séquençage du gène HE pour vérifier les délétions dans la RHP, et détection du VAIS dans des préparations tissulaires à l'aide d'anticorps spécifiques dirigés contre le VAIS (à savoir IHC sur coupes fixées ou test IFAT sur empreintes tissulaires) | ou | ii) | détection du VAIS par RT-qPCR avec séquençage du gène HE pour vérifier les délétions dans la RHP, et | isolement et identification du VAIS dans une culture de cellules provenant d'au moins un échantillon prélevé sur n'importe quel poisson issu de la ferme aquacole;
(c) | where the presence of clinical, gross pathological changes or histopathological findings consistent with ISA are observed, the findings must be corroborated by virus detection by two diagnostic methods with independent principles of detection, such as RT-qPCR and IHC, in accordance with Part 3 of Annex II. | The suspicion of ISA may be ruled out, if tests and inspections over a period of 12 months from the date of the suspicion are found to reveal no further evidence of the presence of ISA.c) | Hvis der konstateres kliniske, tydelige patologiske forandringer eller histopatologiske fund, der tyder på ISA, skal fundene bekræftes ved viruspåvisning ved hjælp af to diagnosemetoder med selvstændige påvisningsprincipper, f.eks. RT-qPCR og IHC, i overensstemmelse med bilag II, del 3. | Mistanke om ISA kan udelukkes, hvis undersøgelser og inspektioner i en periode på 12 måneder fra datoen for mistanken ikke afslører yderligere tegn på forekomst af ISA.c) | lorsque des modifications cliniques, macropathologiques ou histopathologiques compatibles avec l'AIS sont constatées, ces constatations doivent être corroborées par la détection du virus par deux méthodes de diagnostic reposant sur des principes de détection distincts, telles que la RT-qPCR et l'IHC, conformément à l'annexe II, partie 3. | Une suspicion d'AIS peut être écartée lorsqu'il est établi, à l'issue des tests et inspections réalisés sur une période de 12 mois à partir de la date à laquelle est née la suspicion, qu'aucun élément supplémentaire ne prouve la présence de l'AIS.
Table 3.ATabel 3.ATableau 3.A
Surveillance scheme for zones and compartments for the 2-year control period which precedes the achievement of disease-free status for ISA as referred to in point I.2.1Overvågningsordning for zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår ISA, jf. punkt I.2.1Programme de surveillance des zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'AIS visée au point I.2.1.
Year of surveillance | Number of health inspections per year (2 years) | Number of laboratory examinations per year (2 years) | Number of fish to be sampled per yearOvervågningsår | Antal sundhedsinspektioner pr. år (i to år) | Antal laboratorieundersøgelser pr. år (i to år) | Antal fisk til prøveudtagning pr. årAnnée de surveillance | Nombre d'inspections sanitaires par an (sur deux ans) | Nombre d'examens de laboratoire par an (sur deux ans) | Nombre de poissons à échantillonner par an
Year 1 | 6 | 2 (12) | 2 * 75 (13)År 1 | 6 | 2 (12) | 2 * 75 (13)Année 1 | 6 | 2 (12) | 2 * 75 (13)
Year 2 | 6 | 2 (12) | 2 * 75 (13)År 2 | 6 | 2 (12) | 2 * 75 (13)Année 2 | 6 | 2 (12) | 2 * 75 (13)
Table 3.BTabel 3.BTableau 3.B
Surveillance schemes for zones or compartments to maintain disease- free status for ISA as referred to in point I.3  (15)Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår ISA, jf. punkt I.3  (15)Programmes de surveillance des zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'AIS visé au point I.3  (15)
Risk level | Number of health inspections per year | Number of laboratory examinations per year | Number of fish to be sampled per yearRisikoniveau | Antal sundhedsinspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal fisk til prøveudtagning pr. årNiveau de risque | Nombre d'inspections sanitaires par an | Nombre d'examens de laboratoire par an | Nombre de poissons à échantillonner par an
High | 2 | 2 (14) | 2 * 30Højt | 2 | 2 (14) | 2 * 30Élevé | 2 | 2 (14) | 2 × 30
Medium | 1 | 1 (14) | 30Middel | 1 | 1 (14) | 30Moyen | 1 | 1 (14) | 30
Low | 1 every 2 years | 1 every 2 years | 30 every 2 yearsLavt | 1 hvert 2. år | 1 hvert 2. år | 30 hvert 2. årFaible | Une tous les deux ans | Un tous les deux ans | 30 tous les deux ans
PART 4DEL 4PARTIE 4
SURVEILLANCE AND CONTROL METHODS FOR INFECTION WITH MARTEILIA REFRINGENSOVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTION MED MARTEILIA REFRINGENSSURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'INFECTION À MARTEILIA REFRINGENS
I.   Requirements for surveillance and eradication programmes to obtain and to maintain disease-free health statuses with regard to infection with Marteilia refringensI.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringensI.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens
I.1.   General requirementsI.1.   Generelle kravI.1.   Exigences générales
Health inspections and, where appropriate, the sampling for laboratory examination shall be carried out in the period of the year when prevalence of the parasite in the Member State, zone or compartment is known to be maximal. When such data is not available, sampling shall be carried out just after the water temperature has exceeded 17 °C.Sundhedsinspektioner og, hvis det er relevant, prøveudtagning til laboratorieundersøgelse skal foretages på den tid af året, hvor forekomsten af parasitten i medlemsstaten, zonen eller segmentet vides at være størst. Foreligger der ingen sådanne data, skal prøveudtagningen foretages, lige efter at vandtemperaturen har oversteget 17 °C.Des inspections sanitaires et, le cas échéant, le prélèvement d'échantillons en vue d'examens de laboratoire doivent être réalisés pendant la période de l'année où l'on sait que la prévalence du parasite est maximale dans l'État membre, la zone ou le compartiment. Si cette information n'est pas disponible, l'échantillonnage doit être réalisé juste après que la température de l'eau a dépassé 17 °C.
When molluscs are to be sampled in accordance with the requirements set out in Part 4, the following criteria shall apply:Hvis der skal udtages prøver af bløddyr i overensstemmelse med del 4, finder følgende kriterier anvendelse:Si les mollusques doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la partie 4, les critères suivants doivent être respectés:
(a) | if Ostrea spp. and Mytilus spp. are present in the production units or production area, both genera shall be sampled equally in sample size. If only one of those genera is present, that genus shall be sampled. If neither Ostrea nor Mytilus genera are present, the sample must be representative of all other susceptible species present;a) | Hvis Ostrea spp. og Mytilus spp. forekommer i produktionsenhederne eller produktionsområdet, skal de to slægter være ligeligt repræsenteret i prøverne. Hvis der kun forekommer en af disse slægter, udtages der prøver af denne slægt. Hvis hverken Ostrea- eller Mytilus-slægten forekommer, skal prøven være repræsentativ for alle andre modtagelige arter på stedet.a) | si des mollusques des genres Ostrea spp.et Mytilus spp. sont présents dans les unités de production ou l'aire de production, ces deux genres doivent être représentés équitablement dans les échantillons. Si un seul de ces genres est présent, ce genre doit être inclus dans les échantillons. Si ni le genre Ostrea ni le genre Mytilus ne sont présents, les échantillons doivent être représentatifs de toutes les autres espèces sensibles présentes;
(b) | if weak, gaping or freshly dead but not decomposed molluscs are present in the production units, such molluscs shall primarily be selected. If such molluscs are not present, the molluscs selected shall include the oldest healthy molluscs;b) | Hvis der forekommer svage bløddyr, bløddyr med åbne skaller eller nyligt døde bløddyr (som ikke er gået i opløsning) i produktionsenhederne, udvælges først og fremmest disse bløddyr. Forekommer der ikke sådanne bløddyr, udvælges de ældste sunde bløddyr.b) | en présence, dans les unités de production, de mollusques faibles, bâillants ou qui viennent de mourir mais ne sont pas encore décomposés, ces animaux doivent être sélectionnés en priorité. En l'absence de tels mollusques, les animaux sains les plus âgés doivent être sélectionnés;
(c) | when sampling in mollusc farms which utilise more than one water source for mollusc production, mollusc representing all water sources shall be included for sampling in such a way that all parts of the farm are proportionally represented in the sample;c) | Ved udtagning af prøver i akvakulturbrug med opdræt af bløddyr, hvor der anvendes mere end én vandkilde til produktion af bløddyr, skal der indgå bløddyr fra alle vandkilder i prøven, således at alle dele af bruget er proportionalt repræsenteret i prøven.c) | lorsque les prélèvements sont réalisés dans des fermes conchylicoles qui utilisent plusieurs sources d'eau pour la production des mollusques, des animaux représentant toutes les sources d'eau doivent être inclus dans les échantillons, de sorte que toutes les parties de la ferme y soient proportionnellement représentées;
(d) | when sampling in mollusc farming areas, mollusc from a sufficient number of sampling points, shall be included in the sample in such a way that all parts of the mollusc farming area are proportionally represented in the sample. The main factors to be considered for the selection of these sampling points are previous sampling points where Marteilia refringens was detected, stocking density, water flows, presence of susceptible species, presence of vector species, bathymetry and management practices. Natural beds shall be included in the sampling.d) | Ved udtagning af prøver fra områder med opdræt af bløddyr skal prøven omfatte bløddyr fra et tilstrækkeligt antal prøveudtagningssteder, således at alle dele af området med opdræt af bløddyr er proportionalt repræsenteret i prøven. De vigtigste faktorer, der skal tages i betragtning ved udvælgelsen af disse prøveudtagningssteder, er prøveudtagningssteder, hvor der tidligere er blevet påvist Marteilia refringens, populationstæthed, vandstrømme, forekomst af modtagelige arter, forekomst af vektorarter, vanddybde og driftspraksis. Naturlige voksesteder skal indgå i prøveudtagningen.d) | lorsque les prélèvements sont réalisés dans des parcs à mollusques, des mollusques provenant d'un nombre suffisant de points d'échantillonnage doivent être inclus dans les échantillons de sorte que toutes les parties du parc à mollusques y soient représentées proportionnellement. Les principaux facteurs à prendre en compte pour la sélection de ces points de prélèvements sont les anciens points de prélèvement où Marteilia refringens a été détecté, la densité d'élevage, les courants, la présence d'espèces sensibles, la présence d'espèces vectrices, la bathymétrie et les pratiques de gestion. L'échantillonnage doit également porter sur les bancs naturels.
I.2.   Specific requirements to achieve Category I health status with regard to Marteilia refringensI.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår Marteilia refringensI.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne Marteilia refringens
I.2.1.   Surveillance programmesI.2.1.   OvervågningsprogrammerI.2.1.   Programmes de surveillance
A Member State, zone or compartment which has Category III health status with regard to infection with Marteilia refringens may achieve Category I health status with regard to that listed disease when all farms or mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment have been subject at least to the following surveillance programme comprising health inspections and the collection of samples for testing.En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende overvågningsprogram, der inkluderer sundhedsinspektioner og indsamling af prøver til analyse.Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'infection à Marteilia refringens peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet au moins du programme de surveillance ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue de tests:
2-year surveillance programme:Toårigt overvågningsprogram:Programme de surveillance de deux ans:
(a) | the farms or mollusc farming areas have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 4.A set out in Section II;a) | Akvakulturbrugene eller områderne med opdræt af bløddyr skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 4.A i afsnit II.a) | les fermes aquacoles ou les parcs à mollusques doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 4.A de la section II;
(b) | during that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 have produced negative results for Marteilia refringens and any suspicion of Marteilia refringens has been ruled out in accordance with the diagnostic methods set out in point II.3;b) | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for Marteilia refringens, og enhver mistanke om Marteilia refringens skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.b) | au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour Marteilia refringens et toute suspicion d'infection par Marteilia refringens doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3;
(c) | when Ostrea edulis, Mytilus edulis or Mytilus galloprovincialis sourced from a Member State, zone or compartment of Category I health status are to be included in the sample, they must have been introduced in the farm or mollusc farming area at least in the spring just preceding the period when surveillance programme is carried out.c) | Hvis Ostrea edulis, Mytilus edulis eller Mytilus galloprovincialis fra en medlemsstat, en zone eller et segment med en sundhedsstatus i kategori I skal medtages i prøven, skal de være blevet tilført til akvakulturbruget eller området med opdræt af bløddyr senest det forår, der går lige forud for den periode, hvor overvågningsprogrammet gennemføres.c) | lorsque des mollusques des espèces Ostrea edulis, Mytilus edulis ou Mytilus galloprovincialis provenant d'un État membre, d'une zone ou d'un compartiment jouissant d'un statut sanitaire de catégorie I doivent être inclus dans les échantillons, ils doivent avoir été introduits dans la ferme aquacole ou dans le parc à mollusques au moins au printemps précédant immédiatement la période d'exécution du programme de surveillance.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
The eradication of Marteilia refringens is considered to be impossible in most cases, but where the Member State judges it to be feasible, the following model for an eradication programme shall apply.I de fleste tilfælde anses det for umuligt at udrydde Marteilia refringens, men hvis medlemsstaten vurderer, at det kan lade sig gøre, skal følgende model for et udryddelsesprogram anvendes.L'éradication de Marteilia refringens est considérée comme impossible dans la plupart des cas, mais lorsque l'État membre l'estime faisable, le modèle de programme d'éradication ci-après doit être appliqué.
A Member State, zone or compartment that has Category V health status as regards infection with Marteilia refringens may achieve Category I health status with regard to that listed disease when all farms or mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within that Member State, zone or compartment have been subject at least to the following eradication programme:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af mindst følgende udryddelsesprogram:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Marteilia refringens peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet du programme d'éradication suivant au moins:
(a) | the measures laid down in Section 3 of Chapter V of Directive 2006/88/EC have effectively been applied, and in particular a containment area as referred to in Article 32(b) of Directive 2006/88/EC, comprising a protection zone and surveillance zone, has been established in the vicinity of the farm(s) or mollusc farming area(s) officially declared infected with Marteilia refringens. | The containment area shall be defined on a case-by-case basis taking into account factors influencing the risks for the spread of Marteilia refringens, such as: the number, age, rate and distribution of the mortalities of molluscs on the farm or mollusc farming area infected with Marteilia refringens including wild molluscs; the distance and density of neighbouring farms or mollusc farming areas including wild molluscs; the proximity to processing establishments, contact farms or mollusc farming areas; the species, especially susceptible species and vector species, present at the farms or mollusc farming areas; the farming practices applied in the affected and neighbouring farms and mollusc farming areas; the hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply: | (i) | a protection zone shall be established in the immediate vicinity of a farm or mollusc farming area officially declared infected with Marteilia refringens and shall correspond to an area determined according to appropriate hydrodynamic or epidemiological data; | (ii) | a surveillance zone shall be established outside the protection zone and shall correspond to an area, surrounding the protection zone, determined according to appropriate hydrodynamic or epidemiological data;a) | De foranstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug eller det eller de områder med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af Marteilia refringens, som f.eks.: antal, alder, procentdel og fordeling af døde bløddyr på det akvakulturbrug eller i det område med opdræt af bløddyr, der er inficeret med Marteilia refringens, herunder vildtlevende bløddyr, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, herunder vildtlevende bløddyr, nærhed til forarbejdningsvirksomheder, kontaktbrug eller kontaktområder med opdræt af bløddyr, de arter, navnlig modtagelige arter og vektorarter, der findes på akvakulturbrugene eller i områderne med opdræt af bløddyr, opdrætspraksis på/i de berørte og nærmestliggende akvakulturbrug og områder med opdræt af bløddyr, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug eller et område med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens, og denne beskyttelseszone skal svare til et område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data. | ii) | Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til et område omkring beskyttelseszonen fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.a) | les mesures prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles ou du ou des parcs à mollusques officiellement déclarés infectés par Marteilia refringens. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de Marteilia refringens, à savoir: le nombre, l'âge, le taux de mortalité et la distribution de la mortalité des mollusques dans la ferme aquacole ou le parc à mollusques infecté par Marteilia refringens, y compris chez les mollusques sauvages, la distance à laquelle se trouvent les fermes aquacoles ou parcs à mollusques voisins et la densité de ceux-ci, y compris les mollusques sauvages, la proximité des établissements de transformation et des fermes aquacoles ou parcs à mollusques en contact, les espèces, en particulier les espèces sensibles et les espèces vectrices, présentes dans les fermes aquacoles ou les parcs à mollusques, les pratiques d'élevage appliquées dans les fermes aquacoles et les parcs à mollusques contaminés et voisins; les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole ou d'un parc à mollusque officiellement déclaré infecté par Marteilia refringens et doit correspondre à une zone déterminée selon des données hydrodynamiques ou épidémiologiques appropriées; | ii) | un périmètre de surveillance doit être établi au-delà du périmètre de protection, et doit correspondre à une zone située autour du périmètre de protection, déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;
(b) | all farms and mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with Marteilia refringens shall be subject to an official investigation comprising at least the collection of samples for the testing of 150 molluscs after the beginning of the transmission period of Marteilia refringens. When the transmission period is not known, the sampling shall begin in the period after the temperature of the water exceeds 17 °C;b) | På alle akvakulturbrug og i alle områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF i beskyttelseszonen, og som ikke officielt er erklæret inficeret med Marteilia refringens, skal der foretages en officiel undersøgelse, der mindst omfatter indsamling af prøver med henblik på undersøgelse af 150 bløddyr efter begyndelsen af overførselsperioden for Marteilia refringens. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes i perioden, efter at vandtemperaturen overstiger 17 °C.b) | l'ensemble des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE situés à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarés infectés par Marteilia refringens doit faire l'objet d'une enquête officielle comprenant au moins un prélèvement d'échantillons visant à tester 150 mollusques, réalisé après le début de la période de transmission de Marteilia refringens. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer après que la température de l'eau a dépassé 17 °C;
(c) | all farms and mollusc farming areas officially declared infected with Marteilia refringens shall be emptied, fallowed and if possible cleansed, and disinfected. | The duration of the fallowing period shall be at least: | (i) | 2 months in case of the farms and mollusc farming areas with limited connections with the surrounding waters such as hatcheries and nurseries; | (ii) | 2 months in case of the farms and mollusc farming areas with unlimited connections with the surrounding waters provided that the infected molluscs of the susceptible species and those molluscs of the susceptible species with epidemiological links with the infected farm or mollusc farming area have been harvested or removed before the period of the year when the prevalence of Marteilia refringens is known to be maximal, or when that period is not known, before the period when water temperature exceeds 17 °C; | (iii) | 14 months in case of the farms and mollusc farming areas with unlimited connections with the surrounding waters provided that the infected molluscs of the susceptible species and those molluscs of the susceptible species with epidemiological links with the infected farm or mollusc farming area have not been harvested or removed before the period of the year when the prevalence of Marteilia refringens is known to be maximal or when such data is not known, when molluscs of the susceptible species have not been harvested or removed before the period when water temperature exceeds 17 °C. | When all farms and mollusc farming areas officially declared infected are emptied, at least 4 weeks of synchronised fallowing shall be carried out. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms or mollusc farming areas, as appropriate within the established protection and surveillance zones. The length of the fallowing period shall be determined by the competent authority following a case by case risk evaluation;c) | Alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens, skal tømmes, udtages af drift og, hvis muligt, rengøres og desinficeres. | De skal være udtaget af drift i mindst: | i) | to måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med begrænset kontakt til de omkringliggende vandområder, f.eks. klæknings- og yngelanlæg | ii) | to måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med ubegrænset kontakt til de omkringliggende vandområder, forudsat at de inficerede bløddyr af modtagelige arter og bløddyrene af modtagelige arter med epidemiologiske forbindelser til det inficerede akvakulturbrug eller område med opdræt af bløddyr er høstet eller fjernet inden den periode af året, hvor forekomsten af Marteilia refringens vides at være størst, eller, hvis denne ikke kendes, inden den periode, hvor vandtemperaturen overstiger 17 °C | iii) | fjorten måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med ubegrænset kontakt til de omkringliggende vandområder, forudsat at de inficerede bløddyr af modtagelige arter og bløddyrene af modtagelige arter med epidemiologiske forbindelser til det inficerede akvakulturbrug eller område med opdræt af bløddyr ikke er høstet eller fjernet inden den periode af året, hvor forekomsten af Marteilia refringens vides at være størst, eller, hvis sådanne data ikke kendes, hvis bløddyr af modtagelige arter ikke er blevet høstet eller fjernet inden den periode, hvor vandtemperaturen overstiger 17 °C. | Når alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst fire uger. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug eller områder med opdræt af bløddyr, alt efter hvad der er relevant, inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug eller områder skal være udtaget af drift.c) | toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés par Marteilia refringens sont vidés de leurs mollusques, font l'objet d'un vide sanitaire et sont si possible nettoyés et désinfectés. | La durée de la période de vide sanitaire doit être d'au moins: | i) | deux mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens limités avec les eaux avoisinantes telles que celles des écloseries et des nurseries; | ii) | deux mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens illimités avec les eaux avoisinantes, à condition que les mollusques infectés des espèces sensibles et les mollusques des espèces sensibles ayant des liens épidémiologiques avec la ferme aquacole ou le parc à mollusques infectés aient été récoltés ou retirés avant la période de l'année où l'on sait que la prévalence de Marteilia refringens est maximale ou, si cette information n'est pas connue, avant la période où la température de l'eau dépasse 17 °C; | iii) | quatorze mois dans le cas des fermes aquacoles et des parcs à mollusques ayant des liens illimités avec les eaux avoisinantes, à condition que les mollusques infectés des espèces sensibles et les mollusques des espèces sensibles ayant des liens épidémiologiques avec la ferme aquacole ou le parc à mollusques infectés n'aient pas été récoltés ou retirés avant la période de l'année où l'on sait que la prévalence de Marteilia refringens est maximale ou, si cette information n'est pas connue, lorsque les mollusques des espèces sensibles n'ont pas été récoltés ou éliminés avant la période où la température de l'eau dépasse 17 °C. | Lorsque toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés sont vidés de leurs mollusques, un vide sanitaire synchronisé d'au moins quatre semaines doit être mis en place. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis soient vidés de leurs mollusques, nettoyés, désinfectés et qu'ils fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;
(d) | all farms or mollusc farming areas officially declared infected and all other farms or mollusc farming areas fallowed within the established protection and surveillance zones shall be restocked with molluscs sourced from Member States, zones or compartments with a Category I health status as regards infection with Marteilia refringens. | Restocking shall only take place when all farms officially declared infected have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2(c);d) | På alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er taget ud af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af bløddyr ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår infektion med Marteilia refringens. | Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, har været tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2, litra c).d) | la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques ayant fait l'objet d'un vide sanitaire situés à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne Marteilia refringens. | Le repeuplement ne doit avoir lieu qu'une fois que toutes fermes aquacoles officiellement déclarées infectées ont été vidées de leurs mollusques, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2 c);
(e) | all farms and mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment covered by the eradication programme shall subsequently be subject to the surveillance scheme set out in point I.2.1 of this Part.e) | Alle akvakulturbrug og områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1 i denne del.e) | toutes les fermes aquacoles et tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication doivent ensuite faire l'objet du programme de surveillance décrit au point I.2.1 de la présente partie.
I.3.   Specific requirements for the maintenance of disease-free health status (Category I) with regard to infection with Marteilia refringensI.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår infektion med Marteilia refringensI.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'infection à Marteilia refringens
When targeted surveillance is required to maintain Category I health status, as provided for in Article 52 of Directive 2006/88/EC, all farms or mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment concerned shall be subject to health inspections and sampled in accordance with Table 4.B set out in Section II, taking into account the risk level of the farm or mollusc farming area for the contraction of Marteilia refringens.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 4.B i afsnit II, idet der tages hensyn til risikoniveauet for akvakulturbruget eller området med opdræt af bløddyr med hensyn til indslæbning af Marteilia refringens.Lorsqu'une surveillance ciblée est requise pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, la totalité des fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doit faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 4.B de la section II, compte tenu du risque de contamination de la ferme aquacole ou du parc à mollusques par Marteilia refringens.
The disease-free status may only be maintained as long as all samples using the diagnostic methods set out in point II.2 produced negative results for Marteilia refringens and any suspicion of Marteilia refringens is ruled out in accordance with the diagnostic methods set out in point II.3.Statussen som sygdomsfri kan kun opretholdes, så længe alle prøver ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for Marteilia refringens, og enhver mistanke om Marteilia refringens er udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic décrites au point II.2 se révèlent négatifs pour Marteilia refringens et que toute suspicion d'infection à Marteilia refringens est écartée conformément aux méthodes de diagnostic décrites au point II.3.
I.4.   Requirements for the lifting of the containment measures provided for in Article 39 of Directive 2006/88/EC (change from Category V to Category III health status) with regard to infection with Marteilia refringensI.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med Marteilia refringensI.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne l'infection à Marteilia refringens
A Member State, zone or compartment that has Category V health status with regard to infection with Marteilia refringens may achieve Category III health status with regard to that listed disease provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Marteilia refringens peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:
(a) | the requirements laid down in points I.2.2(a), (b) and (c) have been met. In case fallowing is not technically possible, the farms shall be subject to an alternative measure which provides almost similar guarantee for extermination of Marteilia refringens from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at Marteilia refringens er udryddet i brugets miljøa) | Les exigences définies au paragraphe I.2.2, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de Marteilia refringens de l'environnement de la ferme aquacole;
(b) | all farms or mollusc farming areas officially declared infected and all other farms or mollusc farming areas fallowed/been subject to alternative measures in accordance with (a) within the established protection and surveillance zones have been restocked with molluscs sourced from Member States, zone or compartments with a Category I, II or III health status with regard to infection with Marteilia refringens;b) | nytilførslen af fisk på alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), inden for de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår infektion med Marteilia refringensb) | la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis et ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) aient été repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'infection à Marteilia refringens;
(c) | restocking has only taken place when all farms or mollusc farming areas officially declared infected have been emptied, cleansed, disinfected and fallowed or been subject to alternative measures in accordance with (a);c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift eller gjort til genstand for alternative foranstaltninger i henhold til litra a)c) | le repeuplement n'ait eu lieu qu'après que la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, nettoyés, désinfectés et soumis à un vide sanitaire ou à d'autres mesures conformément au point a);
(d) | no confirmation of infection with Marteilia refringens has occurred during the period of 2 years that follows the completion of the measures referred to in (a), (b) and (c), and suspicions during this period have been ruled out according to the procedures established in point II.3.d) | der ikke har været bekræftet infektion med Marteilia refringens i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.d) | aucune infection à Marteilia refringens n'ait été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.
II.   Diagnostic methods and official investigationsII.   Diagnosemetoder og officielle undersøgelserII.   Méthodes de diagnostic et enquêtes officielles
II.1.   SamplesII.1.   PrøverII.1.   Échantillons
The whole animal shall be submitted to the laboratory for the performance of the diagnostic tests provided for in points II.2 and II.3.Hele dyret skal indsendes til laboratoriet med henblik på udførelse af de diagnostiske test i punkt II.2 og II.3.L'animal entier est présenté au laboratoire pour la réalisation des tests de diagnostic spécifiés aux points II.2 et II.3.
II.2.   Diagnostic methods to obtain or maintain disease-free status for infection with Marteilia refringensII.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringensII.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens
The diagnostics methods to be used to obtain or maintain disease-free status for infection with Marteilia refringens following the detailed diagnostic methods and procedures set out in of Part 4 of Annex II, shall be histopathology, tissue imprints or PCR.De diagnosemetoder, der skal anvendes for at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringens i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 4, er histopatologi, vævsaftryk eller PCR.Les méthodes de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 4, sont l'examen histopathologique, les empreintes tissulaires ou la PCR.
II.3.   Official investigation and diagnostic methods to confirm the presence of or to rule out the suspicion of infection with Marteilia refringensII.3.   Officielle undersøgelser og diagnosemetoder med henblik på at bekræfte forekomst af eller udelukke mistanke om infektion med Marteilia refringensII.3.   Méthodes d'enquête officielle et de diagnostic visant à confirmer la présence d'une infection à Marteilia refringens ou à écarter une suspicion d'une telle infection
When a suspicion of infection with Marteilia refringens is required to be confirmed or ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedure shall be complied with:Hvis mistanke om forekomst af infektion med Marteilia refringens skal bekræftes eller udelukkes i henhold til artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'infection à Marteilia refringens conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:
(a) | the official investigation shall include at least one sampling of 30 molluscs of susceptible species if the suspicion is based on a mortality report or if not, 150 molluscs of susceptible species after the beginning of the transmission period of Marteilia refringens. When the transmission period is not known, the sampling shall begin in the period after the temperature of the water exceeds 17 °C;a) | Den officielle undersøgelse skal omfatte mindst én prøveudtagning af 30 bløddyr af modtagelige arter, hvis mistanken bygger på en rapport om dødelighed, eller, hvis dette ikke er tilfældet, 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Marteilia refringens. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes i perioden, efter at vandtemperaturen overstiger 17 °C.a) | l'enquête officielle doit comporter au moins un échantillonnage sur 30 mollusques d'espèces sensibles si la suspicion est fondée sur un rapport de mortalité, ou, si tel n'est pas le cas, sur 150 mollusques d'espèces sensibles, les prélèvements étant réalisés après le début de la période de transmission de Marteilia refringens. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer après que la température de l'eau a dépassé 17 °C;
(b) | Samples shall be tested using the diagnostic methods set out in point (i) following the detailed diagnostic methods and procedures set out in Section I of Part 4 of Annex II: | (i) | the presence of Marteilia refringens shall be considered as confirmed when a positive result by histopathology, tissue imprints or in situ hybridisation is combined with a positive result PCR completed by sequencing; | (ii) | the suspicion of infection with Marteilia refringens may be ruled out, if the tests referred to in (i) reveal no further evidence of the presence of Marteilia refringens.b) | Prøverne undersøges ved hjælp af diagnosemetoderne i nr. i) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 4, afsnit I: | i) | Forekomst af Marteilia refringens anses for bekræftet, hvis et positivt resultat opnået ved histopatologi, vævsaftryk eller in situ-hybridisering er kombineret med et positivt resultat opnået ved PCR efterfulgt af sekventering. | ii) | Mistanke om infektion med Marteilia refringens kan udelukkes, hvis de undersøgelser, der er omhandlet i nr. i), ikke afslører yderligere tegn på forekomst af Marteilia refringens.b) | les échantillons doivent être testés à l'aide des méthodes de diagnostic indiquées au point i) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 4, section I: | i) | la présence de Marteilia refringens doit être considérée comme confirmée lorsque l'examen histopathologique, les empreintes tissulaires ou l'hybridation in situ donnent un résultat positif associé à un résultat positif obtenu par la PCR complétée par un séquençage; | ii) | la suspicion d'infection à Marteilia refringens peut être écartée dans les cas où les tests visés au point i) n'apportent aucun élément supplémentaire prouvant la présence de Marteilia refringens.
Table 4.ATabel 4.ATableau 4.A
Surveillance scheme for Member States, zones or compartments for the control period which precedes the achievement of disease-free status for Marteilia refringens as referred to in point I.2.1Overvågningsordning for medlemsstater, zoner eller segmenter i kontrolperioden forud for opnåelse af status som sygdomsfri for så vidt angår Marteilia refringens, jf. punkt I.2.1Programme de surveillance dans les États membres, zones ou compartiments pour la période qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens visé au point I.2.1
  | Number of health inspections per year | Number of laboratory examinations per year | Number of molluscs in the sample  | Antal sundhedsinspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal bløddyr i prøven  | Nombre d'inspections sanitaires par an | Nombre d'examens de laboratoire par an | Nombre de mollusques par échantillon
Farms/mollusc farming areas | 1 | 1 | 150Akvakulturbrug/områder med opdræt af bløddyr | 1 | 1 | 150Fermes aquacoles/parcs à mollusques | 1 | 1 | 150
Table 4.BTabel 4.BTableau 4.B
Surveillance schemes for Member States, zones or compartments to maintain disease-free status for Marteilia refringens as referred to in point I.3Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår Marteilia refringens, jf. punkt I.3Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'infection à Marteilia refringens visé au point I.3
Risk level | Number of health inspections | Number of laboratory examinations | Number of molluscs in the sampleRisikoniveau | Antal sundhedsinspektioner | Antal laboratorieundersøgelser | Antal bløddyr i prøvenNiveau de risque | Nombre d'inspections sanitaires | Nombre d'examens de laboratoire | Nombre de mollusques par échantillon
High | 1 every year | 1 every 2 years | 150Højt | 1 pr. år | 1 hvert 2. år | 150Élevé | Une par an | Un tous les deux ans | 150
Medium | 1 every 2 years | 1 every 2 years | 150Middel | 1 hvert 2. år | 1 hvert 2. år | 150Moyen | Une tous les deux ans | Un tous les deux ans | 150
Low | 1 every 2 years | 1 every 4 years | 150Lavt | 1 hvert 2. år | 1 hvert 4. år | 150Faible | Une tous les deux ans | Un tous les quatre ans | 150
PART 5DEL 5PARTIE 5
SURVEILLANCE AND CONTROL METHODS FOR INFECTION WITH BONAMIA OSTREAEOVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTION MED BONAMIA OSTREAESURVEILLANCE ET MÉTHODES DE LUTTE CONTRE L'INFECTION À BONAMIA OSTREAE
I.   Requirements for surveillance or eradication programmes to obtain and maintain disease-free health statuses with regard to infection with Bonamia ostreaeI.   Krav til overvågnings- eller udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreaeI.   Exigences relatives aux programmes de surveillance ou d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae
I.1.   General requirementsI.1.   Generelle kravI.1.   Exigences générales
Health inspections and, where appropriate, the sampling of production units shall be carried out in the period of the year when prevalence of Bonamia ostreae in the Member State, zone or compartment is known to be maximal. When such data is not available, sampling shall be carried out in winter or at the beginning of spring.Sundhedsinspektioner og, hvis det er relevant, prøveudtagning på produktionsenheder skal foretages på den tid af året, hvor forekomsten af Bonamia ostreae i medlemsstaten, zonen eller segmentet vides at være størst. Foreligger der ingen sådanne data, skal prøveudtagningen foretages om vinteren eller først på foråret.Des inspections sanitaires et, s'il y a lieu, un échantillonnage des unités de production doivent être effectués pendant la période de l'année où l'on sait que la prévalence de Bonamia ostreae est maximale dans l'État membre, la zone ou le compartiment. Si cette information n'est pas disponible, l'échantillonnage doit être réalisé en hiver ou au début du printemps.
When molluscs are to be sampled in accordance with the requirements set out in Part 5, the following criteria shall apply:Hvis der skal udtages prøver af bløddyr i overensstemmelse med del 5, finder følgende kriterier anvendelse:Si les mollusques doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la partie 5, les critères suivants doivent être respectés:
(a) | if Ostrea edulis are present, only oysters of that species shall be selected for sampling. If Ostrea edulis are not present, the sample shall be representative of all other susceptible species present;a) | Hvis der produceres Ostrea edulis, udtages der en prøve bestående udelukkende af østers af denne art. Hvis der ikke forekommer Ostrea edulis, skal prøven være repræsentativ for alle andre modtagelige arter på stedet.a) | lorsque des huîtres de l'espèce Ostrea edulis sont présentes, seules des huîtres de cette espèce doivent être sélectionnées pour l'échantillonnage. En l'absence de telles huîtres, l'échantillon doit être représentatif de toutes les autres espèces sensibles présentes;
(b) | if weak, gaping or freshly dead but not decomposed molluscs are present, such molluscs shall primarily be selected. If such molluscs are not present, the molluscs selected shall include the oldest healthy molluscs;b) | Hvis der forekommer svage bløddyr, bløddyr med åbne skaller eller nyligt døde bløddyr (som ikke er gået i opløsning), udvælges først og fremmest disse bløddyr. Forekommer der ikke sådanne bløddyr, udvælges de ældste sunde bløddyr.b) | en présence de mollusques faibles, bâillants ou qui viennent de mourir mais ne sont pas encore décomposés, ces animaux doivent être sélectionnés en priorité. En l'absence de tels mollusques, les animaux sains les plus âgés doivent faire partie des mollusques sélectionnés;
(c) | when sampling in farms which utilise more than one water source for mollusc production, mollusc representing all water sources shall be included for sampling in such a way that all parts of the farm are proportionally represented in the sample;c) | Ved udtagning af prøver i akvakulturbrug, hvor der anvendes mere end én vandkilde til produktion af bløddyr, skal der indgå bløddyr fra alle vandkilder i prøven, således at alle dele af bruget er proportionalt repræsenteret i prøven.c) | lorsque les prélèvements sont réalisés dans des fermes aquacoles qui utilisent plusieurs sources d'eau pour la production des mollusques, des animaux représentant toutes les sources d'eau doivent être inclus dans les échantillons, de sorte que toutes les parties de la ferme aquacole y soient proportionnellement représentées;
(d) | when sampling in mollusc farming areas, molluscs from a sufficient number of sampling points shall be included in the sample. The main factors to be considered for the selection of those sampling points are previous points where Bonamia ostreae was detected, stocking density, water flows, the presence of susceptible species, the presence of vector species, bathymetry and management practices. Natural beds within or adjacent to the farming areas shall be included in the sampling.d) | Ved udtagning af prøver fra områder med opdræt af bløddyr skal prøven omfatte bløddyr fra et tilstrækkeligt antal prøveudtagningssteder. De vigtigste faktorer, der skal tages i betragtning ved udvælgelsen af disse prøveudtagningssteder, er steder, hvor der tidligere er blevet påvist Bonamia ostreae, populationstæthed, vandstrømme, forekomst af modtagelige arter, forekomst af vektorarter, vanddybde og driftspraksis. Naturlige voksesteder i eller i umiddelbar nærhed af områder med opdræt af bløddyr skal indgå i prøveudtagningen.d) | lorsque des échantillons sont prélevés dans des parcs à mollusques, des animaux provenant d'un nombre suffisant de points d'échantillonnage doivent être inclus dans l'échantillon. Les principaux facteurs à prendre en compte pour la sélection de ces points de prélèvements sont les anciens points de prélèvement où Bonamia ostreae a été détecté, la densité d'élevage, les courants, la présence d'espèces sensibles, la présence d'espèces vectrices, la bathymétrie et les pratiques de gestion. L'échantillonnage doit aussi porter sur les bancs naturels se trouvant à l'intérieur des parcs à mollusques ou adjacents à ceux-ci.
I.2.   Specific requirements to achieve Category I health status as regards Bonamia ostreaeI.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår Bonamia ostreaeI.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne l'infection à Bonamia ostreae
I.2.1.   Surveillance programmesI.2.1.   OvervågningsprogrammerI.2.1.   Programmes de surveillance
A Member State, zone or compartment that has Category III health status with regard to Bonamia ostreae may achieve Category I health status again with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment have been subject at least to the following surveillance programme comprising health inspections and the collection of samples for testing.En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår Bonamia ostreae, kan atter opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende overvågningsprogram, der omfatter sundhedsinspektioner og indsamling af prøver til analyse.Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme de surveillance ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue de tests.
2-year surveillance programme:Toårigt overvågningsprogram:Programme de surveillance de deux ans:
(a) | the farms and mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 5.A. set out in this Part;a) | Akvakulturbrugene og områderne med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 5.A i denne del.a) | les fermes aquacoles et les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE doivent avoir fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 5.A de la présente partie;
(b) | during that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 produced negative results for Bonamia ostreae and any suspicion of Bonamia ostreae has been ruled out in accordance with the diagnostic methods set out in point II.3;b) | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for Bonamia ostreae, og enhver mistanke om Bonamia ostreae skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.b) | au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 doivent s'être révélés négatifs pour Bonamia ostreae et toute suspicion d'infection par Bonamia ostreae doit avoir été écartée conformément aux méthodes de diagnostic indiquées au point II.3;
(c) | when Ostrea edulis sourced from a Member State, zone or compartment of Category I health status are to be included in the sample, they must have been introduced into the farm or mollusc farming area at least in the autumn just preceding the period when the surveillance programme is carried out.c) | Hvis Ostrea edulis fra en medlemsstat, en zone eller et segment med en sundhedsstatus i kategori I skal medtages i prøven, skal de være blevet tilført til akvakulturbruget eller området med opdræt af bløddyr senest det efterår, der går lige forud for den periode, hvor overvågningsprogrammet gennemføres.c) | lorsque des huîtres de l'espèce Ostrea edulis provenant d'un État membre, d'une zone ou d'un compartiment jouissant d'un statut sanitaire de catégorie I doivent être incluses dans l'échantillon, elles doivent avoir été introduites dans la ferme aquacole ou le parc à mollusques au moins à l'automne précédant immédiatement la période d'exécution du programme de surveillance.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
Eradication of Bonamia ostreae is considered to be impossible in most cases, but where the Member State judges it to be feasible, the following model for an eradication programme shall apply.I de fleste tilfælde anses det for umuligt at udrydde Bonamia ostreae, men hvis medlemsstaten vurderer, at det kan lade sig gøre, skal følgende model for et udryddelsesprogram anvendes:L'éradication de Bonamia ostreae est considérée comme impossible dans la plupart des cas, mais lorsque l'État membre l'estime faisable, le modèle de programme d'éradication ci-après doit être appliqué.
A Member State, zone or compartment that has Category V health status as regards Bonamia ostreae may achieve Category I health status again with regard to that listed disease when all farms or mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment have been subject at least to the following eradication programme:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår Bonamia ostreae, kan atter opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, når alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende udryddelsesprogram:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles ou tous les parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont fait l'objet du programme d'éradication suivant au moins:
(a) | the minimum control measures laid down in Section 3 of Chapter V of Directive 2006/88/EC have effectively been applied, and in particular a containment area as referred in point (b) of Article 32 of that Directive, comprising a protection zone and surveillance zone, has been established in the vicinity of the farm(s) or mollusc farming area(s) officially declared infected with Bonamia ostreae. | The containment area shall be defined on a case-by-case basis taking into account factors influencing the risks for the spread of that listed disease, such as: the number, rate, age and distribution of the mortalities of molluscs on the farm or mollusc farming area infected with Bonamia ostreae including wild molluscs; the distance and density of neighbouring farms or mollusc farming areas, including wild molluscs; the proximity to processing establishments, contact farms or mollusc farming areas; the species present at the farms or mollusc farming areas, especially susceptible species and vector species; farming practices applied in the affected and neighbouring farms or mollusc farming areas; hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply: | (i) | a protection zone shall be established in the immediate vicinity of a farm or mollusc farming area officially declared infected with Bonamia ostreae and shall correspond to an area determined according to appropriate hydrodynamic or epidemiological data; | (ii) | a surveillance zone shall be established outside the protection zone and shall correspond to an area surrounding the protection zone, determined according to appropriate hydrodynamic or epidemiological data;a) | De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug eller det eller de områder med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af denne listeopførte sygdom, som f.eks.: antal, procentdel, alder og fordeling af bløddyr på det akvakulturbrug eller i det område med opdræt af bløddyr, der er inficeret med Bonamia ostreae, herunder vildtlevende bløddyr, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, herunder vildtlevende bløddyr, nærhed til forarbejdningsvirksomheder, kontaktbrug eller kontaktområder med opdræt af bløddyr, de arter, navnlig modtagelige arter og vektorarter, der findes på akvakulturbrugene eller i områderne med opdræt af bløddyr, opdrætspraksis på/i de berørte og nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug eller et område med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae, og denne beskyttelseszone skal svare til et område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data. | ii) | Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til et område omkring beskyttelseszonen fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.a) | les mesures minimales de lutte prévues au chapitre V, section 3, de la directive 2006/88/CE ont effectivement été appliquées et, en particulier, une zone de confinement telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie aux alentours de la ou des fermes aquacoles ou du ou des parcs à mollusques officiellement déclarés infectés par Bonamia ostreae. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de propagation de cette maladie répertoriée, à savoir: le nombre, l'âge, le taux de mortalité et la distribution de la mortalité des mollusques dans la ferme aquacole ou le parc à mollusques infecté par Bonamia ostreae, y compris les mollusques sauvages, l'éloignement et la densité des fermes aquacoles ou parcs à mollusques voisins, y compris les mollusques sauvages, la proximité des établissements de transformation et des fermes aquacoles ou parcs à mollusques en contact, les espèces présentes dans les fermes aquacoles ou les parcs à mollusques, en particulier les espèces sensibles et les espèces vectrices, les pratiques d'élevage appliquées dans les fermes aquacoles ou les parcs à mollusques contaminés et dans les fermes aquacoles ou parcs à mollusques voisins, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole ou d'un parc à mollusques officiellement déclaré infecté par Bonamia ostreae et doit correspondre à une zone déterminée selon des données hydrodynamiques ou épidémiologiques appropriées; | ii) | un périmètre de surveillance doit être établi au-delà du périmètre de protection, et doit correspondre à une zone située autour du périmètre de protection, déterminée selon des données hydrodynamiques ou épidémiologiques appropriées;
(b) | all farms and mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with Bonamia ostreae shall be subject to an official investigation comprising at least the collection of samples for testing of 150 molluscs of susceptible species after the beginning of the transmission period of Bonamia ostreae. When the transmission period is not known, the sampling shall begin in winter or at the beginning of spring;b) | På alle akvakulturbrug og i alle områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF i beskyttelseszonen, og som ikke officielt er erklæret inficeret med Bonamia ostreae, skal der foretages en officiel undersøgelse, der mindst omfatter indsamling af prøver med henblik på undersøgelse af 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Bonamia ostreae. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes om vinteren eller først på foråret.b) | la totalité des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE situés à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarés infectés par Bonamia ostreae doit faire l'objet d'une enquête officielle comprenant au moins un prélèvement d'échantillons visant à tester 150 mollusques, réalisé après le début de la période de transmission de Bonamia ostreae. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer en hiver ou au début du printemps;
(c) | all farms and mollusc farming areas officially declared infected with Bonamia ostreae shall be emptied, fallowed and if possible cleansed and disinfected. The duration of the fallowing period shall be at least 6 months. | When all farms or mollusc farming areas officially declared infected are emptied, at least 4 weeks of synchronised fallowing shall be carried out. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms or mollusc farming areas, as appropriate within the established protection and surveillance zones. The length of the fallowing period shall be determined by the competent authority following a case by case risk evaluation;c) | Alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae, skal tømmes, udtages af drift og, hvis muligt, rengøres og desinficeres. Det skal være udtaget af drift i mindst seks måneder. | Når alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst fire uger. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug eller områder med opdræt af bløddyr, alt efter hvad der er relevant, inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug eller områder skal være udtaget af drift.c) | toutes les fermes aquacoles et tous les parcs à mollusques officiellement déclarés infectés par Bonamia ostreae doivent être vidés de leurs mollusques, soumis à un vide sanitaire et si possible nettoyés et désinfectés; la durée de la période de vide sanitaire doit être d'au moins six semaines. | Lorsque la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, un vide sanitaire synchronisé d'au moins quatre semaines doit être mis en place. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis soient vidés de leurs mollusques, nettoyés, désinfectés et qu'ils fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;
(d) | all farms or mollusc farming areas officially declared infected and all other farms or mollusc farming areas fallowed within the established protection and surveillance zones shall be restocked with molluscs sourced from Member States, zones or compartments with a Category I health status with regard to infection with Bonamia ostreae. Restocking shall only take place when all farms officially declared infected have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2(c);d) | På alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er taget ud af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af bløddyr ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår infektion med Bonamia ostreae. Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2, litra c).d) | la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des fermes aquacoles ou des parcs à mollusques ayant fait l'objet d'un vide sanitaire situés à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne l'infection à Bonamia ostreae. Le repeuplement ne doit avoir lieu qu'une fois que toutes fermes aquacoles officiellement déclarées infectées ont été vidées de leurs mollusques, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2 c);
(e) | all farms and mollusc farming areas keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment covered by the eradication programme must subsequently be subject to the surveillance programme laid down in point I.2.e) | Alle akvakulturbrug og områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, skal efterfølgende være omfattet af det overvågningsprogram, der er fastsat i punkt I.2.e) | la totalité des fermes aquacoles et des parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couvert par le programme d'éradication doit ensuite faire l'objet du programme de surveillance décrit au point I.2.
I.3.   Specific requirements for the maintenance of disease-free health status (Category I) with regard to infection with Bonamia ostreaeI.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår infektion med Bonamia ostreaeI.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne l'infection à Bonamia ostreae
When targeted surveillance is required to maintain Category I health status, as laid down in Article 52 of Directive 2006/88/EC, all farms or mollusc farming areas keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment concerned shall be subject to health inspections and sampled in accordance with Table 5.B set out in Section II of this Part, taking into account the risk level of the farm or mollusc farming area for the contraction of infection with Bonamia ostreae.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med i afsnit II, tabel 5.B, i denne del, idet der tages hensyn til risikoniveauet for akvakulturbruget eller området med opdræt af bløddyr med hensyn til indslæbning af infektion med Bonamia ostreae.Lorsqu'une surveillance ciblée est requise pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE, la totalité des fermes aquacoles ou parcs à mollusques détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doit faire l'objet d'inspections sanitaires et d'échantillonnages conformément au tableau 5.B figurant à la section II de la présente partie, compte tenu du risque de contamination de la ferme aquacole ou du parc à mollusques par Bonamia ostreae.
Disease-free status with regard to infection with Bonamia ostreae may only be maintained as long as all samples using the diagnostic methods set out in point II.2 have produced negative results for Bonamia ostreae and any suspicion of Bonamia ostreae has been ruled out in accordance with the diagnostic methods set out in point II.3.Statussen som sygdomsfri for så vidt angår Bonamia ostreae opretholdes kun, så længe alle prøver ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for Bonamia ostreae, og enhver mistanke om Bonamia ostreae er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.Le statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour Bonamia ostreae, et que toute suspicion d'infection à Bonamia ostreae a été écartée conformément aux méthodes de diagnostic établies au point II.3.
I.4.   Requirements for the lifting of the containment measures provided for in Article 39 of Directive 2006/88/EC (the change from Category V to Category III health status) with regard to infection with Bonamia ostreae.I.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med Bonamia ostreae.I.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne l'infection à Bonamia ostreae.
A Member State, zone or compartment that has Category V health status with regard to infection with Bonamia ostreae may achieve Category III health status with regard to that disease provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår Bonamia ostreae, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne l'infection à Bonamia ostreae peut obtenir un statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:
(a) | the requirements set out in points I.2.2(a), (b) and (c) have been met. In case fallowing is not technically possible, the farms shall be subject to an alternative measure which provides almost similar guarantee for extermination of Bonamia ostreae from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at Bonamia ostreae er udryddet i brugets miljøa) | Les exigences définies au paragraphe I.2.2, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication de Bonamia ostreae de l'environnement de la ferme aquacole;
(b) | all farms or mollusc farming areas officially declared infected and all other farms or mollusc farming areas fallowed/been subject to alternative measures in accordance with (a) within the established protection and surveillance zones have been restocked with molluscs sourced from Member States, zones or compartments with a Category I, II or III health status with regard to infection with Bonamia ostreae.b) | nytilførslen af bløddyr på alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), inden for de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår infektion med Bonamia ostreaeb) | la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés et la totalité des autres fermes aquacoles ou parcs à mollusques situés à l'intérieur des périmètres de protection et de surveillance établis et ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) aient été repeuplées avec des mollusques provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne l'infection à Bonamia ostreae;
(c) | the restocking has only taken place when all farms or mollusc farming areas officially declared infected have been emptied, cleansed, disinfected and fallowed/been subject to alternative measures in accordance with (a);c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a)c) | le repeuplement n'ait eu lieu qu'après que la totalité des fermes aquacoles ou des parcs à mollusques officiellement déclarés infectés ont été vidés de leurs mollusques, nettoyés, désinfectés et soumis à un vide sanitaire ou à d'autres mesures conformément au point a);
(d) | no confirmation of infection with Bonamia ostreae has occurred during the period of 2 years that follows the completion of the measures referred to in (a),(b) and (c), and suspicions during this period have been ruled out according to the procedures established in point II.3.d) | der ikke har været bekræftet infektion med Bonamia ostreae i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.d) | aucune infection à Bonamia ostreae n'ait été confirmée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.
II.   Diagnostic methods and diagnostic criteriaII.   Diagnosemetoder og diagnosekriterierII.   Méthodes et critères de diagnostic
II.1.   SamplesII.1.   PrøverII.1.   Échantillons
The whole animal shall be submitted to the laboratory for the performance of the diagnostic tests provided for in points II.2 and II.3.Hele dyret skal indsendes til laboratoriet med henblik på udførelse af de diagnostiske test i punkt II.2 og II.3.L'animal entier est présenté au laboratoire pour la réalisation des tests de diagnostic spécifiés aux points II.2 et II.3.
II.2.   Diagnostic methods to obtain or maintain disease-free status for infection with Bonamia ostreaeII.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreaeII.2.   Méthodes de diagnostic pour l'obtention et le maintien du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae
The diagnostics methods to be used to obtain or maintain disease-free status for infection with Bonamia ostreae, shall be histopathology, tissue imprints or PCR. When applying these diagnostic methods, the corresponding detailed methods and procedures set out in of Part 5 of Annex II shall be followed.De diagnosemetoder, der skal anvendes for opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreae, er histopatologi, vævsaftryk eller PCR. Ved anvendelsen af disse diagnosemetoder skal de detaljerede metoder og procedurer i bilag II, del 5, følges.Les méthodes de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de maladie» en ce qui concerne les infections à Bonamia ostreae sont l'examen histopathologique, les empreintes tissulaires ou la PCR. Lors de l'application de ces méthodes de diagnostic, les méthodes et procédures détaillées correspondantes décrites à l'annexe II, partie 5, doivent être respectées.
II.3.   Diagnostic criteria to confirm of the presence of or to rule out the suspicion of infection with Bonamia ostreaeII.3.   Diagnosemetoder med henblik på at bekræfte forekomst af eller udelukke mistanke om infektion med Bonamia ostreaeII.3.   Critères de diagnostic pour confirmer la présence d'une infection à Bonamia ostreae ou écarter une suspicion d'une telle infection
When a suspicion of infection with Bonamia ostreae is required to be confirmed or ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedure shall be complied with:Hvis mistanke om forekomst af infektion med Bonamia ostreae skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion d'infection à Bonamia ostreae conformément à l'article 28 de la directive 2006/88/CE, les procédures d'inspection, d'échantillonnage et d'essai suivantes doivent être respectées:
The official investigation shall include at least one sampling of 30 molluscs of susceptible species if the suspicion is based on a mortality report, or if not 150 molluscs of susceptible species after the beginning of the transmission period of Bonamia ostreae. When the transmission period is not known, the sampling shall begin in the winter or at the beginning of spring. The samples shall be tested using the diagnostic methods set out in point (i) following the detailed diagnostic methods and procedures set out in Section I of Part 5 of Annex II.Den officielle undersøgelse skal omfatte mindst én prøveudtagning af 30 bløddyr af modtagelige arter, hvis mistanken bygger på en rapport om dødelighed, eller, hvis dette ikke er tilfældet, 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Bonamia ostreae. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes om vinteren eller først på foråret. Prøverne undersøges ved hjælp af diagnosemetoderne i nr. i) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 5, afsnit I.l'enquête officielle doit comporter au moins un échantillonnage sur 30 mollusques d'espèces sensibles si la suspicion est fondée sur un rapport de mortalité, ou, si tel n'est pas le cas, sur 150 mollusques d'espèces sensibles, les prélèvements étant réalisés après le début de la période de transmission de Bonamia ostreae. Lorsque la période de transmission n'est pas connue, l'échantillonnage doit commencer en hiver ou au début du printemps. Les échantillons doivent être testés à l'aide des méthodes de diagnostic indiquées au point i) conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 5, section I:
(i) | the presence of Bonamia ostreae shall be considered as confirmed when a positive result by histopathology, tissue imprints or in situ hybridisation is combined with a positive result by PCR completed by sequencing in accordance with the approved methods and procedures set out in Part 5 of Annex II;i) | Forekomst af Bonamia ostreae anses for bekræftet, hvis et positivt resultat opnået ved histopatologi, vævsaftryk eller in situ-hybridisering er kombineret med et positivt resultat opnået ved PCR efterfulgt af sekventering i overensstemmelse med de godkendte metoder og procedurer i bilag II, del 5.i) | la présence de Bonamia ostreae doit être considérée comme confirmée lorsque l'examen histopathologique, les empreintes tissulaires ou l'hybridation in situ donnent un résultat positif associé à un résultat positif obtenu par la PCR complétée par un séquençage, conformément aux méthodes et procédures approuvées décrites à l'annexe II, partie 5;
(ii) | the suspicion of the presence of infection with Bonamia ostreae shall be ruled out, if those tests reveal no further evidence of the presence of Bonamia ostreae.ii) | En mistanke om forekomst af infektion med Bonamia ostreae anses for udelukket, hvis disse undersøgelser ikke afslører yderligere tegn på forekomst af Bonamia ostreae.ii) | une suspicion d'infection à Bonamia ostreae doit être écartée si ces tests n'apportent pas de preuve supplémentaire de la présence de Bonamia ostreae.
Table 5.ATabel 5.ATableau 5.A
Surveillance scheme for Member States, zones or compartments for the control period which precedes the achievement of disease-free status for Bonamia ostreae as referred to in point I.2.1Overvågningsordning for medlemsstater, zoner eller segmenter i kontrolperioden forud for opnåelse af status som sygdomsfri for så vidt angår Bonamia ostreae, jf. punkt I.2.1Programme de surveillance dans les États membres, zones ou compartiments pour la période qui précède l'obtention du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae visé au point I.2.1
  | Number of health inspections per year | Number of laboratory examinations per year | Number of molluscs in the sample  | Antal sundhedsinspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal bløddyr i prøven  | Nombre d'inspections sanitaires par an | Nombre d'examens de laboratoire par an | Nombre de mollusques par échantillon
Farms/Mollusc farming areas | 1 | 1 | 150Akvakulturbrug/områder med opdræt af bløddyr | 1 | 1 | 150Fermes aquacoles/parcs à mollusques | 1 | 1 | 150
Table 5.BTabel 5.BTableau 5.B
Surveillance schemes for Member States, zones or compartments to maintain disease-free status for Bonamia ostreae as referred to in point I.3Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår Bonamia ostreae, jf. punkt I.3Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de maladie» en ce qui concerne l'infection à Bonamia ostreae visé au point I.3
Risk level | Number of health inspections | Number of laboratory examinations | Number of molluscs in the sampleRisikoniveau | Antal sundhedsinspektioner | Antal laboratorieundersøgelser | Antal bløddyr i prøvenNiveau de risque | Nombre d'inspections sanitaires | Nombre d'examens de laboratoire | Nombre de mollusques par échantillon
High | 1 every year | 1 every 2 years | 150Højt | 1 pr. år | 1 hvert 2. år | 150Élevé | Une par an | Un tous les deux ans | 150
Medium | 1 every 2 years | 1 every 2 years | 150Middel | 1 hvert 2. år | 1 hvert 2. år | 150Moyen | Une tous les deux ans | Un tous les deux ans | 150
Low | 1 every 2 years | 1 every 4 years | 150Lavt | 1 hvert 2. år | 1 hvert 4. år | 150Faible | Une tous les deux ans | Un tous les quatre ans | 150
PART 6DEL 6PARTIE 6
SURVEILLANCE AND CONTROL METHODS FOR WHITE SPOT DISEASE (WSD)OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR WHITE SPOT DISEASE (WSD)SURVEILLANCE ET MÉTHODES DE LUTTE CONTRE LA MALADIE DES POINTS BLANCS (MPB)
I.   Requirements for surveillance and eradication programmes to obtain and maintain disease-free health statuses with regard to WSD and to contain infection with WSSVI.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår WSD og foranstaltninger mod spredning af infektion med WSSVI.   Exigences relatives aux programmes de surveillance et d'éradication en vue de l'obtention et du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la MPB ainsi que des mesures de confinement destinées à lutter contre l'infection par le virus du syndrome des points blancs (VSPB)
I.1.   General requirements for inspections and samplingI.1.   Generelle krav til inspektioner og prøveudtagningI.1.   Exigences générales relatives aux inspections et à l'échantillonnage
The sampling of crustaceans for laboratory examination shall be carried out whenever the water temperature is likely to reach its highest annual point. That requirement concerning water temperature shall also apply to health inspections where these are feasible and appropriate.Prøveudtagning af krebsdyr til laboratorieundersøgelse skal foretages, når vandtemperaturen forventes at være højest. Dette krav til vandtemperaturen gælder også for sundhedsinspektioner, hvor disse er gennemførlige og relevante.L'échantillonnage des crustacés en vue d'examens de laboratoire doit être effectué chaque fois que la température de l'eau est susceptible d'atteindre les maxima annuels. Cette exigence concernant la température de l'eau s'applique également aux inspections sanitaires lorsque celles-ci sont réalisables et appropriées.
When farmed crustaceans are to be sampled in accordance with the requirements set out in this Part, the following criteria shall apply:Hvis der skal udtages prøver af opdrættede krebsdyr i overensstemmelse med denne del, finder følgende kriterier anvendelse:Si les crustacés d'élevage doivent faire l'objet d'un échantillonnage conformément aux exigences définies dans la présente partie, les critères suivants doivent être respectés:
(a) | if weak or moribund crustaceans are present in the production units, such crustaceans shall primarily be selected. If such crustaceans are not present, those selected shall include crustaceans of different size cohorts namely juveniles and adults, of the selected susceptible species, proportionally represented in the sample;a) | Hvis der forekommer svage eller døende krebsdyr i produktionsenhederne, udvælges først og fremmest disse krebsdyr. Forekommer der ikke sådanne krebsdyr, udvælges krebsdyr i forskellige størrelseskohorter, dvs. yngel og voksne krebsdyr, af de udvalgte modtagelige arter, som skal være proportionalt repræsenteret i prøvena) | en présence de crustacés faibles ou moribonds dans les unités de production, ces animaux doivent être sélectionnés en priorité. En l'absence de tels crustacés, l'échantillonnage doit porter sur des animaux appartenant à différentes cohortes de taille, à savoir des juvéniles et des adultes des espèces sensibles, qui doivent être représentés proportionnellement dans les échantillons;
(b) | if more than one water source is utilised for crustacean production, susceptible crustacean representing all water sources must be included for sampling.b) | Hvis der anvendes mere end én vandkilde til krebsdyrproduktion, skal der indgå modtagelige krebsdyr fra alle vandkilder i prøven.b) | si plus d'une source d'eau est utilisée pour la production des crustacés, des crustacés sensibles représentatifs de toutes les sources d'eau doivent être inclus dans les échantillons.
When targeted surveillance in wild populations is required in accordance with the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the number and geographical distribution of the sampling points shall be determined to obtain a reasonable coverage of the Member State, zone or compartment. The sampling points shall also be representative of the different ecosystems where the wild populations of susceptible species are located namely marine, estuary, river and lake systems.Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningssteder fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal også være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende populationer af modtagelige arter, dvs. hav-, udmundings-, flod- og søsystemer.Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, le nombre et la répartition géographique des points de prélèvement doivent être déterminés de façon à obtenir une couverture raisonnable de l'État membre, de la zone ou du compartiment. Les points de prélèvement doivent aussi être représentatifs des divers écosystèmes abritant des populations sauvages sensibles, à savoir les eaux marines, les estuaires, les cours d'eau et les lacs.
When targeted surveillance in wild populations is required in accordance with the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the crustaceans to be sampled shall be selected as follows:Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, udvælges krebsdyr til prøveudtagning på følgende måde:Lorsqu'une surveillance ciblée des populations sauvages est requise conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de la directive 2006/88/CE, les crustacés à inclure dans l'échantillonnage doivent être sélectionnés comme suit:
(i) | in marine and estuary systems areas, one or more of the following species shall be selected: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus or penaeid shrimp species namely Penaeus japonicus, Penaeus kerathurus, Penaeus semisulcatus. If those species are not present, the sample must be representative of other susceptible decapod species present. Given the broad susceptible host range, hosts may be selected from genera or families of the Decapoda where susceptibility has been experimentally or naturally demonstrated;i) | I områder med hav- og udmundingssystemer udvælges en eller flere af følgende arter: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus eller rejer af Penaeidae-familien, dvs. Penaeus japonicus, Penaeus kerathurus og Penaeus semisulcatus. Hvis disse arter ikke forekommer, skal prøven være repræsentativ for alle andre modtagelige arter af Decapoda-ordenen på stedet. I betragtning af det store antal forskellige modtagelige værtsarter kan værtsarter udvælges fra slægter eller familier af Decapoda-ordenen, såfremt modtagelighed er påvist eksperimentelt eller naturligt.i) | dans les aires marines et estuariennes, une ou plusieurs des espèces suivantes doivent être sélectionnées: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus ou les crevettes pénéides, notamment Penaeus japonicus, Penaeus kerathurus, Penaeus semisulcatus. Si ces espèces ne sont pas présentes, les échantillons doivent être représentatifs des autres espèces de décapodes sensibles présentes. Étant donné la grande variété d'hôtes sensibles, il y a lieu de choisir des hôtes appartenant à des genres ou familles de l'ordre des Decapoda dont la sensibilité a été démontrée expérimentalement ou dans la nature;
(ii) | in river and lake systems, one or more of the following species shall be selected: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes or Orconectes limosus. If those species are not present, the sample must be representative of other susceptible decapod species present. Given the broad susceptible host range, hosts may be selected from genera or families of the Decapoda where susceptibility has been experimentally or naturally demonstrated;ii) | I flod- og søsystemer udvælges en eller flere af følgende arter: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes eller Orconectes limosus. Hvis disse arter ikke forekommer, skal prøven være repræsentativ for andre modtagelige arter af Decapoda-ordenen på stedet. I betragtning af det store antal forskellige modtagelige værtsarter kan værtsarter udvælges fra slægter eller familier af Decapoda-ordenen, såfremt modtagelighed er påvist eksperimentelt eller naturligt.ii) | dans les cours d'eau et les lacs, une ou plusieurs des espèces suivantes doivent être sélectionnées: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes ou Orconectes limosus. Si ces espèces ne sont pas présentes, les échantillons doivent être représentatifs des autres espèces de décapodes sensibles présentes. Étant donné la grande variété d'hôtes sensibles, il y a lieu de choisir des hôtes appartenant à des genres ou familles de l'ordre des Decapoda dont la sensibilité a été démontrée expérimentalement ou dans la nature;
(iii) | if weak or moribund crustaceans are present, such crustaceans shall primarily be selected. If such crustaceans are not present, those selected shall include crustaceans of different size cohorts namely juveniles and adults of the selected susceptible species, proportionally represented in the sample.iii) | Hvis der forekommer svage eller døende krebsdyr, udvælges først og fremmest disse krebsdyr. Forekommer der ikke sådanne krebsdyr, udvælges krebsdyr i forskellige størrelseskohorter, dvs. yngel og voksne krebsdyr, af de udvalgte modtagelige arter, som skal være proportionalt repræsenteret i prøven.iii) | en présence de crustacés faibles ou moribonds, ces animaux doivent être sélectionnés en priorité. En l'absence de tels crustacés, l'échantillonnage doit porter sur des animaux appartenant à différentes cohortes de taille, à savoir des juvéniles et des adultes des espèces sensibles, qui doivent être représentés proportionnellement dans les échantillons.
I.2.   Specific requirements to obtain Category I health status with regard to WSDI.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår WSDI.2.   Exigences spécifiques pour l'obtention du statut sanitaire de catégorie I en ce qui concerne la MPB
I.2.1.   Surveillance programmesI.2.1.   OvervågningsprogrammerI.2.1.   Programmes de surveillance
(a) | a Member State, zone or compartment that has Category III health status with regard to WSD in accordance with part B of Annex III to Directive 2006/88/EC may achieve Category I health status with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment, meet the relevant requirements set out in Annex V to that Directive and all those farms and, when required by the second paragraph of point 2 of Part I of Annex V to Directive 2006/88/EC, the sampling points in wild populations selected in accordance with that point, have been subject to the following 2-year surveillance programme comprising health inspections and collection of samples for testing. | The farms or sampling points have been subject to health inspections and sampled for a minimum period of two consecutive years as laid down in Table 6.A set out in Section II. | During that 2-year period, the testing of all samples using the diagnostic methods set out in point II.2 have produced negative results for infection with WSD and any suspicion of WSD has been ruled out in accordance with the diagnostic methods set out in point II.3.a) | En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår WSD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i medlemsstaten, zonen eller segmentet opfylder de relevante krav i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, prøveudtagningsstederne i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte punkt, har været omfattet af følgende toårige overvågningsprogram, der omfatter sundhedsinspektioner og indsamling af prøver til analyse. | Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 6.A i afsnit II. | I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for infektion med WSD, og enhver mistanke om WSD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.a) | Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie III en ce qui concerne la MPB conformément à l'annexe III, partie B, de la directive 2006/88/CE peut obtenir le statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de ladite directive dans cet État membre, cette zone ou ce compartiment remplissent les conditions fixées à l'annexe V de ladite directive, et que toutes ces fermes aquacoles et, pour autant que les dispositions de l'annexe V, partie I, point 2, deuxième paragraphe, de ladite directive le requièrent, tous les points de prélèvement dans les populations sauvages sélectionnées conformément audit point, ont fait l'objet du programme de surveillance de deux ans ci-après comprenant des inspections sanitaires et le prélèvement d'échantillons en vue d'essais. | Les fermes aquacoles ou les points de prélèvement ont fait l'objet d'inspections sanitaires et d'échantillonnages pendant une période minimale de deux années consécutives, comme indiqué dans le tableau 6.A de la section II. | Au cours de cette période de deux ans, les tests de dépistage réalisés sur tous les échantillons à l'aide des méthodes de diagnostic spécifiées au point II.2 se sont révélés négatifs pour la MPB et toute suspicion de MPB a été écartée conformément aux méthodes de diagnostic indiquées au point II.3;
(b) | when during the implementation of the surveillance programme referred to in (a), infection with WSSV is confirmed in a farm included in that surveillance programme, and therefore its Category II health status has been withdrawn, that farm may immediately regain the Category II health status and continue the implementation of the surveillance programme to obtain disease-free status without implementing an eradication programme as set out in point I.2.2. provided that: | (i) | it is a continental farm whose health status regarding WSD is independent of the health status regarding that listed disease of the surrounding natural waters in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC; | (ii) | it has been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period must be at least 6 weeks; | (iii) | it has been restocked with crustaceans sourced from Member States, zones or compartments with a Category I health status with regard to WSD.b) | Hvis det i forbindelse med gennemførelsen af det overvågningsprogram, der er omhandlet i litra a), bekræftes, at der er infektion med WSSV på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som fastsat i punkt I.2.2, forudsat at bruget opfylder følgende betingelser: | i) | Det er et indlandsbrug, hvis sundhedsstatus vedrørende WSD er uafhængig af sundhedsstatussen i de omkringliggende naturlige vandområder for så vidt angår denne listeopførte sygdom i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF. | ii) | Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger. | iii) | Nytilførslen af krebsdyr er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD.b) | si, au cours de la mise en œuvre du programme de surveillance visé au point a), une infection par le VSPB est confirmée dans une ferme aquacole incluse dans ce programme de surveillance et que, par conséquent, cette ferme a vu son statut sanitaire de catégorie II lui être retiré, elle peut immédiatement retrouver ce statut sanitaire de catégorie II et poursuivre la mise en œuvre du programme de surveillance en vue de l'obtention du statut «indemne de maladie» sans mettre en œuvre le programme d'éradication décrit au point I.2.2 à condition de satisfaire aux conditions suivantes: | i) | il s'agit d'une ferme aquacole continentale dont le statut sanitaire en ce qui concerne la MPB est indépendant de celui des eaux naturelles avoisinantes pour cette maladie répertoriée, conformément à l'annexe V, partie II, point 3 de la directive 2006/88/CE; | ii) | elle a été vidée de ses crustacés, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée; | iii) | elle a été repeuplée avec des crustacés provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I en ce qui concerne la MPB.
I.2.2.   Eradication programmesI.2.2.   UdryddelsesprogrammerI.2.2.   Programmes d'éradication
I.2.2.1.   General requirementsI.2.2.1.   Generelle kravI.2.2.1.   Exigences générales
A Member State, zone or a compartment that has Category V health status with regard WSD may achieve Category I health status with regard to that listed disease when all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or the compartment have been subject at least to the following eradication programme:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår WSD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende udryddelsesprogram:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la MPB peut obtenir un statut sanitaire de catégorie I pour cette maladie répertoriée lorsque toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans cet État membre, cette zone ou ce compartiment ont été soumises au moins au programme d'éradication suivant:
(a) | the minimum control measures laid down in Section 4 of Chapter V of Directive 2006/88/EC have effectively been applied, and a containment area referred to in Article 32(b) of that Directive, comprising a protection zone and surveillance zone, has been established in the vicinity of the farm(s) officially declared infected with WSD. | The containment area must have been defined on a case-by-case basis taking into account factors influencing the risks for the spread of WSD to farmed and wild crustaceans, such as: the number, rate and distribution of the mortalities of crustaceans on the farm infected with WSD; the distance and density of neighbouring farms; contact farms; the species present at the farms; the farming practices applied in the affected and neighbouring farms; hydrodynamic conditions and other factors of epidemiological significance identified. | For the establishment of the protection and surveillance zones, the following minimum requirements shall apply: | (i) | a protection zone shall be established in the immediate vicinity of a farm officially declared infected with WSD and shall correspond to: | (1) | in marine and estuarine areas: the area included in a circle with a radius of at least one tidal excursion or at least 5 km, whichever is larger, centred on the farm officially declared infected with WSD, or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; or | (2) | in freshwaters: the entire water catchment area of the farm officially declared infected with WSD; the competent authority may limit the extension of the protection zone to parts of the water catchment area provided that the prevention of the spread of WSD is not compromised; | (ii) | a surveillance zone shall be established outside the protection zone and shall correspond: | (1) | in marine areas: an area, surrounding the protection zone, of overlapping tidal excursion zones; or an area, surrounding the protection zone, and included in a circle of a radius of 10 km from the centre of the protection zone; or an equivalent area determined according to appropriate hydrodynamic or epidemiological data; or | (2) | in freshwaters: as an extended area outside the established protection zone;a) | De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med WSD. | Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af WSD til opdrættede og vildtlevende krebsdyr som f.eks.: antal, procentdel og fordeling af døde krebsdyr på det akvakulturbrug, der er inficeret med WSD, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans. | Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav: | i) | Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med WSD, og den skal svare til: | 1) | i hav- og udmundingsområder: et område i en cirkel med en radius, der mindst svarer til en tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum i det akvakulturbrug, der officielt er erklæret inficeret med WSD, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller | 2) | i ferskvand: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med WSD; den kompetente myndighed kan begrænse beskyttelseszonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af WSD. | ii) | Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til: | 1) | i havområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller | 2) | i ferskvand: et udvidet område uden om den oprettede beskyttelseszone.a) | les mesures minimales de lutte prévues au chapitre V, section 4, de la directive 2006/88/CE ont effectivement été appliquées et une zone de confinement, telle que visée à l'article 32, point b), de ladite directive, assortie d'un périmètre de protection et d'un périmètre de surveillance, a été établie à proximité de la ou des fermes aquacoles officiellement déclarées infectées par le VSPB. | La zone de confinement doit avoir été définie au cas par cas, compte tenu des facteurs qui ont une incidence sur les risques de transmission de la MPB aux crustacés d'élevage et aux crustacés sauvages, à savoir: la mortalité, le taux de mortalité et la distribution de la mortalité des crustacés dans la ferme aquacole infectée par la MPB, la distance à laquelle se trouvent les fermes aquacoles voisines et la densité de ces dernières, les fermes aquacoles en contact, les espèces présentes dans les fermes aquacoles, les pratiques d'élevage appliquées dans les fermes aquacoles contaminées et dans les fermes aquacoles voisines, les conditions hydrodynamiques et les autres facteurs pertinents d'un point de vue épidémiologique. | Pour l'établissement des périmètres de protection et de surveillance, les exigences minimales suivantes doivent être satisfaites: | i) | un périmètre de protection doit être établi aux environs immédiats d'une ferme aquacole officiellement déclarée infectée par la MPB, et doit correspondre: | 1. | dans les aires marines et estuariennes: à une zone s'étendant sur un rayon d'au moins une excursion de marée et, en tout état de cause, d'au moins cinq kilomètres autour de la ferme aquacole officiellement déclarée infectée par la MPB, ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées; ou | 2. | dans les eaux douces: à la totalité du bassin hydrographique de la ferme aquacole officiellement déclarée infectée par la MPB; l'autorité compétente peut limiter l'extension du périmètre à certaines parties du bassin hydrographique à condition que cela ne remette pas en cause les moyens mis en œuvre pour empêcher la propagation de la MPB; | ii) | un périmètre de surveillance doit être établi au-delà du périmètre de protection et doit correspondre: | 1. | dans les aires marines: à une zone située autour du périmètre de protection et dont la zone d'excursion de marée chevauche celle du périmètre de protection, à une zone située autour du périmètre de protection et s'étendant sur un rayon de 10 kilomètres à partir du centre du périmètre de protection ou à une superficie équivalente déterminée selon les données hydrodynamiques ou épidémiologiques appropriées ou | 2. | dans les eaux douces: à une zone étendue qui se situe au-delà du périmètre de protection établi;
(b) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the protection zone not officially declared infected with WSD shall be subject to an official investigation comprising at least the following: | (i) | the collection of samples for testing of 10 crustaceans, when clinical signs or post-mortem signs consistent with infection WSD are observed, or 150 crustaceans, when clinical or post-mortem signs are not observed; and | (ii) | one health inspection; in those farms where the tests referred to in (i) have produced negative results, health inspections shall continue once per month during the season when the water temperature is likely to reach its highest annual points, until the protection zone has been withdrawn in accordance with point I.2.2.1(c).b) | På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med WSD, skal der foretages en officiel undersøgelse, der mindst omfatter følgende: | i) | indsamling af prøver med henblik på undersøgelse af 10 krebsdyr, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion på WSD, eller 150 krebsdyr, hvis der ikke konstateres kliniske tegn eller obduktionsfund, og | ii) | én sundhedsinspektion; på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater, skal der fortsat foretages sundhedsinspektioner én gang om måneden på den årstid, hvor vandtemperaturen forventes at være højest, indtil beskyttelseszonen er blevet ophævet i overensstemmelse med punkt I.2.2.1, litra c).b) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II de la directive 2006/88/CE, qui se trouvent à l'intérieur du périmètre de protection et qui ne sont pas officiellement déclarées infectées par la MPB doivent faire l'objet d'une enquête officielle comprenant au moins les éléments suivants: | i) | un prélèvement d'échantillons en vue de la réalisation de tests sur 10 crustacés en cas de signes cliniques ou de signes post-mortem compatibles avec la MPB, ou sur 150 crustacés en l'absence de signes cliniques ou de signes post mortem; et | ii) | une inspection sanitaire; dans les fermes aquacoles où les tests visés au point i) ont donné des résultats négatifs, les inspections sanitaires doivent se poursuivre à raison d'une fois par mois pendant la saison durant laquelle la température de l'eau est susceptible d'atteindre les maxima annuels, jusqu'à la levée du périmètre de protection conformément au point I.2.2.1 c);
(c) | all farms officially declared infected with WSD shall be emptied, cleansed disinfected and fallowed. The duration of the fallowing period shall be at least 6 weeks. When all farms officially declared infected are emptied, at least 3 weeks of synchronised fallowing shall be carried out. This paragraph shall also apply to new farms officially declared infected during the implementation of the eradication programme. | When fallowing of the officially declared infected farms is carried out, the protection zones shall be converted into surveillance zones. | The competent authority may decide to require the emptying, cleansing, disinfection and fallowing of other farms within the established protection and surveillance zones. The length of that fallowing period shall be determined by the competent authority following a case by case risk evaluation.c) | Alle akvakulturbrug, der officielt er erklæret inficeret med WSD, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Når alle akvakulturbrug, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet. | Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner. | Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug skal være udtaget af drift.c) | toutes les fermes aquacoles officiellement déclarées infectées par la MPB doivent être vidées de leurs animaux, nettoyées et désinfectées et une période de vide sanitaire d'une durée d'au moins six semaines doit être observée. Lorsque la totalité des fermes aquacoles officiellement déclarées infectées ont été vidées de leurs crustacés, un vide sanitaire synchronisé d'au moins trois semaines doit être mis en place. Le présent paragraphe s'applique également aux nouvelles fermes aquacoles officiellement déclarées infectées pendant la mise en œuvre du programme d'éradication. | Lors du vide sanitaire des fermes aquacoles officiellement déclarées infectées, les périmètres de protection sont convertis en périmètres de surveillance. | L'autorité compétente peut décider d'exiger que d'autres fermes aquacoles situées à l'intérieur des périmètres de protection et de surveillance établis soient vidées de leurs crustacés, nettoyées, désinfectées et qu'elles fassent l'objet d'un vide sanitaire. La durée de la période de vide sanitaire est déterminée par l'autorité compétente sur la base d'une évaluation des risques au cas par cas;
(d) | all farms officially declared infected and all other farms fallowed within the established protection and surveillance zones shall be restocked: | (i) | with crustaceans sourced from Member States, zones or compartments with a Category I health status as regards WSD; or | (ii) | for a transitional period until 31 December 2020, with crustaceans from Member States, zones or compartments with an approved WSD surveillance programme. | Restocking shall only take place when all farms officially declared infected with WSD have been emptied, cleansed, disinfected and fallowed in accordance with point I.2.2.1(c).d) | På alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre akvakulturbrug, der er udtaget af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af krebsdyr: | i) | ske med krebsdyr fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD eller | ii) | i en overgangsperiode indtil 31. december 2020 ske med krebsdyr fra medlemsstater, zoner eller segmenter med et godkendt WSD-overvågningsprogram. | Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret med WSD, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).d) | toutes les fermes aquacoles officiellement déclarées infectées et toutes les autres fermes ayant fait l'objet d'un vide sanitaire qui se trouvent à l'intérieur des périmètres de protection et de surveillance établis doivent être repeuplées: | i) | avec des crustacés provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la MPB; ou | ii) | transitoirement jusqu'au 31 décembre 2020, avec des crustacés provenant d'États membres, de zones ou de compartiments faisant l'objet d'un programme de surveillance de la MPB approuvé. | Le repeuplement ne doit avoir lieu qu'une fois que toutes les fermes aquacoles officiellement déclarées infectées par la MPB ont été vidées de leurs animaux, nettoyées et désinfectées, puis soumises à une période de vide sanitaire conformément au point I.2.2.1. c);
(e) | all farms keeping susceptible species listed in Part II of Annex IV to Directive 2006/88/EC within the Member State, zone or compartment covered by the eradication programme and, when surveillance in wild populations is required, sampling points selected in accordance with the second paragraph of point 2 of Part I of Annex V to that Directive, must subsequently be subject at least to the programme laid down in point I.2.1.e) | Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med del I, punkt 2, andet afsnit, i bilag V til samme direktiv skal efterfølgende være omfattet af mindst det program, der er fastsat i punkt I.2.1.e) | toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de la directive 2006/88/CE dans l'État membre, la zone ou le compartiment couverts par le programme d'éradication, ainsi que, lorsqu'une surveillance des populations sauvages est requise, les points de prélèvement sélectionnés conformément à l'annexe V, partie I, point 2, deuxième paragraphe, de ladite directive doivent avoir ensuite été soumises au moins au programme de surveillance décrit au point I.2.1.
I.2.2.2.   Requirements for regaining disease-free status with regard to WSD for continental compartments comprising one single farm that previously was declared free of WSDI.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for så vidt angår WSD for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for WSDI.2.2.2.   Exigences à respecter pour que des compartiments continentaux comprenant une seule ferme aquacole précédemment déclarés indemnes de la MPB puissent retrouver le statut «indemne de maladie»
A continental compartment comprising one single farm that has Category I health status with regard to WSD, whose health status with regard to that listed disease is independent of the surrounding natural waters in accordance with point 3 of Part II of Annex V to Directive 2006/88/EC, and whose Category I status has been withdrawn in accordance with Article 53(3) of that Directive, may regain Category I health status immediately after the competent authority has confirmed that the following conditions have been complied with:Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår WSD, og hvis sundhedsstatus for så vidt angår denne listeopførte sygdom er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i henhold til artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at bruget har opfyldt følgende betingelser:Un compartiment continental comprenant une seule ferme aquacole ayant un statut sanitaire de catégorie I en ce qui concerne la MPB, dont le statut sanitaire à l'égard de cette maladie répertoriée est indépendant de celui des eaux naturelles avoisinantes, conformément à l'annexe V, partie II, point 3, de la directive 2006/88/CE, et qui s'est vu retirer ce statut sanitaire de catégorie I conformément à l'article 53, paragraphe 3, de ladite directive, peut retrouver ce statut de catégorie I dès que l'autorité compétente a confirmé que les conditions suivantes sont remplies:
(a) | the farm with WSD has been emptied, cleansed, disinfected and fallowed; the duration of the fallowing period must have been at least 6 weeks;a) | Akvakulturbruget med WSD er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.a) | la ferme aquacole infectée par la MPB a été vidée de ses animaux, nettoyée, désinfectée et une période de vide sanitaire d'une durée d'au moins six semaines a été observée;
(b) | the farm with WSD has been restocked with crustaceans sourced from Member States, zones or compartments with a Category I health status with regard to WSD.b) | Nytilførslen af krebsdyr på akvakulturbruget med WSD er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD.b) | la ferme infectée a été repeuplée avec des crustacés provenant d'États membres, de zones ou de compartiments jouissant d'un statut sanitaire de catégorie I en ce qui concerne la MPB.
I.3.   Specific requirements for the maintenance of disease-free health status (Category I) with regard to WSDI.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår WSDI.3.   Exigences spécifiques pour le maintien du statut sanitaire «indemne de maladie» (catégorie I) en ce qui concerne la MPB
When targeted surveillance is required to maintain category I health status, as laid down in Article 52 of Directive 2006/88/EC, all farms keeping susceptible species listed in Part II of Annex IV to that Directive within the Member State, zone or compartment concerned shall undergo a health inspection and sampling in accordance with Table 6 B set out in Section II, taking into account the risk level of the farm for the contraction of WSD.Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal der på alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment foretages en sundhedsinspektion og udtages prøver i overensstemmelse med tabel 6.B i afsnit II, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af WSD.Lorsqu'une surveillance ciblée est nécessaire pour maintenir le statut sanitaire de catégorie I conformément à l'article 52 de la directive 2006/88/CE du Conseil, toutes les fermes aquacoles détenant des espèces sensibles énumérées à l'annexe IV, partie II, de cette directive dans l'État membre, la zone ou le compartiment concernés doivent faire l'objet d'une inspection sanitaire et d'échantillonnages conformément au tableau 6.B de la section II, compte tenu du risque de contamination de la ferme aquacole par la MPB.
In Member States, zones or compartments where the number of farms is limited and targeted surveillance on those farms does not provide sufficient epidemiological data, the surveillance programmes to maintain disease-free status shall include sampling points selected in accordance with the requirements laid down in point I.1.I medlemsstater, zoner eller segmenter, i hvilke der er et begrænset antal akvakulturbrug, og målrettet overvågning på disse akvakulturbrug ikke giver tilstrækkelige epidemiologiske data, skal overvågningsprogrammerne med henblik på opretholdelse af status som sygdomsfri omfatte prøveudtagningssteder udvalgt i overensstemmelse med kravene i punkt I.1.Dans les États membres, les zones ou les compartiments comptant un nombre limité de fermes aquacoles et où la surveillance ciblée de ces établissements ne fournit pas suffisamment de données épidémiologiques, les programmes de surveillance nécessaires pour maintenir le statut «indemne de maladie» doivent inclure des points de prélèvement sélectionnés conformément aux exigences fixées au point I.1.
Those sampling points shall be inspected and sampled by rotation of 50 % of the sampling points each year. The sampling shall be carried out in accordance with Table 6 B set out in Section II. The samples shall be selected, prepared and examined in accordance with the diagnostic and sampling methods set out in Section II and the laboratory examinations must have produced negative results as regards to the agent of WSD.Disse prøveudtagningssteder skal underkastes inspektioner og prøveudtagninger efter en rotationsordning (50 % af prøveudtagningsstederne pr. år). Prøveudtagningen skal foretages i overensstemmelse med tabel 6.B. i afsnit II. Prøverne skal udvælges, præpareres og undersøges i overensstemmelse med diagnose- og prøveudtagningsmetoderne i afsnit II, og laboratorieundersøgelserne skal have givet negative resultater med hensyn til WSD-agens.50 % de ces points de prélèvement doivent faire l'objet d'inspections et de prélèvements chaque année, par rotation. L'échantillonnage doit être réalisé conformément au tableau 6.B de la section II. Les échantillons doivent être sélectionnés, préparés et analysés conformément aux méthodes d'échantillonnage et de diagnostic décrites à la section II et les examens de laboratoire doivent avoir fourni des résultats négatifs en ce qui concerne l'agent de la MPB.
Disease-free status shall only be maintained as long as all samples tested using the diagnostic and sampling methods set out in point II.2 produce negative results for WSD and any suspicion of WSD has been ruled out in accordance with the official investigation and diagnostic methods set out in point II.3.Statussen som sygdomsfri opretholdes kun, så længe alle prøver ved hjælp af diagnose- og prøveudtagningsmetoderne i punkt II.2 giver negative resultater for WSD, og enhver mistanke om WSD er blevet udelukket i overensstemmelse med de officielle undersøgelses- og diagnosemetoder i punkt II.3.Le statut «indemne de maladie» ne doit être maintenu que tant que tous les échantillons testés à l'aide des méthodes de diagnostic établies au point II.2 se révèlent négatifs pour la MPB et que toute suspicion de MPB est écartée conformément aux méthodes d'enquête officielle et de diagnostic établies au point II.3.
I.4.   Requirements for the lifting of the containment measures provided for in Article 39 of Directive 2006/88/EC (the change from Category V to Category III health status) with regard to WSDI.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med WSDI.4.   Exigences à respecter pour la levée des mesures de confinement prévues à l'article 39 de la directive 2006/88/CE (passage d'un statut sanitaire de catégorie V à un statut de catégorie III) en ce qui concerne la MPB
A Member State, zone or a compartment which has Category V health status with regard to WSD may achieve Category III health status with regard to that listed disease provided that:En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår WSD, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:Un État membre, une zone ou un compartiment ayant un statut sanitaire de catégorie V en ce qui concerne la MPB peut obtenir le statut sanitaire de catégorie III pour cette maladie répertoriée à condition que:
(a) | the requirements set out in points I.2.2.1(a), (b) and (c) have been met. In case fallowing is not technically possible, the farms shall be subject to an alternative measure which provides almost similar guarantee for extermination of WSSV from the environment of the farm;a) | de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at WSSV er udryddet i akvakulturbrugets miljøa) | Les exigences définies au paragraphe I.2.2.1, points a), b) et c) soient satisfaites. Dans les cas où il n'est techniquement pas possible de mettre en place un vide sanitaire, les fermes aquacoles doivent faire l'objet d'une autre mesure offrant des garanties quasiment identiques pour l'éradication du VSPB de l'environnement de la ferme aquacole;
(b) | all farms officially declared infected with WSD and all other farms fallowed/been subject to alternative measures in accordance with (a) within the established protection and surveillance zones have been restocked with crustacean sourced from Member States, zones or compartments with a Category I, II or III health status with regard to WSD.b) | nytilførslen af krebsdyr på alle akvakulturbrug, der officielt er erklæret inficeret med WSD, og på alle andre brug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår WSDb) | toutes les fermes aquacoles officiellement déclarées infectées par la MPB et toutes les autres fermes aquacoles ayant fait l'objet d'un vide sanitaire ou d'autres mesures conformément au point a) situées à l'intérieur des périmètres de protection et de surveillance établis aient été repeuplées avec des crustacés provenant d'États membres, de zones ou de compartiments ayant un statut sanitaire de catégorie I, II ou III en ce qui concerne la MPB;
(c) | the restocking has only taken place when all farms officially declared infected with WSD have been emptied, cleansed, disinfected and fallowed/been subject to alternative measures in accordance with (a);c) | nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret med WSD, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).c) | le repeuplement n'ait eu lieu qu'après que toutes les fermes aquacoles officiellement déclarées infectées par la MPB ont été vidées de leurs animaux, nettoyées, désinfectées et soumises à un vide sanitaire ou à d'autres mesures conformément au point a);
(d) | no detection of WSD has occurred during the period of 2 years that follows the completion of the measures set out in paragraphs (a) and (b) and suspicions during this period have been ruled out according to the procedures established in point II.3.d) | der ikke har været påvist WSD i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), og b), og at mistanke i denne periode er blevet udelukket i henhold til de procedurer, der er fastsat i punkt II.3.d) | la MPB n'ait pas été détectée au cours des deux années suivant l'exécution des mesures visées aux points a), b) et c), et que toute suspicion au cours de cette période ait été écartée conformément aux procédures établies au point II.3.
II.   Diagnostic and sampling methodsII.   Diagnose- og prøveudtagningsmetoderII.   Méthodes d'échantillonnage et de diagnostic
II.1.   SamplesII.1.   PrøverII.1.   Échantillons
Samples of integumental epidermis, either dissected or contained within walking legs, pleopods, mouthparts or gills of the test animal shall be fixed in 95 % ethanol prior to the preparation of samples for two-step PCR.Prøver af integumentær epidermis, enten dissekeret eller indeholdt i det undersøgte dyrs gangben, pleopoder, munddele eller gæller, skal fikseres i 95 % ethanol inden præparation af prøverne til totrins-PCR.Des échantillons d'épiderme tégumentaire, soit disséqué, soit présent dans les pattes locomotrices, les pléopodes, les pièces buccales ou les branchies de l'animal d'expérience sont fixés dans de l'éthanol à 95 % avant la préparation des échantillons pour la PCR en deux étapes.
Other samples, fixed for histology and transmission electron microscopy may be collected to support diagnostic data arising from PCR.Andre prøver, der er fikseret med henblik på histologi og transmissionselektronmikroskopi, kan indsamles til støtte for diagnostiske data fra PCR.D'autres échantillons, fixés pour l'examen histologique et l'examen en microscopie électronique à transmission peuvent être prélevés pour corroborer les données de diagnostic obtenues par PCR.
II.2.   Diagnostic methods to obtain or maintain disease-free status with regard to WSDII.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår WSDII.2.   Méthodes de diagnostic pour l'obtention ou le maintien du statut «indemne de la MPB»
The diagnostic method to be used to obtain or to maintain disease-free status with regard to WSD following the detailed methods and procedures set out in Part 6 of Annex II, shall be two-step PCR.Den diagnosemetode, der skal anvendes for opnå eller opretholde status som sygdomsfri for så vidt angår WSD i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 6, er totrins-PCR.La méthode de diagnostic à utiliser pour l'obtention ou le maintien du statut «indemne de la MPB» conformément aux méthodes et procédures de diagnostic détaillées figurant à l'annexe II, partie 6, est la PCR en deux étapes.
In the case of a positive result of the two-step PCR, the result shall be corroborated by the sequencing of the amplicon before the initial control measures provided for in Article 28 of Directive 2006/88/EC are implemented, if possible under practical conditions by the demonstration of pathognomonic signs of WSD in those susceptible hosts selected, via histology and transmission electron microscopy.Hvis totrins-PCR giver et positivt resultat, skal resultatet bekræftes ved sekventering af amplikon inden gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF, hvis det er praktisk muligt ved påvisning af patognomoniske tegn på WSD i de udvalgte modtagelige værter via histologi og transmissionselektronmikroskopi.Si la PCR en deux étapes donne un résultat positif, celui-ci doit être corroboré par le séquençage du produit d'amplification avant la mise en place des premières mesures de lutte prévues à l'article 28 de la directive 2006/88/CE, si possible, concrètement, par la mise en évidence, par examen histologique et microscopie électronique à transmission, de signes pathognomoniques de la MPB chez les hôtes sensibles sélectionnés.
II.3.   Official investigation and diagnostic methods to rule out the suspicion of or to confirm the presence of infection with WSDII.3.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke mistanke om eller bekræfte forekomst af infektion med WSDII.3.   Méthodes d'enquête officielle et de diagnostic pour écarter une suspicion de MPB ou pour confirmer la présence de la maladie
When the presence of infection with WSD is required to be confirmed or the suspicion of such infection is required be ruled out in accordance with Article 28 of Directive 2006/88/EC, the following inspection, sampling and testing procedure shall be complied with:Hvis forekomst af infektion med WSD skal bekræftes eller mistanke om en sådan infektion udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:Lorsqu'il est nécessaire de confirmer ou d'écarter une suspicion de MPB conformément à l'article 28 de la directive 2006/88/CE, la procédure d'inspection, d'échantillonnage et d'essai suivante doit être respectée:
(a) | the official investigation shall include at least one health inspection and one sampling of 10 crustaceans when clinical or post-mortem signs consistent with infection with WSD are observed or 150 crustaceans when clinical or post-mortem signs are not observed. The samples shall be tested using the diagnostic method set out in point II.2 (two-step PCR);a) | Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 krebsdyr, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med WSD, eller 150 krebsdyr, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af diagnosemetoderne i punkt II.2 (totrins-PCR).a) | l'enquête officielle doit comprendre au moins une inspection sanitaire et un échantillonnage sur 10 crustacés en cas de signes cliniques ou de signes post-mortem compatibles avec une infection par le SVPB, ou sur 150 crustacés en l'absence de signes cliniques ou de signes post mortem. Les échantillons doivent être testés conformément à la méthode de diagnostic indiquée au point II.2 (PCR en deux étapes);
(b) | the presence of WSD shall be considered as confirmed when two-step PCR followed by sequencing, following the detailed methods and procedures set out in this Part 6 of Annex II, is positive for WSSV and, when pathognomonic signs of WSD are present in the selected hosts. | The suspicion of WSD may be ruled out, if those tests reveal no further evidence of the presence of WSD.b) | Forekomst af WSD anses for bekræftet, hvis totrins-PCR efterfulgt af sekventering i overensstemmelse med de detaljerede metoder og procedurer i bilag II, del 6, er positiv for WSSV, og hvis der forekommer patognomoniske tegn på WSD i de udvalgte værter. | Mistanke om forekomst af WSD kan udelukkes, hvis disse undersøgelser ikke afslører yderligere tegn på forekomst af WSD.b) | la présence de la MPB doit être considérée comme confirmée lorsque la PCR en deux étapes suivie d'un séquençage, réalisée selon les méthodes et procédures détaillées indiquées à l'annexe II, partie 6, se révèle positive pour le VSPB et que des signes pathognomoniques de la MPB sont observés chez les hôtes sélectionnés. | Une suspicion de MPB peut être écartée si les résultats de ces tests n'apportent aucun élément supplémentaire prouvant la présence de la MPB.
Table 6 ATabel 6.ATableau 6.A
Surveillance scheme for Member States, zones and compartments for the 2-year control period which precedes the achievement of WSD disease-free status as referred to in point I.2.1Overvågningsordning for medlemsstater, zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår WSD, jf. punkt I.2.1Programme de surveillance dans les États membres, zones et compartiments pour la période de deux ans qui précède l'obtention du statut «indemne de la MPB» visée au point I.2.1
  | Number of clinical inspections per year | Number of laboratory examinations per year | Number of crustaceans in the sample  | Antal kliniske inspektioner pr. år | Antal laboratorieundersøgelser pr. år | Antal krebsdyr i prøven  | Nombre d'inspections cliniques par an | Nombre d'examens de laboratoire par an | Nombre de crustacés par échantillon
Farms/sampling sites | 1 | 1 | 150Akvakulturbrug/prøveudtagningssteder | 1 | 1 | 150Fermes aquacoles/sites de prélèvement | 1 | 1 | 150
Table 6 BTabel 6.BTableau 6.B
Surveillance schemes for Member States, zones or compartments to maintain WSD disease-free status as referred to in point I.3Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår WSD, jf. punkt I.3Programmes de surveillance dans les États membres, zones ou compartiments en vue du maintien du statut «indemne de la MPB» visé au point I.3
Risk level | Number of health inspections | Number of laboratory examinations | Number of crustaceans in the sampleRisikoniveau | Antal sundhedsinspektioner | Antal laboratorieundersøgelser | Antal krebsdyr i prøvenNiveau de risque | Nombre d'inspections sanitaires | Nombre d'examens de laboratoire | Nombre de crustacés par échantillon
High | 1 every year | 1 every 2 years | 150Højt | 1 pr. år | 1 hvert 2. år | 150Élevé | Une par an | Un tous les deux ans | 150
Medium | 1 every 2 years | 1 every 2 years | 150Middel | 1 hvert 2. år | 1 hvert 2. år | 150Moyen | Une tous les deux ans | Un tous les deux ans | 150
Low | 1 every 2 years | 1 every 4 years | 150Lavt | 1 hvert 2. år | 1 hvert 4. år | 150Faible | Une tous les deux ans | Un tous les quatre ans | 150
(1)  The samples must be collected no sooner than 3 weeks after the transfer of the fish from fresh to saltwater.(1)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.(1)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.
(2)  Ovarian or seminal fluid of broodstock shall be collected at the time of maturation, in connection with stripping.(2)  Ovarie- eller sædvæske fra gydebestande indsamles på modningstidspunktet i forbindelse med strygning.(2)  Les ovaires ou le liquide séminal des géniteurs doivent être recueillis au moment de la maturation, à l'occasion de la ponte artificielle (stripping).
(3)  Samples must be taken from the number of fish that will ensure the detection of VHSV or IHNV with a 95 % confidence if the design prevalence is 5 %.(3)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 5 %.(3)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 5 %.
(4)  The samples must be collected no sooner than 3 weeks after the transfer of the fish from fresh to saltwater.(4)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.(4)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.
(5)  Ovarian or seminal fluid of broodstock shall be collected at the time of maturation, in connection with stripping.(5)  Ovarie- eller sædvæske fra gydebestande indsamles på modningstidspunktet i forbindelse med strygning.(5)  Les ovaires ou le liquide séminal des géniteurs doivent être recueillis au moment de la maturation, à l'occasion de la ponte artificielle (stripping).
(6)  Samples must be taken from the number of fish that will ensure detection of VHSV or IHNV with a 95 % confidence if the design prevalence is 10 %.(6)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 10 %.(6)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 10 %.
(7)  The samples must be collected no sooner than 3 weeks after the transfer of the fish from fresh to saltwater.(7)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.(7)  Les échantillons doivent être prélevés au plus tôt trois semaines après le transfert des poissons de l'eau douce à l'eau de mer.
(8)  Samples must be taken from the number of fish that will ensure the detection of VHSV or IHNV with a 95 % confidence if the design prevalence is 10 %.(8)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 10 %.(8)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection du virus de la SHV ou de la NHI avec un niveau de confiance de 95 % si la prévalence escomptée est de 10 %.
(9)  There shall be minimum one sample for every health inspection.(9)  Hver sundhedsinspektion skal som minimum omfatte én prøve.(9)  Au minimum un échantillon doit être prélevé pour chaque inspection sanitaire.
(10)  Samples must be taken from the number of fish that will ensure the detection of KHV with a 95 % confidence if the design prevalence is 5 %.(10)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af KHV med en konfidens på 95 % ved en udgangsprævalens på 5 %.(10)  Les échantillons doivent être prélevés sur un nombre de poissons propre à garantir la détection de l'HVK avec un niveau de confiance de 95 % si la prévalence escomptée est de 5 %.
(11)  Shall not apply to farms only rearing rainbow trout (Oncorhynchus mykiss) or brown trout (Salmo trutta) or both and where the water supply is exclusively based on fresh water sources not housing Atlantic salmon (Salmo salar).(11)  Gælder ikke for akvakulturbrug, der kun opdrætter regnbueørred (Onchorhynchus mykiss) eller havørred (Salmo trutta) eller begge, og hvor vandforsyningen udelukkende er baseret på ferskvandskilder, der ikke huser atlantisk laks (Salmo salar).(11)  Ne s'applique pas aux fermes aquacoles qui élèvent uniquement des truites arc-en-ciel (Oncorhynchus mykiss) ou des truites fario (Salmo trutta), ou les deux, dans une eau provenant exclusivement de sources d'eau douce n'abritant pas le saumon de l'Atlantique (Salmo salar).
(12)  Samples must be collected and stored and examined during two 1 month test periods per year (namely spring and autumn) or when appropriate in accordance with practical considerations.(12)  Prøver skal indsamles og opbevares samt undersøges i løbet af to årlige undersøgelsesperioder af en måneds varighed hver (dvs. forår og efterår), eller når det er hensigtsmæssigt ud fra praktiske overvejelser.(12)  Les échantillons doivent être prélevés et stockés puis examinés au cours de deux périodes de tests d'un mois chaque année (au printemps et en automne), ou selon ce qui convient en fonction de considérations d'ordre pratique.
(13)  Maximum number of fish per pool: 5.(13)  Maksimalt antal fisk pr. samleprøve: 5.(13)  Nombre maximal de poissons par regroupement: 5.
(14)  Samples must be collected and examined during two 1 month test periods per year (namely spring and autumn) or when appropriate in accordance with practical considerations.(14)  Prøver skal indsamles og undersøges i løbet af to årlige undersøgelsesperioder af en måneds varighed hver (dvs. forår og efterår), eller når det er hensigtsmæssigt ud fra praktiske overvejelser.(14)  Les échantillons doivent être prélevés et examinés au cours de deux périodes de tests d'un mois chaque année (au printemps et en automne), ou selon ce qui convient en fonction de considérations d'ordre pratique.
(15)  Shall not apply to farms only rearing rainbow trout (Oncorhynchus mykiss) or brown trout (Salmo trutta) or both and where the water supply is exclusively based on fresh water sources not housing Atlantic salmon (Salmo salar).(15)  Gælder ikke for akvakulturbrug, der kun opdrætter regnbueørred (Onchorhynchus mykiss) eller havørred (Salmo trutta) eller begge, og hvor vandforsyningen udelukkende er baseret på ferskvandskilder, der ikke huser atlantisk laks (Salmo salar).(15)  Ne s'applique pas aux fermes aquacoles qui élèvent uniquement des truites arc-en-ciel (Oncorhynchus mykiss) ou des truites fario (Salmo trutta), ou les deux, dans une eau provenant exclusivement de sources d'eau douce n'abritant pas le saumon de l'Atlantique (Salmo salar).
ANNEX IIBILAG IIANNEXE II
DETAILED DIAGNOSTIC METHODS AND PROCEDURESDETALJEREDE DIAGNOSEMETODER OG -PROCEDURERMÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES
I.   IntroductionI.   IndledningI.   Introduction
This Annex sets out the detailed procedures for the diagnostic methods to be used for the laboratory examination in the eradication and surveillance programmes set out in Annex I to this Decision, and in order to confirm or rule out the suspected presence of the following non-exotic diseases listed in Part II to Annex IV to Directive 2006/88/EC (‘the listed diseases’) in accordance with Article 57 (b) to that Directive:I dette bilag fastsættes der detaljerede procedurer for de diagnosemetoder, der skal anvendes i forbindelse med laboratorieundersøgelserne i de udryddelses- og overvågningsprogrammer, der er fastsat i bilag I til denne afgørelse, for at bekræfte eller udelukke mistanke om forekomst af følgende ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (»listeopførte sygdomme«), i overensstemmelse med artikel 57, litra b), i samme direktiv:La présente annexe établit les procédures détaillées des méthodes de diagnostic à appliquer lors des examens de laboratoire prévus par les programmes d'éradication et de surveillance décrits à l'annexe I de la présente décision, et afin de confirmer ou d'écarter les suspicions des maladies non exotiques ci-après qui sont énumérées à l'annexe IV, partie II de la directive 2006/88/CE (ci-après les «maladies répertoriées»), conformément à l'article 57, point b), de cette directive:
1. | Viral haemorrhagic septicaemia (VHS) | Part 11. | Viral hæmoragisk septikæmi (VHS) | Del 11. | la septicémie hémorragique virale (SHV) | Partie 1
2. | Infectious hematopoietic necrosis (IHN) | Part 12. | Infektiøs hæmatopoietisk nekrose (IHN) | Del 12. | la nécrose hématopoïétique infectieuse (NHI) | Partie 1
3. | Koi herpesvirus (KHV) disease | Part 23. | Koi-herpesvirus-sygdom (KHV) | Del 23. | l'herpèsvirose de la carpe koï (HVCK) | Partie 2
4. | Infectious salmon anaemia (ISA) | Part 34. | Infektiøs lakseanæmi (ISA) | Del 34. | l'anémie infectieuse du saumon (AIS) | Partie 3
5. | Infection with Marteilia refringens | Part 45. | Infektion med Marteilia refringens | Del 45. | l'infection à Marteilia refringens | Partie 4
6. | Infection with Bonamia ostreae | Part 56. | Infektion med Bonamia ostreae | Del 56. | l'infection à Bonamia ostreae | Partie 5
7. | White spot disease (WSD) | Part 67. | White spot disease (WSD) | Del 67. | la maladie des points blancs (MPB) | Partie 6
II.   DefinitionsII.   DefinitionerII.   Définitions
For the purpose of this Annex, ‘transport medium’ means a cell culture medium with 10 % calf serum and with 200 iu penicillin, 200 μg streptomycin, and 200 μg kanamycin per millilitre or with other antibiotics of proven efficacy.I dette bilag forstås ved »transportmedium«: et cellekulturmedium med 10 % kalveserum og med 200 iu penicillin, 200 μg streptomycin og 200 μg kanamycin pr. ml eller med andre dokumenteret effektive antibiotika.Aux fins de la présente annexe, on entend par «milieu de transport», un milieu de culture cellulaire contenant 10 % de sérum de veau, 200 UI de pénicilline, 200 μg de streptomycine et 200 μg de kanamycine par millilitre ou d'autres antibiotiques d'efficacité avérée.
PART 1DEL 1PARTIE 1
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR THE SURVEILLANCE AND CONFIRMATION OF IHN AND VHSDETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF IHN OG VHSMÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE LA NHI ET DE LA SHV
I.   Diagnostic methods and procedures for the surveillance of VHS and IHNI.   Diagnosemetoder og -procedurer for overvågning af VHS og IHNI.   Méthodes et procédures de diagnostic pour la surveillance de la SHV et de la NHI
When sampling and laboratory examination for the purpose of obtaining or maintaining disease-free health status with regard to IHN or VHS as set out in Section I of Part 1 of Annex I are carried out, using the diagnostic methods set out in points II.1 and II.2 of Part 1 of that Annex, the detailed diagnostic methods and procedures set out in following points I.1 to I.6 shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår IHN eller VHS som fastsat i bilag I, del 1, afsnit I, ved hjælp af diagnosemetoderne i del 1, punkt II.1 og II.2, i samme bilag, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1-l I.6 nedenfor.Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou du maintien du statut sanitaire «indemne de maladie» en ce qui concerne la NHI ou la SHV visé à l'annexe I, partie 1, section I, à l'aide des méthodes de diagnostic indiquées dans la partie 1, points II.1 et II.2, de ladite annexe, les méthodes et procédures de diagnostic détaillées décrites aux points I.1 à I.6 doivent être appliquées.
I.1.   Preparation and shipment of samples from fishI.1.   Præparation og forsendelse af fiskeprøverI.1.   Préparation et expédition des échantillons de poissons
I.1.1.   Tissues for virological examination on cell cultureI.1.1.   Væv til virologisk undersøgelse i cellekulturI.1.1.   Tissus destinés à un examen virologique sur culture cellulaire
Before shipment or transfer to the laboratory, pieces of the organs to be examined shall be removed from the fish with sterile dissection tools and transferred to sterile plastic tubes containing transport medium.Inden prøverne sendes eller overføres til laboratoriet, fjernes stykker af de organer, som skal undersøges, fra fisken med sterile dissektionsredskaber og overføres til sterile plastrør indeholdende transportmedium.Avant d'être expédiés ou transférés vers le laboratoire, les morceaux d'organes à examiner doivent être prélevés sur le poisson à l'aide d'instruments de dissection stériles et placés dans des tubes en plastique stériles contenant le milieu de transport.
The quantity of fish material suitable for virological examination on cell culture and by RT-qPCR is dependent on fish size. Thus, whole alevin (body length < 4 cm), viscera including kidney (4 cm < body length < 6 cm) or, for larger size fish, kidney, spleen, heart and/or encephalon, and ovarian fluid from brood fish at the time of spawning shall be the tissues to be sampled.Den mængde fiskemateriale, der er egnet til virologisk undersøgelse i cellekultur og ved hjælp af RT-qPCR, afhænger af fiskestørrelsen. Det væv, der skal udtages prøver af, er hel fiskeyngel (længde < 4 cm), indvolde inklusive nyre (4 cm < længde < 6 cm) eller, for større fisk, nyre, milt, hjerte og/eller hjerne samt ovarievæske fra gydefisk på gydetidspunktet.La quantité de tissus de poisson nécessaire pour un examen virologique sur culture cellulaire et par RT-qPCR dépend de la taille des poissons. On prélèvera donc l'alevin entier (si longueur du corps < 4 cm), les viscères, y compris les reins (si 4 cm < longueur du corps < 6 cm) ou, dans le cas des poissons de plus grande taille, les reins, la rate, le cœur et/ou l'encéphale, ainsi que le liquide ovarien des reproductrices au moment du frai.
Ovarian or seminal fluid or organ pieces from a maximum of 10 fish may be collected in one sterile tube containing at least 4 ml transport medium and represent one pooled sample. The tissue in each sample shall weigh a minimum of 0,5 gram (g).Ovarie- eller sædvæske eller organstykker fra højst 10 fisk kan indsamles i et sterilt rør indeholdende mindst 4 ml transportmedium og udgøre en samleprøve. Vævet i hver prøve skal veje mindst 0,5 g.Du liquide ovarien ou séminal ou des morceaux d'organes provenant de dix poissons au maximum peuvent être regroupés dans un tube stérile contenant au moins 4 ml de milieu de transport; ils constituent un échantillon global. Le poids minimal de tissus contenus dans chaque échantillon doit être de 0,5 gramme (g).
The virological examination on cell culture shall be started as soon as possible and no later than 48 hours after the collection of the samples. In exceptional cases, the virological examination may be started at the latest within 72 hours after the collection of the material, provided that the material to be examined is protected by a transport medium and that the temperature requirements during transportation can be fulfilled.Den virologiske undersøgelse i cellekultur skal påbegyndes hurtigst muligt og senest 48 timer efter prøveudtagningen. I undtagelsestilfælde kan den virologiske undersøgelse påbegyndes senest 72 timer efter indsamlingen af materialet, hvis materialet er beskyttet af transportmedium, og kravene til transporttemperaturen kan overholdes.L'examen virologique sur culture cellulaire doit commencer dès que possible et au plus tard 48 heures après le prélèvement des échantillons. Dans des cas exceptionnels, l'examen virologique peut commencer au plus tard 72 heures après la collecte du matériel à examiner à condition que celui-ci soit conservé dans le milieu de transport et que les conditions de température requises pendant le transport aient pu être respectées.
I.1.2.   Samples for reversed transcriptase polymerase chain reaction (RT-PCR or RT-qPCR) analysisI.1.2.   Prøver til analyse ved revers transkriptase-polymerasekædereaktion (RT-PCR eller RT-qPCR)I.1.2.   Échantillons destinés à l'analyse par amplification en chaîne par polymérase en présence de transcriptase inverse (RT-PCR ou RT-qPCR)
Samples shall be taken from the fish in accordance with the procedure described in point I.1.1 using a sterile instrument and transferred to a sterile plastic tube containing transport medium. Tissue from 10 fish may be collected in one tube and shall represent one pooled sample. However, in case the amount of inoculum is small, tissue from up to five fish may be used. Alternatively, samples may be pooled in RNA stabilization reagents, such as 0,2 g tissue/ml reagent according to the recommendation from the manufacturers, although each fish shall be processed individually and shall not be pooled in the samples because of the small amount of material to be used for extraction.Prøver udtages fra fisken i overensstemmelse med den procedure, der er beskrevet i punkt I.1.1, med et sterilt instrument og overføres til et sterilt plastrør indeholdende transportmedium. Væv fra 10 fisk kan samles i ét rør og udgøre en samleprøve. Hvis mængden af inokulum er lille, kan væv fra op til fem fisk dog anvendes. Alternativt kan prøver samles i RNA-stabiliseringsreagens, f.eks. 0,2 g væv/ml reagens i henhold til fabrikanternes anbefaling, idet hver fisk dog skal behandles særskilt og ikke må samles med andre fisk i prøverne på grund af den lille mængde materiale, der skal anvendes til ekstraktion.Les échantillons doivent être prélevés sur le poisson conformément à la procédure décrite au point I.1.1 à l'aide d'un instrument stérile, puis transférés dans des tubes en plastique stériles contenant le milieu de transport. Les tissus de 10 poissons peuvent être rassemblés dans un tube pour constituer un échantillon global. Toutefois, si la quantité d'inoculum est faible, on regroupera les tissus provenant de cinq poissons au maximum. Il est aussi possible de regrouper les échantillons dans des réactifs de stabilisation de l'ARN, à raison de 0,2 g de tissu/ml de réactif selon les recommandations des fabricants, mais chaque poisson devra être traité séparément et ne devra pas être regroupé avec d'autres dans les échantillons en raison de la faible quantité de matériel à utiliser pour l'extraction.
Whole fish may also be sent to the laboratory.Der kan også sendes hele fisk til laboratoriet.Des poissons entiers peuvent aussi être envoyés au laboratoire.
I.2.   Shipment of samples for fishI.2.   Forsendelse af fiskeprøverI.2.   Expédition des échantillons de poissons
Tubes containing fish tissues in transport medium for cell cultivation or RT-PCR/RT-qPCR analysis shall be placed in insulated containers, such as thick-walled polystyrene boxes, together with sufficient ice or an alternative cooling medium with the similar cooling effect to ensure chilling of the samples during transportation to the laboratory. However, freezing of the samples shall be avoided. The temperature of a sample during transit must never exceed 10 °C and ice must still be present in the transport box at receipt or one or more freeze blocks must still be partly or completely frozen.Rør med fiskevæv i transportmedium til celledyrkning eller RT-PCR/RT-qPCR-analyse skal placeres i isolerede beholdere, f.eks. tykvæggede polystyren-kasser, sammen med tilstrækkeligt med is eller et alternativt kølemiddel med tilsvarende køleeffekt, så det sikres, at prøverne opbevares køligt under transporten til laboratoriet. Dog bør nedfrysning af prøverne undgås. En prøves temperatur under forsendelsen bør aldrig overstige 10 °C, og der skal stadig være is tilbage i transportkassen, eller en eller flere af fryseblokkene skal fortsat være delvis eller helt frosset, ved kassens ankomst.Les tubes contenant les tissus des poissons dans le milieu de transport qui sont destinés à la culture cellulaire ou à l'analyse par RT-qPCR doivent être placés dans des conteneurs isolés, tels que des boîtes en polystyrène à parois épaisses, avec une quantité suffisante de glace ou d'un autre agent réfrigérant ayant le même effet afin de garantir la réfrigération des échantillons pendant le transport vers le laboratoire. Il y a toutefois lieu d'éviter la congélation des échantillons. La température d'un échantillon pendant son transport ne doit jamais dépasser 10 °C et le récipient de transport doit encore contenir de la glace lors de sa réception, ou un ou plusieurs blocs réfrigérants doivent encore être partiellement ou totalement congelés.
Whole fish may be sent to the laboratory if the temperature requirements referred to in the first paragraph during transportation can be fulfilled. Whole fish shall be wrapped up in paper with absorptive capacity and shall finally be shipped in a plastic bag. Live fish may also be shipped.Der kan sendes hele fisk til laboratoriet, hvis kravene til transporttemperaturen, jf. første afsnit, kan overholdes. Hele fisk skal indpakkes i absorberende papir og skal derefter forsendes i en plastpose. Der kan også forsendes levende fisk.Des poissons entiers peuvent être envoyés au laboratoire si les conditions de température pendant le transport visées au premier paragraphe peuvent être respectées. Le cas échéant, les poissons entiers, éventuellement enveloppés dans du papier absorbant, doivent être placés dans un sac en plastique pour l'expédition. Des poissons vivants peuvent également être expédiés.
I.3.   Collection of supplementary diagnostic materialI.3.   Indsamling af supplerende diagnostisk materialeI.3.   Collecte de matériel de diagnostic supplémentaire
When approved by the diagnostic laboratory, other fish tissues may be collected as well and prepared for supplementary examinations.Med det diagnostiske laboratoriums godkendelse kan også andet fiskevæv indsamles og præpareres til supplerende undersøgelser.Si le laboratoire de diagnostic y consent, d'autres tissus de poissons peuvent aussi être collectés et préparés en vue d'examens supplémentaires.
I.4.   Preparation of samples for cell culture examination and RT-qPCRI.4.   Præparation af prøver til cellekulturundersøgelse og RT-qPCRI.4.   Préparation des échantillons destinés à la culture cellulaire et à l'analyse par RT-qPCR
I.4.1.   Freezing in exceptional casesI.4.1.   Frysning i undtagelsestilfældeI.4.1.   Congélation dans des cas exceptionnels
Where practical difficulties arise, which make it impossible to process the samples within 48 hours after the collection of the fish tissues, it may be acceptable to freeze the tissue specimens in transport medium at – 20 °C or below and to carry out virological examination within 14 days. However, the fish tissue shall only be frozen and thawed once before examination. Records shall be kept with details on the reason for each freezing of fish tissue samples.Hvis der opstår praktiske vanskeligheder, som gør det umuligt at behandle prøverne senest 48 timer efter indsamlingen af fiskevævet, kan vævsprøverne nedfryses til – 20 °C eller lavere temperatur i et transportmedium, og den virologiske undersøgelse foretages inden for 14 dage. Fiskevævet må dog kun fryses og optøs én gang, inden det undersøges. Der skal føres et register med nærmere oplysninger om grunden til hver enkelt nedfrysning af vævsprøver.En cas de difficultés pratiques empêchant le traitement des échantillons dans les 48 heures suivant la collecte des tissus de poisson, il est possible de congeler les spécimens de tissus dans le milieu de transport à – 20 °C ou à une température inférieure et de procéder à l'examen virologique dans les 14 jours suivants. Toutefois, les tissus ne doivent être congelés et décongelés qu'une seule fois avant examen. Les motifs précis de chaque congélation d'échantillons de tissus de poisson doivent être consignés.
I.4.2.   Homogenisation of organsI.4.2.   Homogenisering af organerI.4.2.   Homogénéisation des organes
In the laboratory, the fish tissue in the tubes shall be completely homogenised, either by stomacher, blender or mortar and pestle with sterile sand, and subsequently suspended in the original transport medium.På laboratoriet skal fiskevævet i rørene homogeniseres fuldstændigt, enten med stomacher, blender eller morter og pistil med sterilt sand, og derefter opslæmmes i det oprindelige transportmedium.Au laboratoire, les tissus de poisson contenus dans les tubes doivent être complètement homogénéisés (à l'aide d'un malaxeur d'échantillons, d'un mélangeur ou d'un ensemble pilon-mortier avec sable stérile) et mis ensuite en suspension dans le milieu de transport d'origine.
If a sample consists of a whole fish less than 4 cm long, it shall be minced with sterile scissors or scalpel after removal of the body behind the gut opening. If a sample consists of a whole fish with body length between 4 cm and 6 cm, the viscera including kidney shall be collected. If a sample consists of a whole fish more than 6 cm long, the tissue specimens shall be collected as described in point I.1. The tissue specimens shall be minced with sterile scissors or scalpel and homogenised as described in the first paragraph of this point and suspended in transport medium.Hvis prøven består af en hel fisk på under 4 cm, findeles den ved hjælp af en steril saks eller skalpel efter fjernelse af kroppen bag gatåbningen. Hvis prøven består af en hel fisk på 4-6 cm, indsamles indvoldene, herunder nyre. Hvis prøven består af en hel fisk på over 6 cm, indsamles vævsprøverne som beskrevet i punkt I.1. Vævsprøverne findeles ved hjælp af en steril saks eller skalpel, homogeniseres som beskrevet i første afsnit og opslæmmes i transportmedium.Si un échantillon est constitué d'un poisson entier de longueur inférieure à 4 cm, celui-ci doit être réduit en petits fragments à l'aide de ciseaux stériles ou d'un scalpel, après élimination de la partie du corps située à l'arrière de l'anus. Si un échantillon est constitué d'un poisson entier de longueur comprise entre 4 et 6 cm, il y a lieu de prélever les viscères, y compris les reins. Si un échantillon est constitué d'un poisson entier de longueur supérieure à 6 cm, les spécimens de tissus doivent être prélevés comme décrit au point I.1. Les spécimens de tissus doivent être réduits en petits fragments à l'aide de ciseaux stériles ou d'un scalpel et homogénéisés comme décrit au premier paragraphe, puis mis en suspension dans le milieu de transport.
The final ratio between tissue material and transport medium shall be adjusted in the laboratory to 1:10.Det endelige forhold mellem vævsmateriale og transportmedium skal på laboratoriet justeres til 1:10.Le rapport final entre les tissus et le milieu de transport doit être ajusté à 1:10 au laboratoire.
I.4.3.   Centrifugation of homogenateI.4.3.   Centrifugering af homogenatetI.4.3.   Centrifugation de l'homogénat
The homogenate shall be centrifuged in a refrigerated centrifuge at 2 °C to 5 °C at 2 000 to 4 000 × g for 15 minutes and the supernatant collected and may be treated for either four hours at 15 °C or overnight at 4 to 8 °C with antibiotics. If the sample has been shipped in a transport medium, the treatment of the supernatant with antibiotics may be omitted.Homogenatet centrifugeres i en kølecentrifuge ved 2-5 °C og 2 000-4 000 × g i 15 minutter, hvorefter supernatanten opsamles og kan behandles enten i 4 timer ved 15 °C eller natten over ved 4-8 °C med antibiotika. Hvis prøven er blevet sendt i et transportmedium, kan behandling af supernatanten med antibiotika udelades.L'homogénat doit être centrifugé entre 2 000 et 4 000 g dans une centrifugeuse réfrigérée à une température comprise entre 2 et 5 °C pendant 15 minutes et le surnageant doit être recueilli; celui-ci peut ensuite être traité avec des antibiotiques, soit pendant 4 heures à 15 °C, soit pendant une nuit entre 4 et 8 °C. Si l'échantillon a été expédié dans un milieu de transport, le traitement du surnageant par des antibiotiques n'est pas nécessaire.
Where practical difficulties arise, such as incubator breakdown or problems with cell cultures, which make it impossible to inoculate cells within 48 hours after the collection of the fish tissue samples, the supernatant may be frozen at – 80 °C and virological examination may be carried out within 14 days.Hvis der opstår praktiske vanskeligheder, f.eks. at varmeskabet går i stykker, eller at der opstår problemer med cellekulturer, som gør det umuligt at pode celler senest 48 timer efter indsamlingen af fiskevævsprøverne, kan supernatanten fryses ved – 80 °C, og den virologiske undersøgelse foretages inden for 14 dage.En cas de difficultés pratiques, telles qu'une panne d'incubateur ou des problèmes de cultures cellulaires, empêchant l'inoculation des cellules dans les 48 heures qui suivent la collecte des échantillons de tissus, le surnageant peut être congelé à – 80 °C et l'examen virologique réalisé dans les quatorze jours.
If the collected supernatant is stored at – 80 °C within 48 hours after the sampling, it may be reused only once for virological examination.Hvis den opsamlede supernatant opbevares ved en temperatur på – 80 °C senest 48 timer efter prøveudtagningen, kan den, dog kun én gang, genanvendes til virologisk undersøgelse.Si le surnageant recueilli est conservé à – 80 °C au cours des 48 heures suivant l'échantillonnage, il ne peut être réutilisé qu'une seule fois pour l'examen virologique.
Prior to the inoculation of the cells, the supernatant shall be mixed with equal parts of a suitably diluted pool of antisera to the indigenous serotypes of Infectious pancreatic necrosis (IPN) virus and incubated with this for a minimum of one hour at 15 °C or a maximum of 18 hours at 4 °C. The titre of the antiserum shall be at least 1/2 000 in a 50 % plaque neutralisation test.Inden supernatanten podes på cellerne, blandes den med en tilsvarende mængde passende fortyndet pool af antisera mod de indigene serotyper af infektiøs pankreasnekrose-virus (IPN-virus) og inkuberes hermed i mindst 1 time ved 15 °C eller i højst 18 timer ved 4 °C. Antiserumtiteren skal være mindst 1/2 000 i en 50 % pladeneutraliseringsprøve.Avant d'inoculer les cellules, le surnageant doit être mélangé à parts égales avec un lot de sérums anti-sérotypes indigènes du virus de la nécrose pancréatique infectieuse (NPI), dilués de façon appropriée, et doit être incubé ainsi pendant au minimum une heure à 15 °C ou pendant au maximum 18 heures à 4 °C. Le titre de l'antisérum doit être d'au moins 1/2 000 dans un test de neutralisation sur plaque à 50 %.
Treatment of all inocula with antiserum to IPN virus aims at preventing cytopathic effect (CPE) due to IPN virus from developing in inoculated cell cultures. This will reduce the duration of the virological examinations as well as the number of cases in which occurrence of CPE would have to be considered potentially indicative of VHSV or IHNV.Formålet med at behandle alle inokula med antiserum mod IPN-virus er at hindre, at der udvikles cytopatisk effekt (CPE) som følge af IPN-virus i podede cellekulturer. Det vil nedsætte de virologiske undersøgelsers varighed og antallet af tilfælde, hvor forekomst af CPE ellers måtte opfattes som en potentiel indikation af VHSV eller IHNV.Le traitement de tous les inoculums par le sérum anti-virus de la NPI vise à empêcher l'effet cytopathogène (ECP) dû au virus de la NPI de se manifester dans les cultures cellulaires inoculées. Cela permet de réduire la durée des examens virologiques ainsi que le nombre de cas où l'apparition d'un ECP devrait être considérée comme une manifestation possible du virus de la SHV ou de la NHI.
When samples come from production units, which are considered free from IPN, the treatment of inocula with antiserum to IPN virus may be omitted.Når prøverne kommer fra produktionsenheder, der anses for at være frie for IPN, kan behandling af inokula med antiserum mod IPN-virus undlades.Lorsque les échantillons proviennent d'unités de production considérées comme indemnes de la NPI, le traitement des inoculums par le sérum antivirus de la NPI peut être omis.
I.4.4.   Sample preparation for RT-PCR and RT-qPCR based surveillance programmesI.4.4.   Præparation af prøver til overvågningsprogrammer på basis af RT-PCR og RT-qPCRI.4.4.   Préparation des échantillons pour les programmes de surveillance faisant appel à la RT-PCR et à la RT-qPCR
If samples were collected in transport medium, the procedure set out in points I.4.2 and I.4.3 shall be carried out. After centrifugation, supernatant shall be collected and RNA extracted. If further examination is not to be undertaken directly after centrifugation, the samples shall be immediately frozen at – 20 °C or below.Hvis prøverne blev opsamlet i et transportmedium, gennemføres proceduren i punkt I.4.2 og I.4.3. Efter centrifugering opsamles supernatanten, og RNA ekstraheres. Hvis der ikke skal foretages yderligere undersøgelser direkte efter centrifugering, fryses prøverne straks ved – 20 °C eller derunder.Si les échantillons ont été placés dans le milieu de transport, la procédure décrite aux points I.4.2 et I.4.3 doit être suivie. Après centrifugation, le surnageant doit être recueilli et l'ARN extrait. Si aucun autre examen ne doit être réalisé directement après la centrifugation, les échantillons doivent être immédiatement congelés à – 20 °C ou à une température inférieure.
For the analysis of fish tissues preserved in RNA stabilization reagent, subsequent work shall be carried out within the following time scales for samples stored at different temperatures:Til analyse af fiskevævsprøver, der er konserveret i RNA-stabiliseringsreagens, skal det efterfølgende arbejde foretages inden for følgende tidsfrister for prøver opbevaret ved forskellige temperaturer:Pour l'analyse des tissus de poisson conservés dans du réactif de stabilisation de l'ARN, d'autres opérations doivent être réalisées dans les délais précisés ci-après sur les échantillons stockés à différentes températures:
  | samples stored at 37 °C: 1 day;  | prøver opbevaret ved 37 °C: en dag  | échantillons stockés à 37 °C: dans un délai d'un jour;
  | samples stored at 25 °C: 1 week;  | prøver opbevaret ved 25 °C: en uge  | échantillons stockés à 25 °C: dans un délai d'une semaine
  | samples stored at 4 °C: 1 month;  | prøver opbevaret ved 4 °C: en måned  | échantillons stockés à 4 °C: dans un délai d'un mois;
  | samples stored at – 20 °C: indefinitely  | prøver opbevaret ved – 20 °C: tidsubegrænset.  | échantillons stockés à – 20 °C: délai indéterminé.
Pooled samples in RNA stabilization reagent shall be treated like single samples in RNA stabilization reagent. For samples pooled in RNA stabilization reagent, the sample amount shall not exceed that recommended by the manufacturer for extraction with RNA kits, such as RNeasy Mini kits (Qiagen) or similar. If larger samples are pooled, the extraction kits or methods must reflect this pooling.Samleprøver i RNA-stabiliseringsreagens behandles som enkeltprøver i RNA-stabiliseringsreagens. For prøver, der samles i RNA-stabiliseringsreagens, må prøvemængden ikke overstige den af fabrikanten anbefalede for ekstraktion med RNA-kit som f.eks. RNeasy Mini kit (Qiagen) eller tilsvarende. Hvis større prøver samles, skal ekstraktionskittene eller -metoderne afspejle denne samling.Les échantillons globaux conservés dans le réactif de stabilisation de l'ARN doivent être traités de la même manière que les échantillons simples dans du réactif de stabilisation de l'ARN. Dans le cas d'échantillons globaux dans du réactif de stabilisation de l'ARN, le volume de l'échantillon ne doit dépasser le volume recommandé par le fabricant pour l'extraction de l'ARN à l'aide de kits tels que RNeasy Minikit (Qiagen) ou similaires. En cas de regroupement d'échantillons plus grands, les kits ou les méthodes d'extraction doivent être adaptés en conséquence.
Samples collected in RNA stabilization reagents shall not be used for cell cultivation.Prøver, der opsamles i RNA-stabiliseringsreagens, må ikke anvendes til celledyrkning.Les échantillons recueillis dans des réactifs de stabilisation de l'ARN ne doivent pas être utilisés pour les cultures cellulaires.
I.4.5.   Pooling of samples for RT-qPCRI.4.5.   Samling af prøver til RT-qPCRI.4.5.   Regroupement d'échantillons pour la RT-qPCR
As the RT-qPCR protocols given are of similar or higher sensitivity than the cell cultivation methods, it may be acceptable to use supernatant from homogenised fish tissue material of pooled organs from up to 10 fish in cell culture medium for PCR. However, due to the much smaller inoculum used for PCR compared to cell cultivation, all fish tissues shall be carefully homogenised before collating material for extraction.Da de givne RT-qPCR-protokoller har en sensitivitet, der svarer til eller er højere end celledyrkningsmetodernes, kan der til PCR anvendes supernatant fra homogeniseret fiskevævsmateriale af organer fra op til ti fisk samlet i cellekulturmedium. Eftersom der anvendes en meget mindre mængde inokulum til PCR end til celledyrkning, skal alt fiskevæv dog homogeniseres omhyggeligt, inden materialet samles til ekstraktion.Étant donné que les protocoles de RT-qPCR sont d'une sensibilité identique ou supérieure à celle des méthodes de culture cellulaire, il est dans certains cas acceptable d'utiliser pour la PCR le surnageant des tissus homogénéisés d'organes prélevés sur 10 poissons au maximum et regroupés dans le milieu de culture cellulaire. Toutefois, en raison de la quantité nettement réduite d'inoculum utilisée pour la PCR par rapport à la culture cellulaire, tous les tissus de poissons doivent être soigneusement homogénéisés avant le regroupement du matériel pour l'extraction.
The same principle shall also be applied if samples are collected in RNA stabilization reagents. However, in that case it is often difficult to collect representative material from up to 10 fish in one tube, and the number of fish per pool shall therefore be reduced to 2 to 5.Samme princip gælder, hvis prøverne indsamles i RNA-stabiliseringsreagens. I dette tilfælde er det imidlertid vanskeligt at samle repræsentativt materiale fra op til ti fisk i ét rør, og antallet af fisk pr. samleprøve skal derfor indskrænkes til 2-5.Le même principe s'applique lorsque les échantillons sont recueillis dans des réactifs de stabilisation de l'ARN. Toutefois, dans ce cas, il est souvent difficile de regrouper dans un même tube du matériel pouvant provenir de 10 poissons, et il faut donc réduire le nombre de poissons par échantillon global et le ramener à un chiffre compris entre 2 et 5.
I.5.   Virological examination on cell cultureI.5.   Virologisk undersøgelse i cellekulturI.5.   Examen virologique sur culture cellulaire
I.5.1.   Cell cultures and mediaI.5.1.   Cellekulturer og medierI.5.1.   Cultures cellulaires et milieux
Bluegill fry cell line -2 (BF-2) or Rainbow trout gonad cell line - 2 (RTG-2) and either Epithelioma papulosum cyprini (EPC) or Fathead minnow (FHM) cells shall be grown at 20 to 30 °C in suitable medium, namely Eagle's Minimum essential medium (MEM) or modifications thereof, with a supplement of 10 % foetal bovine serum and antibiotics in standard concentrations.Celler af enten cellelinjen Bluegill fry – 2 (BF-2) eller cellelinjen Rainbow trout gonad – 2 (RTG-2) og enten cellelinjen Epithelioma papulosum cyprini (EPC) eller Fathead minnow (FHM) skal dyrkes ved 20-30 °C i et egnet medium, dvs. Eagle's Minimum essential medium (MEM) eller modifikationer heraf, tilsat 10 % føtalt kvægserum og antibiotika i standardkoncentrationer.Des cellules de la lignée cellulaire 2 d'alevins de crapet arlequin (Bluegill fry) (BF-2) ou de la lignée cellulaire 2 de gonades de truite arc-en-ciel (Rainbow trout gonad) (RTG-2) et des cellules de Epithelioma papulosum cyprini (EPC) ou de poisson tête de boule (Fathead minnow) (FHM) sont cultivées à une température comprise entre 20 et 30 °C dans un milieu approprié, en l'occurrence le milieu essentiel minimal de Eagle (MEM) ou une variante de celui-ci, additionné de sérum fœtal bovin à 10 % et d'antibiotiques à une concentration standard.
When the cells are cultivated in closed vials, the medium shall be buffered with bicarbonate. The medium used for cultivation of cells in open units may be buffered with tris(hydroxymethyl)aminomethane-HCl (Tris-HCl) (23 mM) and sodium bicarbonate (6 mM). The pH must be 7,6 ± 0,2.Når cellerne dyrkes i lukkede glas, benyttes bicarbonat som buffer til mediet. Til det medie, der anvendes til dyrkning af celler i åbne enheder, kan tris(hydroxymethyl)aminomethan-HCl (Tris-HCl) (23 mM) og natriumbicarbonat (6 mM) benyttes som buffer. pH-værdien skal ligge på 7,6 ± 0,2.Lorsque les cellules sont cultivées dans des flacons fermés, le milieu doit être tamponné à l'aide de bicarbonate. Le milieu utilisé pour la culture cellulaire en unités ouvertes peut être tamponné à l'aide de tris(hydroxyméthyl)aminométhane-HCl (Tris-HCl) (23 mM) et de bicarbonate de sodium (6 mM). Le pH doit être égal à 7,6 ± 0,2.
The cell cultures to be used for inoculation with fish tissue material shall be young, normally 1 day old cell culture monolayers where possible; however, a range between 4 to 48 hours old may be accepted. The cells must be actively growing at inoculation.De cellekulturer, der skal anvendes til podning med fiskevævsmateriale, skal være unge, normalt en dag gamle cellekulturer i monolag, hvis det er muligt; cellekulturer, som er 4-48 timer gamle, kan dog accepteres. Cellerne skal være aktivt voksende ved podningen.Pour l'inoculation des cultures par du matériel tissulaire de poisson, il convient d'utiliser des cultures cellulaires jeunes, âgées normalement d'un jour et monocouches si possible; néanmoins, les cultures d'âge compris entre 4 et 48 heures sont acceptables. Les cellules doivent être en phase de croissance active au moment de l'inoculation.
I.5.2.   Inoculation of cell culturesI.5.2.   Podning af cellekulturerI.5.2.   Inoculation des cultures cellulaires
Antibiotic-treated organ suspension shall be inoculated into cell cultures in two dilutions, namely the primary dilution and, in addition, a 1:10 dilution thereof, resulting in final dilutions of tissue material in cell culture medium of 1:100 and 1:1 000, respectively, in order to prevent homologous interference. At least two cell lines shall be inoculated as referred to in point I.5.1. The ratio between inoculum size and volume of cell culture medium shall be about 1:10.En antibiotikabehandlet organopslæmning podes på cellekulturer i to fortyndinger, dvs. primærfortyndingen og derudover en fortynding på 1:10 heraf, så der fremkommer slutfortyndinger af vævsmateriale i cellekulturmediet på henholdsvis 1:100 og 1:1 000, idet formålet er at hindre homolog interferens. Mindst to cellelinjer skal podes i overensstemmelse med punkt I.5.1. Mængdeforholdet mellem inokulum og cellekulturmedium skal være ca. 1:10.Une suspension d'organes traitée aux antibiotiques doit être inoculée aux cultures cellulaires en deux dilutions distinctes, à savoir la dilution initiale et, en outre, une dilution au 1:10 de celle-ci (soit des dilutions finales respectives des tissus dans le milieu de culture de 1:100 et 1:1 000), de manière à éviter les interférences homologues. Deux lignées cellulaires au moins doivent être inoculées comme indiqué au point I.5.1. Le rapport entre la quantité d'inoculum et le volume du milieu de culture cellulaire doit être de 1:10 environ.
For each dilution and each cell line, a minimum of about 2 cm2 cell area, corresponding to one well in a 24-well cell culture tray, shall be utilised. Cell culture trays shall be used where possible.For hver fortynding og hver cellelinje anvendes et celleområde på mindst ca. 2 cm2 svarende til én brønd på en cellekulturplade med 24 brønde. Der anvendes cellekulturplader, hvis det er muligt.Pour chaque dilution et chaque lignée cellulaire, il y a lieu d'utiliser une surface de culture minimale d'environ 2 cm2, ce qui correspond à un puits sur une plaque de culture cellulaire à 24 puits. Des plaques de culture cellulaire doivent être utilisées dans la mesure du possible.
I.5.3.   Incubation of cell culturesI.5.3.   Inkubation af cellekulturerI.5.3.   Incubation des cultures cellulaires
The inoculated cell cultures shall be incubated at 15 °C for seven to 10 days. If the colour of the cell culture medium changes from red to yellow indicating medium acidification, pH adjustment with sterile bicarbonate solution or equivalent substances shall be performed to ensure cell susceptibility to virus infection.De podede cellekulturer inkuberes ved 15 °C i 7-10 dage. Hvis cellekulturmediet ændrer farve fra rød til gul, som er tegn på forsuring af mediet, skal pH-værdien justeres med steril bicarbonatopløsning eller tilsvarende stoffer for at sikre, at cellematerialet er modtageligt for virusinfektion.Les cultures cellulaires inoculées doivent être incubées à 15 °C pendant sept à dix jours. Si la couleur du milieu de culture vire du rouge au jaune, indiquant une acidification du milieu, il y a lieu d'ajuster le pH à l'aide d'une solution stérile de bicarbonate ou à l'aide de substances équivalentes pour garantir la sensibilité des cellules à l'infection virale.
At least every 6 months or if decreased cell susceptibility is suspected, titration of frozen stocks of VHSV and IHNV shall be performed to verify the susceptibility of the cell cultures to infection. The procedure set out in Section III shall be used, if possible.Der foretages mindst hver sjette måned, eller når der er mistanke om, at cellerne er mindre modtagelige, titrering af frosne lagre af VHSV og IHNV for at fastslå, om cellekulturerne er modtagelige for infektion. Proceduren i afsnit III anvendes, hvis det er muligt.Tous les six mois au moins, ou lorsqu'on suspecte une diminution de la sensibilité cellulaire, il y a lieu de procéder au titrage des préparations mères congelées de VSHV et VNHI, afin de vérifier la sensibilité des cultures cellulaires à l'infection. La procédure décrite à la section III doit être appliquée, si possible.
I.5.4.   MicroscopyI.5.4.   MikroskopiI.5.4.   Microscopie
Inoculated cell cultures shall be inspected regularly, at least three times a week, for the occurrence of CPE at 40 to 150 × magnification. If obvious CPE is observed, virus identification procedures in accordance with point I.6 shall be initiated immediately.Podede cellekulturer skal undersøges jævnligt (mindst tre gange om ugen) for forekomst af CPE ved ca. 40-150 × forstørrelse. Hvis der konstateres tydelig CPE, skal der omgående anvendes procedurer for virusidentifikation i overensstemmelse med punkt I.6.Les cultures cellulaires inoculées doivent être examinées régulièrement (au moins trois fois par semaine) au microscope à un grossissement compris entre × 40 et × 150 pour rechercher un ECP. Si un ECP net est observé, les procédures d'identification du virus décrites au point I.6 doivent être mises en œuvre immédiatement.
I.5.5.   SubcultivationI.5.5.   SubkultiveringI.5.5.   Repiquage
If no CPE has developed after the primary incubation for 7 to 10 days, subcultivation shall be performed to fresh cell cultures utilising a cell area similar to that of the primary culture.Er der ingen udvikling af CPE efter primærinkubationen i 7-10 dage, gennemføres der subkultivering med friske cellekulturer på et celleareal af samme størrelse som primærkulturens.Si aucun ECP ne s'est manifesté après une première incubation de sept à dix jours, il convient de procéder à un repiquage sur des cultures cellulaires fraîches en utilisant une surface de culture identique à celle de la culture primaire.
Aliquots of medium (supernatant) from all cultures or wells constituting the primary culture shall be pooled according to cell line 7 to 10 days after inoculation. The pools shall then be inoculated into homologous cell cultures undiluted and diluted 1:10 (resulting in final dilutions of 1:10 and 1:100, respectively, of the supernatant) as described in point I.5.2. Alternatively, aliquots of 10 % of the medium constituting the primary culture shall be inoculated directly into a well with fresh cell culture (namely, well to well subcultivation). The inoculation may be preceded by pre-incubation of the dilutions with the antiserum to IPN virus at appropriate dilution as described in point I.4.3.Aliquoter af medium (supernatant) fra alle kulturer eller brønde, som udgør primærkulturen, samles pr. cellelinje 7-10 dage efter podning, og podes derefter på homologe cellekulturer, der er ufortyndet og fortyndet 1:10 (som giver slutfortyndinger af supernatanten på henholdsvis 1:10 og 1:100), som beskrevet i punkt I.5.2. Alternativt podes aliquoter på 10 % af det medium, som udgør primærkulturen, direkte i en brønd med frisk cellekultur (brønd-til-brønd-subkultivering). Inden podningen kan der foretages inkubation af fortyndingerne med antiserum mod IPN-virus i en passende fortynding som beskrevet i punkt I.4.3.Des parties aliquotes du milieu (surnageant) de toutes les cultures ou de tous les puits constituant la culture primaire sont regroupées en pools par lignée cellulaire sept à dix jours après l'inoculation. Les pools non dilués et dilués au 1:10 (ce qui donne respectivement des dilutions finales du surnageant au 1:10 et au 1:100) sont ensuite inoculés chacun à des cultures cellulaires homologues, comme décrit au point I.5.2. Une autre possibilité consiste à inoculer directement des parties aliquotes de 10 % du milieu constituant la culture primaire dans un puits contenant une culture cellulaire fraîche (repiquage de puits à puits). L'inoculation peut être précédée d'une préincubation des dilutions avec le sérum antivirus de la NPI à la dilution appropriée, comme décrit au point I.4.3.
The inoculated cultures shall then be incubated for 7 to 10 days at 15 °C and inspected in accordance with point I.5.4.De podede kulturer inkuberes derefter i 7-10 dage ved 15 °C og undersøges i overensstemmelse med punkt I.5.4.Les cultures inoculées doivent ensuite être incubées à 15 °C pendant sept à dix jours, puis examinées comme indiqué au point I.5.4.
If toxic CPE occurs within the first 3 days of incubation, subcultivation shall be performed at that stage, but the cells shall then be incubated for 7 days and sub cultivated again with further 7 days incubation. When toxic CPE develops after 3 days, the cells shall be passed once and incubated to achieve the total of 14 days from the primary inoculation. There must be no evidence of toxicity in the final 7 days of incubation.Hvis der forekommer toksisk CPE i løbet af de første tre inkubationsdage, foretages subkultivering på det stadium, men cellerne skal i så fald inkuberes i syv dage og subkultiveres igen med yderligere syv dages inkubation. Hvis der udvikler sig toksisk CPE efter tre dage, subkultiveres cellerne én gang og inkuberes, således at man kommer op på de i alt 14 dage fra primærpodningen. Der må ikke være noget tegn på toksicitet i de sidste syv inkubationsdage.Si un ECP toxique se manifeste au cours des trois premiers jours d'incubation, un repiquage doit être effectué à ce stade, mais les cellules doivent alors être incubées pendant sept jours puis repiquées à nouveau et soumises à une nouvelle période d'incubation de sept jours. Lorsqu'un ECP toxique se manifeste après trois jours, les cellules doivent être repiquées une fois puis incubées jusqu'à ce que se soient écoulés au total quatorze jours à partir de l'inoculation primaire. Aucun signe de toxicité ne doit se manifester au cours des sept derniers jours d'incubation.
If bacterial contamination occurs despite treatment with antibiotics, subcultivation shall be preceded by centrifugation at 2 000 to 4 000 × g for 15 to 30 minutes at 2 to 5 °C, or filtration of the supernatant through a 0,45 μm filter or both (low protein-binding membrane). In addition to this, subcultivation shall follow the same procedures as described for toxic CPE in the fourth paragraph of this point.Hvis der trods antibiotikabehandling optræder bakteriekontamination, skal supernatanten inden subkultivering centrifugeres ved 2 000-4 000 × g i 15-30 minutter ved 2-5 °C og/eller filtreres gennem et 0,45 μm filter (svagt proteinbindende membranfilter). Derudover er procedurerne for subkultivering de samme som dem, der er beskrevet for toksisk CPE i fjerde afsnit.Si une contamination bactérienne se produit malgré le traitement antibiotique, le repiquage doit être précédé d'une centrifugation à 2 000-4 000 g pendant 15 à 30 minutes à une température comprise entre 2 et 5 °C, ou d'une filtration du surnageant à travers un filtre de 0,45 μm, ou bien des deux à la fois (membrane à faible capacité de liaison des protéines). En outre, le repiquage doit être réalisé suivant les mêmes procédures que celles décrites pour l'apparition d'un ECP toxique au quatrième alinéa du présent point.
If no CPE occurs, the test may be declared negative.Hvis der ikke forekommer CPE, kan testen erklæres for negativ.Si aucun ECP ne se manifeste, le test est réputé négatif.
I.6.   Virus identificationI.6.   VirusidentifikationI.6.   Identification du virus
If evidence of CPE has been observed in a cell culture, medium (supernatant) shall be collected and examined by one or more of the following techniques: Enzyme-linked immunosorbent essay (ELISA), Immunofluorescence (IF), neutralisation, RT-PCR or RT-qPCR. If these tests have not allowed definitive identification of the virus within 1 week, the supernatant shall be forwarded to the national reference laboratory or to the EU reference laboratory for fish diseases referred to in Annex VI to Directive 2006/88/EC for immediate identification.Hvis der er observeret tegn på CPE i en cellekultur, indsamles mediet (supernatanten) og undersøges efter én eller flere af følgende metoder: enzymbundet immunosorbent assay (ELISA), immunfluorescens (IF), neutralisationstest, RT-PCR eller RT-qPCR. Hvis sådanne test ikke i løbet af en uge har ført til en definitiv identifikation af virusset, skal supernatanten sendes til det nationale referencelaboratorium eller til EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF, med henblik på øjeblikkelig identifikation.Si un ECP a été observé dans une culture cellulaire, le milieu (surnageant) doit être recueilli et examiné par une ou plusieurs des techniques suivantes: méthode immunoenzymatique (ELISA), test d'immunofluorescence (IF), neutralisation, RT-PCR ou RT-qPCR. Si ces méthodes n'ont pas permis d'identifier le virus de façon certaine dans un délai d'une semaine, le surnageant doit être envoyé au laboratoire de référence national ou au laboratoire de référence de l'Union pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE en vue d'une identification immédiate.
I.6.1.   ELISAI.6.1.   ELISAI.6.1.   ELISA
A double antibody sandwich ELISA shall be performed in order to identify the virus isolate. Microwell plates shall be coated with 50 μl/well (0,9 pg) of proven quality protein-A purified immunoglobulins(Ig) from rabbit antisera against IHNV or VSHV diluted in carbonate buffer (pH 9,6) containing 15 mM sodium azide and incubated from 18 hours to 2 weeks at 4 °C.Der foretages en dobbelt-antistof-sandwich-ELISA for at identificere virusisolatet. Mikrotiterplader dækkes med 50 μl/brønd (0,9 pg) protein-A-rensede immunglobuliner (Ig) af dokumenteret kvalitet fra kaninantiserum mod IHNV eller VSHV opløst i carbonatbuffer (pH 9,6) indeholdende 15 mM natriumazid og inkuberes i 18 timer til 2 uger ved 4 °C.Un test ELISA en double sandwich doit être réalisé pour identifier l'isolat de virus. Les plaques de micropuits sont enduites à raison de 50 μl/puits (0,9 pg) d'une solution d'immunoglobulines (Ig) de sérums anti-NHI ou anti-SHV de lapin purifiées à la protéine A, de qualité reconnue, diluées dans un tampon de carbonate (pH 9,6) contenant 15 mM d'azoture de sodium, puis incubées à 4 °C pour une durée comprise entre 18 heures et 2 semaines.
On a dilution plate, each sample containing 1 % Triton X-100 and the positive controls shall be diluted with buffer solution (namely, phosphate buffered saline (PBS)-T-BSA, 1 % BSA) in a 4-fold dilution: undiluted, 1:4, 1:16, 1:64. The ELISA plates shall be washed in PBS containing 0,05 % Tween-20 (PBS-T) and 50 μl of each dilution shall be transferred from the dilution plate to the washed and coated ELISA-plate.På en fortyndingsplade skal hver prøve, der indeholder 1 % Triton X-100, og de positive kontroller fortyndes med en bufferopløsning (dvs. phosphat-bufferet saltopløsning (PBS)-T-BSA, 1 % BSA) i en 4-fold-fortynding: ufortyndet, 1:4, 1:16, 1:64. ELISA-pladerne vaskes med PBS indeholdende 0,05 % Tween-20 (PBS-T), og 50 μl af hver fortynding overføres fra fortyndingspladen til den vaskede og belagte ELISA-plade.Sur une plaque de dilution, chaque échantillon contenant 1 % de Triton X-100 et les témoins positifs doit être dilué à l'aide de la solution tampon [à savoir une solution saline tamponnée au phosphate (PBS)-T-BSA, 1 % BSA] dans un rapport de dilution de 4 (1:4, 1:16, 1:64). Les plaques ELISA doivent être lavées dans du PBS contenant 0,05 % de Tween 20 (PBS-T) et 50 μl de chaque dilution doivent être transférés de la plaque de dilution vers la plaque ELISA lavée et enduite.
ELISA plates shall then be incubated for 30 minutes at 37 °C. Subsequently plates shall be washed and incubated for 30 minutes at 37 °C with specific monoclonal antibodies (namely for VHSV identification MAb IP5B11 and for IHNV Hyb 136-3, respectively). 50 μl of horseradish-peroxidase (HRP) conjugated rabbit anti mouse antibodies diluted 1:1 000 in PBS-T-BSA shall be transferred to the ELISA plate.Derefter inkuberes ELISA-pladerne i 30 minutter ved 37 °C. Efterfølgende vaskes pladerne og inkuberes i 30 minutter ved 37 °C med specifikke monoklonale antistoffer (dvs. henholdsvis MAb IP5B11 til VHSV-identifikation og Hyb 136-3 til IHNV). Kanin-anti-mus-antistoffer fortyndet 1:1 000 i PBS-T-BSA konjugeret med 50μl peberrodsperoxidase (HRP) overføres til ELISA-pladen.Les plaques ELISA doivent ensuite être incubées pendant 30 minutes à 37 °C, avant d'être lavées et incubées 30 minutes à 37 °C en présence d'anticorps monoclonaux (AcM) spécifiques (à savoir IP5B11 pour l'identification du virus de la SHV et HYB-136-3 pour celle du virus de la NHI). 50 μl d'anticorps anti-souris de lapin conjugués à de la peroxydase de raifort (HRP) dilués au 1:1 000 dans du PBS-T-BSA doivent être transférés sur la plaque ELISA.
Finally, after renewed washing the reactions shall be developed adding 50 μl/well of ortho-phenylenediamine (OPD). The ELISA plates shall be incubated for 20 minutes at room temperature in the dark and the reaction shall be stopped by adding 100 μl/well 0,5 M H2SO4.Endelig startes reaktionerne, efter endnu en vaskning, ved at tilsætte 50 μl/brønd orthophenylendiamin (OPD). ELISA-pladerne inkuberes mørkt i 20 minutter ved rumtemperatur, og reaktionen stoppes ved at tilsætte 100 μl/brønd 0,5 M H2SO4.Enfin, après nouveau lavage, les réactions sont déclenchées par addition de 50 μl d'orthophénylènediamine (OPD) dans chaque puits. Les plaques ELISA doivent être incubées pendant 20 minutes à température ambiante dans l'obscurité, et la réaction doit être arrêtée par addition de 100 μl de H2SO4 0,5 M par puits.
The absorbance shall be monitored at a wavelength of 492 and 620 nm in an ELISA reader. Samples shall be designated positive or negative after comparing the test results to the absorbance values for the positive and negative controls. In general, samples with combined absorbance (A) < 0,5 for undiluted material shall be considered negative, samples with A values between 0,5 and 1,0 shall be considered suspicious and samples with A values > 1,0 shall be considered positive.Absorbansen måles ved en bølgelængde på 492 og 620 nm i en ELISA-læser. Prøverne betegnes som positive eller negative, efter at testresultaterne er blevet sammenlignet med absorbansværdierne for de positive og negative kontroller. Generelt anses prøver med kombineret absorbans (A) < 0,5 for ufortyndet materiale for negative, prøver med A-værdier mellem 0,5 og 1,0 anses for mistænkelige, og prøver med A-værdier > 1,0 anses for positive.L'absorbance doit être contrôlée à la longueur d'onde de 492 puis de 620 nm dans un lecteur ELISA. Les échantillons sont déclarés positifs ou négatifs après comparaison des résultats aux valeurs d'absorbance des témoins positifs et négatifs. En règle générale, les échantillons présentant une absorbance totale (A) < 0,5 pour du matériel non dilué sont considérés comme étant négatifs; les échantillons dont les valeurs A sont comprises entre 0,5 et 1,0 sont considérés comme suspects et les échantillons avec valeurs A > 1,0 sont considérés comme positifs.
Other ELISA versions with a proven similar efficacy may be used instead of those referred to in this point.Der kan anvendes andre ELISA-versioner med dokumenteret tilsvarende effektivitet i stedet for dem, der er omhandlet i dette punkt.D'autres versions de la technique ELISA d'une efficacité similaire avérée peuvent être utilisées en lieu et place de celles mentionnées au présent point.
I.6.2.   Immunofluorescence- IFI.6.2.   Immunfluorescens (IF)I.6.2.   Immunofluorescence (IF)
The identification of listed pathogens VHSV and IHNV shall be performed by infecting cells in ‘Black’ 96-well plates, conventional 24-well plates or cover slips into 24-well plates. When IHNV or VHSV or both are identified by infecting cells on cover slips, the following protocol shall apply:De listeopførte patogener VHSV og IHNV identificeres ved at inficere celler i 96-brønds »Black«-plader, konventionelle 24-brøndsplader eller på dækglas i 24-brøndsplader. Når IHNV eller VHSV eller begge er identificeret ved at inficere celler på dækglas, anvendes følgende protokol:L'identification des agents pathogènes répertoriés que sont les virus de la SHV et de la NHI doit être réalisée en infectant des cellules dans des plaques 96 puits «Black» ou des plaques 24 puits classiques, ou sur lamelles dans des plaques 24 puits. Si l'identification du virus de la NHI ou de la SHV, ou des deux, s'effectue par infection de cellules sur des lamelles, le protocole suivant doit être appliqué:
(a) | cover slips shall be seeded with cells at a density leading to between 60 % and 90 % confluence after 24 hours of cultivation. EPC cells shall be used where possible for this purpose because of their strong adherence to glass surfaces, but other cell lines such as BF-2, RTG-2 or FHM may be used as well. 150 μl cell culture supernatant in two different dilutions (1:10 and 1:1 000) shall be inoculated in duplicate onto 1-day-old monolayers and incubated at 15 °C for 24 hours;a) | På dækglassene udstryges der celler med en tæthed, der giver 60-90 % sammenflydning efter 24 timers dyrkning. Om muligt anvendes EPC-celler, fordi de klæber stærkt til glasoverflader, men der kan også anvendes andre cellelinjer såsom BF-2, RTG-2 eller FHM. 150 μl cellekultursupernatant i to forskellige fortyndinger (1:10 og 1:1 000) podes i duplikat på en dag gamle monolag og inkuberes ved 15 °C i 24 timer.a) | les lamelles doivent être ensemencées lorsque les cellules sont entre 60 et 90 % de confluence après 24 heures de culture. On utilisera de préférence des cellules EPC en raison de leur forte adhérence aux surfaces de verre, mais d'autres lignées cellulaires, telles que BF-2, RTG-2 ou FHM, peuvent également être utilisées. On inoculera 150 μl de surnageant de culture cellulaire à deux dilutions différentes (1:10 et 1:1 000) en deux exemplaires à des cultures monocouches âgées d'un jour qui sont ensuite incubées à 15 °C pendant 24 heures;
(b) | subsequently, cell culture medium shall be removed, and the infected cell monolayers fixed with 0,5 ml ice-cold, aqueous acetone solution (80 % vol:vol). Fixation shall take place in fume hood for 15 minutes at room temperature, then the acetone solution shall be removed and the cover glasses shall be air dried for at least 30 minutes. At this stage, the plates shall either be processed immediately or stored at – 20 °C for further use;b) | Derefter fjernes cellekulturmediet, og de inficerede cellemonolag fikseres med 0,5 ml iskold, vandig acetoneopløsning (80 % v/v). Fikseringen foretages i et stinkskab i 15 minutter ved rumtemperatur, derefter fjernes acetoneopløsningen, og dækglassene lufttørres i mindst 30 minutter. På dette trin skal pladerne enten behandles med det samme eller opbevares ved – 20 °C med henblik på videre anvendelse.b) | le milieu de culture cellulaire est ensuite éliminé, et les monocouches de cellules infectées sont fixées avec 0,5 ml d'une solution aqueuse d'acétone glacée (80 % v/v). La fixation doit avoir lieu sous hotte pendant 15 minutes à la température ambiante, puis la solution d'acétone doit être éliminée et les lamelles séchées à l'air pendant au moins 30 minutes. À ce stade, les plaques doivent être traitées immédiatement ou bien stockées à une température de – 20 °C en vue d'une utilisation ultérieure;
(c) | specific monoclonal antibodies (namely for VHSV identification, MAb IP5B11 and for IHNV, Hyb 136-3 respectively) shall be diluted in 0,01 M PBST, pH 7,2 in the dilution recommended by the provider of the MAbs; 50 to 100 μl/well shall be added to the fixed monolayer and plates shall be incubated for one hour at 37 °C in a humid chamber;c) | Specifikke monoklonale antistoffer (dvs. henholdsvis MAb IP5B11 til VHSV-identifikation og Hyb 136-3 til IHNV) opløses i 0,01 M PBST med en pH-værdi på 7,2 i den af leverandøren af MAb anbefalede fortynding; 50-100 μl/brønd tilsættes til det fikserede monolag, og pladerne inkuberes i en time ved 37 °C i et fugtkammer.c) | les anticorps monoclonaux spécifiques (à savoir IP5B11 pour le virus de la SHV et HYB-136-3 pour le virus de la NHI) doivent être dilués dans du PBST 0,01 M, à pH 7,2, à la dilution recommandée par le fournisseur des AcM; ils doivent ensuite être ajoutés aux cultures monocouches fixées, à raison de 50 à 100 μl/puits, et les plaques doivent ensuite être incubées pendant une heure à 37 °C dans une étuve humide;
(d) | cover glasses shall be washed gently three times with PBS containing 0,05 % Tween-20 (PBS-T), and the buffer shall be removed completely after the last rinse. The cells shall subsequently be incubated for one hour at 37 °C with fluorescein isothiocyanate (FITC) — or tetramethylrhodamine-5-(and-6-) isothiocyanate (TRITC)-conjugated antibodies against mouse immunoglobulin used as the primary antibody, diluted according to the supplier instructions, washed again in PBS-T, and dried. Stained cultures shall be mounted onto glass slides using glycerol saline and examined under incident ultraviolet (UV) light. Use 10 × or 12 × eyepieces and a × 25 or × 40 objective lens with numerical apertures > 0,7 and > 1,3 respectively.d) | Dækglassene vaskes forsigtigt tre gange med PBS indeholdende 0,05 % Tween-20 (PBS-T), og bufferen fjernes helt efter sidste vaskning. Cellerne inkuberes derefter i en time ved 37 °C med fluoresceinisothiocyanat (FITC) — eller tetramethylrhodamin-5-(og-6-)isothiocyanat (TRITC)-konjugerede antistoffer mod museimmunglobulin anvendt som det primære antistof, fortyndet i henhold til leverandørens anvisninger, vaskles endnu en gang i PBS-T og tørres. Farvede kulturer monteres på objektglas med glycerolsaltopløsning og undersøges under indfaldende UV-lys. Der anvendes okularer, der forstørrer 10 × eller 12 ×, og × 25 – eller × 40-objektiver med en blænde på henholdsvis > 0,7 og > 1,3.d) | les lamelles doivent être rincées en douceur trois fois dans du PBS contenant 0,05 % de Tween 20 (PBS-T), et le tampon doit être totalement éliminé après le dernier rinçage. Les cellules doivent ensuite être incubées pendant une heure à 37 °C avec des anticorps anti-immunoglobulines de souris conjugués à de l'isothiocyanate de fluorescéine (FITC) ou du tétraméthylrhodamine-5-(et 6-)isothiocyanate (TRITC), utilisés comme anticorps primaires, dilués conformément aux instructions du fournisseur, avant nouveau rinçage au PBS-T puis séchage. Les cultures colorées doivent être montées sur lames de verre à l'aide d'une solution saline de glycérol puis examinées en lumière ultraviolette incidente. Utiliser des oculaires 10 × ou 12 × et des lentilles d'objectif × 25 ou × 40, dont les ouvertures numériques sont respectivement > 0,7 et > 1,3.
Other IF techniques, with regard to cell cultures, fixation and antibodies of reference quality, of proven similar efficacy may be used instead.Andre IF-metoder (mht. cellekulturer, fiksering og antistoffer af referencekvalitet) med dokumenteret tilsvarende effektivitet kan anvendes.Il est aussi possible de recourir à d'autres techniques d'IF (pour ce qui est des cultures cellulaires, de la fixation et des anticorps de référence) d'efficacité équivalente avérée.
I.6.3.   NeutralisationI.6.3.   NeutralisationI.6.3.   Neutralisation
Cells from the collected supernatant shall be removed by centrifugation (2 000 to 4 000 × g) or membrane filtration (0,45 μm) with a low protein binding membrane and the supernatant shall be diluted 1:100 and 1:10 000 in cell culture medium.Cellerne fra den opsamlede supernatant fjernes ved centrifugering (2 000-4 000 × g) eller membranfiltrering (0,45 μm) gennem et svagt proteinbindende membranfilter, og supernatanten fortyndes 1:100 og 1:10 000 i celledyrkningsmedium.Les cellules présentes dans le surnageant recueilli doivent être éliminées par centrifugation (entre 2 000 et 4 000 g) ou par filtration sur membrane (0,45 μm) à l'aide d'une membrane à faible capacité de liaison des protéines, puis le surnageant doit être dilué au 1:100 et au 1:10 000 dans le milieu de culture.
Aliquots of a minimum of two supernatant dilutions shall be mixed and incubated for 60 minutes at 15 °C with equal parts of the following reagents separately:Aliquoter af mindst to supernatantfortyndinger blandes og inkuberes i 60 minutter ved 15 °C med lige dele af følgende reagenser hver for sig:Des parties aliquotes d'au moins deux dilutions du surnageant doivent être mélangées et incubées séparément pendant 60 minutes à 15 °C avec des parties égales des réactifs suivants:
(a) | serum containing group specific antibody against VHSV at a 1:50 (vol:vol) dilution;a) | serum indeholdende gruppespecifikt antistof mod VHSV fortyndet i forholdet 1:50 v/va) | du sérum contenant l'anticorps spécifique de groupe contre le virus de la SHV, à une dilution de 1:50 (v:v),
(b) | serum containing group specific antibody against IHNV at a 1:50 (vol:vol) dilution;b) | serum indeholdende gruppespecifikt antistof mod IHNV fortyndet i forholdet 1:50 v/vb) | du sérum contenant l'anticorps spécifique de groupe contre le virus de la NHI, à une dilution de 1:50 (v:v),
(c) | pool of antisera against the indigenous serotypes of IPNV at a 1:50 (vol:vol) dilution;c) | blanding af antisera mod indigene serotyper af IPNV fortyndet i forholdet 1:50 v/vc) | un lot d'antisérums anti-sérotypes indigènes du virus de la NPI, à une dilution de 1:50 (v:v),
(d) | medium alone (positive control).d) | medium alene (positiv kontrol).d) | le milieu seul (témoin positif).
From each virus supernatant-serum mixture, at least two cell cultures shall be inoculated with 50 μl each and then incubated at 15 °C. The development of CPE shall be checked as described in point I.5.4.Der skal fra hver virussupernatant-serum-blanding podes mindst to cellekulturer med 50 μl hver, som derefter inkuberes ved 15 °C. Udviklingen af CPE kontrolleres som beskrevet i punkt I.5.4.Au moins deux cultures cellulaires doivent être inoculées à l'aide de 50 μl du mélange surnageant-sérum de chaque virus, puis incubées à 15 °C. L'apparition de l'ECP doit être vérifiée comme indiqué au point I.5.4.
VHSV strains and isolates that do not react in neutralisation tests shall be identified by IF or ELISA.VHSV-stammer og -isolater, som ikke reagerer i neutralisationstest, identificeres ved IF eller ELISA.Les souches et les isolats du virus de la SHV qui ne réagissent pas dans les tests de neutralisation doivent être identifiés par les techniques IF ou ELISA.
Other neutralisation tests of proven similar efficacy may be used instead.Andre neutralisationstest med dokumenteret tilsvarende effektivitet kan også anvendes.D'autres tests de neutralisation présentant une efficacité similaire avérée peuvent aussi être utilisés.
I.6.4.   RT-PCR/RT-qPCRI.6.4.   RT-PCR/RT-qPCRI.6.4.   RT-PCR/RT-qPCR
I.6.4.1.   Preparation of viral RNAI.6.4.1.   Forberedelse af viralt RNAI.6.4.1.   Préparation de l'ARN viral
All work with RNA shall be performed on ice, using gloves.Alt arbejde med RNA skal udføres på is, og der skal anvendes handsker.Toutes les manipulations sur l'ARN doivent être réalisées sur de la glace, et des gants doivent être utilisés.
RNA shall be extracted using the phenol-chloroform method or by RNA affinity spin columns, according to the manufacturer's instructions. Commercially available RNA extraction kits that will produce high quality RNA suitable for use with the RT-PCR protocols detailed in the points below may be used.RNA ekstraheres efter phenolchloroformmetoden eller med kolonner til oprensning af RNA (RNA affinity spin columns) i henhold til fabrikantens anvisninger. Der kan anvendes kommercielt tilgængelige RNA-ekstraktionskit, der giver RNA af høj kvalitet, som er egnet til anvendelse med de RT-PCR-protokoller, der beskrives i det følgende.L'ARN doit être extrait par la méthode phénol/chloroforme ou par chromatographie d'affinité sur colonnes, selon les instructions du fabricant. Il est possible d'utiliser les kits d'extraction de l'ARN disponibles dans le commerce, qui permettent d'obtenir un ARN de qualité utilisable dans les protocoles de RT-PCR détaillés ci-après.
RNA shall be re-suspended in distilled RNAse-free water, (namely water treated with 0,1 % diethyl pyrocarbonate) or an appropriate elution buffer.RNA skal genopslæmmes i destilleret RNAse-frit vand (dvs. vand, der er behandlet med 0,1 % diethylpyrocarbonat) eller en passende elueringsbuffer.L'ARN doit être remis en suspension dans de l'eau distillée exempte d'ARNase (c.-à-d. de l'eau traitée avec du pyrocarbonate de diéthyle à 0,1 %) ou un tampon d'élution approprié.
I.6.4.2.   RT-PCRI.6.4.2.   RT-PCRI.6.4.2.   RT-PCR
The following primers shall be used for detection of IHNV:Der anvendes følgende primere til påvisning af IHNV:Les amorces suivantes doivent être utilisées pour la détection du VNHI:
  | Forward Primer 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′;  | Forward primer 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′  | amorce sens 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′;
  | Reverse Primer 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.  | Reverse Primer 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.  | amorce antisens 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.
The following cycles shall be used (one-step RT-PCR): 1 cycle: 50 °C for 30 minutes; 1 cycle: 95 °C for 2 minutes; 30 cycles: 95 °C for 30 seconds, 50 °C for 30 seconds, 72 °C for 60 seconds; 1 cycle: 72 °C for 7 minutes and soak at 4 °C.Der anvendes følgende cyklusser (ettrins-RT-PCR): 1 cyklus: 50 °C i 30 minutter; 1 cyklus: 95 °C i 2 minutter; 30 cyklusser: 95 °C i 30 sekunder, 50 °C i 30 sekunder, 72 °C i 60 sekunder; 1 cyklus: 72 °C i 7 minutter og udblødning ved 4 °C.Les cycles suivants doivent être utilisés (RT-PCR en une seule étape): 1 cycle: 50 °C pendant 30 minutes; 1 cycle: 95 °C pendant 2 minutes; 30 cycles: 95 °C pendant 30 secondes, 50 °C pendant 30 secondes, 72 °C pendant 60 secondes; 1 cycle: 72 °C pendant 7 minutes et trempage à 4 °C.
The following primers shall be used for detection of VHSV:Der anvendes følgende primere til påvisning af VHSV:Les amorces suivantes doivent être utilisées pour la détection du VSHV:
  | VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′;  | VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′  | VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′;
  | VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.  | VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.  | VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.
The following cycles shall be used (one-step RT-PCR): 50 °C for 30 minutes, 95 °C for 15 minutes, 35 cycles at 94 °C for 30 seconds, 55 °C for 30 seconds, and 68 °C for 60 seconds. Subsequently, the reaction shall be held at 68 °C for 7 minutes.Der anvendes følgende cyklusser (ettrins-RT-PCR): 50 °C i 30 minutter, 95 °C i 15 minutter, 35 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 68 °C i 60 sekunder. Reaktionen skal derefter holdes ved 68 °C i 7 minutter.Les cycles suivants doivent être utilisés (RT-PCR en une seule étape): 50 °C pendant 30 minutes, 95 °C pendant 15 minutes, 35 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 68 °C pendant 60 secondes. La réaction doit être ensuite maintenue à une température de 68 °C pendant 7 minutes.
Quantity and specificity of the RT-PCR reactions shall be evaluated by gel electrophoresis in 1,5 % agarose gel with ethidium bromide and observed using UV transillumination. A 693 bp PCR amplicon may be observed for IHNV. For VHSV, the size shall be 505 bp.RT-PCR-reaktionernes kvantitet og specificitet skal evalueres ved gelelektroforese i 1,5 % agarosegel med ethidiumbromid og observeres ved hjælp af UV-gennemlysning. Et PCR-amplikon på 693 bp kan observeres for IHNV. For VHSV skal størrelsen være 505 bp.La quantité et la spécificité des réactions de RT-PCR doivent être évaluées par électrophorèse sur gel d'agarose à 1,5 % à l'aide de bromure d'éthidium, et les produits des réactions doivent être observés en lumière UV. Un amplicon de PCR de 693 paires de bases (pb) peut être observé pour le VNHI. Pour le VSHV, la taille de l'amplicon peut atteindre 505 pb.
The results of the PCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or laboratory contamination. Adequate positive and negative controls and sequence amplicons shall therefore be included to avoid any doubts. For the VHSV primers, special care shall be taken when using BF-2 cells, as the primers may react with the cell line DNA/RNA producing false-positive results of similar size. When testing supernatant from BF-2 cells, any amplified PCR fragments shall be sequenced.Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Passende positive og negative kontroller og sekventeret amplikon skal derfor anvendes for at undgå enhver tvivl. For så vidt angår VHSV-primerne skal der udvises særlig forsigtighed, når der anvendes BF-2-celler, da primerne kan reagere med cellelinjens DNA/RNA og give falsk positive resultater af lignende størrelse. Når supernatant fra BF-2-celler testes, skal alle amplificerede PCR-fragmenter sekventeres.Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. Afin de dissiper tout doute, il convient de prévoir des témoins positifs et négatifs et des amplicons de séquences appropriés. En ce qui concerne les amorces du VSHV, l'utilisation de cellules BF-2 nécessite une attention particulière, car les amorces peuvent réagir avec l'ADN/l'ARN de la lignée cellulaire et produire des faux-positifs de même taille. Si le test est réalisé sur du surnageant provenant de cellules BF-2, tous les fragments amplifiés par PCR doivent être séquencés.
I.6.4.3.   RT-qPCR for VHSVI.6.4.3.   RT-qPCR til VHSVI.6.4.3.   RT-qPCR pour le VSHV
For VHSV, amplification shall be performed using the following primers and probe:For VHSV skal amplificering foretages med følgende primere og probe:Pour le VSHV, l'amplification doit être réalisée à l'aide de la sonde et des amorces suivantes:
  | Forward primer: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′;  | Forward primer: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′  | amorce sens: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′;
  | Reverse primer: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′;  | Reverse primer: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′  | amorce antisens: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′;
  | and probe: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.  | og probe: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.  | et sonde: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.
One-step RT-qPCR:Ettrins-RT-qPCR:RT-qPCR en une étape:
Negative template controls and positive controls shall be included on each plate run. Cycling conditions: 50 °C for 30 minutes, 95 °C for 15 minutes, 40 cycles of 94 °C for 15 seconds, 60 °C for 40 seconds, 72 °C for 20 seconds; adjust if necessary. Other RT-PCR or RT-qPCR versions of proven similar efficacy may be used instead.Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser: 50 °C i 3 minutter, 95 °C i 15 minutter, 40 cyklusser ved 94 °C i 15 sekunder, 60 °C i 40 sekunder og 72 °C i 20 sekunder. Justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles: 50 °C pendant 30 minutes, 95 °C pendant 15 minutes, 40 cycles de 94 °C pendant 15 secondes, 60 °C pendant 40 secondes et 72 °C pendant 20 secondes, à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
I.6.4.4.   RT-qPCR for IHNVI.6.4.4.   RT-qPCR til IHNVI.6.4.4.   RT-qPCR pour le VNHI
For IHNV, amplification shall be performed using the following primers and probe:For IHNV skal amplificering foretages med følgende primere og probe:Pour le VNHI, l'amplification doit être réalisée à l'aide de la sonde et des amorces suivantes:
  | Forward primer: 5′- AGA-GCC-AAG-GCA-CTG-TGC-G-3′;  | Forward primer: 5′- AGA-GCC-AAG-GCA-CTG-TGC-G-3′  | amorce sens: 5′-AGA-GCC-AAG-GCA-CTG-TGC-G-3′;
  | Reverse primer: 5′- TTCTTTGCGGCTTGGTTGA - 3′;  | Reverse primer: 5′- TTCTTTGCGGCTTGGTTGA — 3′  | amorce antisens: 5′-TTCTTTGCGGCTTGGTTGA-3′;
  | and probe: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.  | og probe: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.  | et sonde: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.
Two-step RT-qPCR:Totrins-RT-qPCR:RT-qPCR en deux étapes:
As the following assay depends on a two-step amplification, extra care shall be taken when handling the tubes from one reaction to the other in order to prevent contamination.Da følgende analyse afhænger af en totrins-amplificering, skal der for at undgå kontaminering udvises særlig stor forsigtighed ved håndtering af rør mellem første og anden reaktion.L'analyse reposant sur une amplification en deux étapes, des précautions doivent être prises lors de la manutention des tubes entre les réactions, afin d'éviter toute contamination.
Cycling conditions (after RT-step): 50 °C for 2 minutes, 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minutes; adjustments shall be made if necessary.Cyklusbetingelser (efter RT-trinnet): 50 °C i 2 minutter, 95 °C i 10 minutter efterfulgt af 40 cyklusser ved 95 °C i 15 sekunder og 60 °C i 1 minut; om nødvendigt foretages justeringer.Succession de cycles (après l'étape de la transcription inverse): 50 °C pendant 2 minutes, 95 °C pendant 10 minutes, puis 40 cycles de 95 °C pendant 15 secondes et 60 °C pendant 1 minute, à adapter si nécessaire.
Other RT-PCR or RT-qPCR versions of proven similar efficacy may be used instead.Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
II.   Detailed diagnostic methods and procedures for the confirmation of or to rule out the suspicion of VHS or IHN or both in suspected outbreaksII.   Detaljerede diagnosemetoder og -procedurer for at bekræfte eller udelukke mistanke om VHS eller IHN eller begge ved mistanke om udbrudII.   Méthodes et procédures de diagnostic détaillées pour écarter une suspicion de SHV ou de NHI ou des deux maladies, ou pour confirmer la présence d'une de ces maladies ou des deux
When a laboratory examination is required to confirm or rule out the presence of IHN or VHS or both in accordance with Article 57(b) of Directive 2006/88/EC using the diagnostic methods set out in point II.3 of Part 1 of Annex I, the following detailed diagnostic methods and procedures shall apply:Hvis der i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF kræves laboratorieundersøgelser for at bekræfte eller udelukke forekomst af IHN eller VHS eller begge ved hjælp af diagnosemetoderne i bilag I, del 1, punkt II.3, anvendes følgende detaljerede diagnosemetoder og -procedurer:Lorsqu'un examen de laboratoire est requis pour confirmer ou exclure la présence de la NHI ou de la SHV, ou de ces deux maladies à la fois, conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic établies à l'annexe I, partie 1, point II.3, les méthodes et procédures de diagnostic détaillées suivantes doivent être appliquées:
(a) | conventional virus isolation with subsequent seroneutralisation, immune-chemical or molecular virus identification;a) | konventionel virusisolation med efterfølgende seroneutralisation, immunkemisk eller molekylær virusidentifikationa) | isolement classique du virus suivi d'une identification de celui-ci par séroneutralisation ou par technique immunochimique ou moléculaire;
(b) | virus detection by RT-PCR or RT-qPCR;b) | viruspåvisning ved hjælp af RT-PCR eller RT-qPCRb) | détection du virus par RT-PCR ou RT-qPCR;
(c) | other diagnostic techniques such as IFAT, ELISA, RT-PCR, IHC.c) | andre diagnoseteknikker som f.eks. IFAT, ELISA, RT-PCR eller IHC.c) | autres techniques de diagnostic, telles que IFAT, ELISA, RT-PCR, IHC.
II.1.   Conventional virus isolation with subsequent virus identificationII.1.   Konventionel virusisolation med efterfølgende virusidentifikationII.1.   Isolement classique du virus suivi de son identification
II.1.1.   Selection of samplesII.1.1.   Udvælgelse af prøverII.1.1.   Sélection des échantillons
At least 10 fish showing typical signs of IHN or VHS shall be selected for examination.Der udvælges mindst 10 fisk med typiske symptomer på IHN eller VHS til undersøgelse.Au moins dix poissons présentant des signes typiques de NHI ou de SHV doivent être sélectionnés pour un examen.
II.1.2.   Preparation and shipment of samples from fishII.1.2.   Præparation og forsendelse af fiskeprøverII.1.2.   Préparation et expédition des échantillons de poissons
The preparation and shipment for the purpose of conventional virus isolation shall follow the methods and procedures laid down in point I.2.Præparation og forsendelse med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.2.La préparation et l'expédition aux fins de l'isolement classique du virus doivent être effectuées selon les méthodes et procédures indiquées au point I.2.
II.1.3.   Collection of supplementary diagnostic materialII.1.3.   Indsamling af supplerende diagnostisk materialeII.1.3.   Collecte de matériel de diagnostic supplémentaire
The collection of supplementary material for the purpose of conventional virus isolation shall follow the methods and procedures laid down in point I.3.Indsamling af supplerende materiale med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.3.La collecte de matériel supplémentaire aux fins de l'isolement classique du virus doit être réalisée selon les méthodes et procédures indiquées au point I.3.
II.1.4.   Preparation of samples for cell culture examinationII.1.4.   Præparation af prøver til cellekulturundersøgelseII.1.4.   Préparation des échantillons en vue de l'examen de cultures cellulaires
The preparation of samples for cell culture examination for the purpose of conventional virus isolation shall follow the methods and procedures laid down in point I.4.Præparation af prøver til cellekulturundersøgelse henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.4.La préparation des échantillons en vue de l'examen de cultures cellulaires aux fins de l'isolement classique du virus doit être effectuée selon les méthodes et procédures indiquées au point I.4.
II.1.5.   Virological examination on cell cultureII.1.5.   Virologisk undersøgelse i cellekulturII.1.5.   Examen virologique sur culture cellulaire
The virological examination for the purpose of conventional virus isolation shall follow the methods and procedures laid down in point I.5.Den virologiske undersøgelse med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.5.L'examen virologique aux fins de l'isolement classique du virus doit être effectué selon les méthodes et procédures indiquées au point I.5.
II.1.6.   Virus identificationII.1.6.   VirusidentifikationII.1.6.   Identification du virus
The virus identification for the purpose of conventional virus isolation shall follow the methods and procedures laid down in point I.6.Virusidentifikation med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.6.L'identification du virus aux fins de son isolement classique doit être effectuée selon les méthodes et procédures indiquées au point I.6.
II.2.   Virus detection by RT-qPCRII.2.   Viruspåvisning ved hjælp af RT-qPCRII.2.   Détection du virus par RT-qPCR
II.2.1.   Selection of samplesII.2.1.   Udvælgelse af prøverII.2.1.   Sélection des échantillons
The selection of samples for the purpose of virus detection by RT-qPCR shall follow the methods and procedures laid down in point I.1.2.Udvælgelse af prøver med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.1.2.La sélection des échantillons aux fins de la détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées au point I.1.2.
II.2.2.   Preparation and shipment of samples from fishII.2.2.   Præparation og forsendelse af fiskeprøverII.2.2.   Préparation et expédition des échantillons de poisson
The preparation and shipment for the purpose of virus detection by RT-qPCR shall follow the methods and procedures laid down in point I.2.Præparation og forsendelse med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.2.La préparation et l'expédition des échantillons aux fins de la détection du virus par RT-qPCR doivent être réalisées selon les méthodes et procédures indiquées au point I.2.
II.2.3.   Collection of supplementary diagnostic materialII.2.3.   Indsamling af supplerende diagnostisk materialeII.2.3.   Collecte de matériel de diagnostic supplémentaire
The collection of supplementary diagnostic material for the purpose of virus detection by RT-qPCR shall follow the methods and procedures laid down in point I.3.Indsamling af supplerende diagnostisk materiale med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.3.La collecte de matériel de diagnostic supplémentaire aux fins de la détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées au point I.3.
II.2.4.   Sample preparation for RT-qPCRII.2.4.   Præparation af prøver til RT-qPCRII.2.4.   Préparation des échantillons pour la RT-qPCR
The sample preparation for the purpose of virus detection by RT-qPCR shall follow the methods and procedures laid down in point I.6.4.1.Præparation af prøver med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.6.4.1.La préparation des échantillons aux fins de la détection du virus par RT-qPCR doit être réalisée selon les méthodes et procédures indiquées au point I.6.4.1.
II.2.5.   RT-qPCRII.2.5.   RT-qPCRII.2.5.   RT-qPCR
The virus detection by RT-qPCR shall follow the methods and procedures laid down in points I.6.4.1, I.6.4.3 and I.6.4.4.Viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.6.4.1, I.6.4.3 og I.6.4.4.La détection du virus par RT-qPCR doit être effectuée selon les méthodes et procédures indiquées aux points I.6.4.1, I.6.4.3 et I.6.4.4.
II.3.   Other diagnostic techniquesII.3.   Andre diagnosemetoderII.3.   Autres techniques de diagnostic
Supernatant prepared as described in point I.4.3 may be submitted to ELISA, Indirect fluorescent antibody test (IFAT), or RT-PCR in accordance with point I.6.1, point I.6.2 or point I.6.4 respectively. Tissue material may be subjected to other diagnostic techniques, such as IFAT on frozen sections, immunohistochemistry on formalin fixed tissue material. Those rapid techniques shall be supplemented with a virological examination in accordance with either point II(a) or point II(b) within 48 hours after sampling, if:Supernatanten, præpareret som beskrevet i punkt I.4.3, kan analyseres ved ELISA, IFAT eller RT-PCR i overensstemmelse med henholdsvis punkt I.6.1, punkt I.6.2 eller punkt I.6.4. Vævsmateriale kan analyseres efter andre diagnosticeringsmetoder såsom IFAT på frysesnit eller immunhistokemi på formalinfikseret vævsmateriale. Disse hurtige teknikker skal suppleres med en virologisk undersøgelse i overensstemmelse med enten punkt II, litra a), eller punkt II, litra b), senest 48 timer efter prøveudtagningen, hvis:Le surnageant préparé comme indiqué au point I.4.3 peut être soumis à un test ELISA, à un test d'immunofluorescence indirecte (IFAT) ou à une analyse par RT-PCR conformément aux instructions figurant respectivement aux points I.6.1, I.6.2 ou I.6.4. Les tissus peuvent être soumis à d'autres techniques de diagnostic telles que l'IFAT sur coupes congelées ou l'analyse immunohistochimique sur tissus fixés au formol. Ces techniques rapides doivent être complétées par un examen virologique conformément au point II a) ou au point II b), dans les 48 heures suivant l'échantillonnage:
(a) | a negative result is obtained; ora) | resultatet er negativt, ellera) | si un résultat négatif a été obtenu ou
(b) | a positive result is obtained with material representing the first case of IHN or VHS.b) | resultatet er positivt med materiale fra det første tilfælde af IHN eller VHS.b) | si un résultat positif a été obtenu avec un matériel représentant le premier cas de NHI ou SHV.
III.   Procedure for titration to verify the susceptibility of the cell cultures to infectionIII.   Titreringsprocedure til kontrol af cellekulturers modtagelighed for infektionIII.   Titrage destiné à vérifier la sensibilité des cultures cellulaires à l'infection
When titration to verify the susceptibility of the cell cultures to infection as referred to in point I.5.3 is carried out, the procedures set out in the following paragraphs of this point shall be followed.Når titreringen til kontrol af cellekulturers modtagelighed for infektion, jf. punkt I.5.3, foretages, skal procedurerne i følgende afsnit følges.Lors du titrage destiné à vérifier la sensibilité des cultures cellulaires à l'infection visé au point I.5.3, les procédures décrites ci-après doivent être respectées.
At least two VHSV isolates and one isolate of IHNV shall be used. The isolates shall represent the major group of viruses within the European Union, namely for VHSV one pathogenic isolate from rainbow trout in freshwater and one marine isolate pathogenic for turbot, and for IHNV one rainbow trout pathogenic strain from the European Union. Well-defined isolates from the Member States shall be used. Batches of virus in low cell culture passage numbers shall be propagated in cell culture flasks on BF-2 or RTG-2 cells for VHSV and on EPC or FHM cells for IHNV. Cell culture medium with at least 10 % serum shall be used. Low MOI for inoculation (< 1) shall be used.Der anvendes mindst to VHSV-isolater og ét IHNV-isolat. Isolaterne skal repræsentere den vigtigste virusgruppe i Den Europæiske Union, dvs. for VHSV ét patogent isolat fra regnbueørred i ferskvand og ét marint isolat, der er patogent for pighvar, og for IHNV en EU-stamme, som er patogen for regnbueørred. Der anvendes veldefinerede isolater fra medlemsstaterne. Batcher af virus i cellekulturer med lavt passagetal dyrkes i celledyrkningsglas på BF-2- eller RTG-2-celler for VHSV og på EPC- eller FHM-celler for IHNV. Der anvendes celledyrkningsmedium med mindst 10 % serum. Der anvendes en lav MOI til podning (< 1).Il convient d'utiliser au moins deux isolats de VSHV et un isolat de VNHI. Ces isolats doivent être représentatifs des principaux groupes de virus dans l'Union européenne, à savoir, en ce qui concerne le VSHV, un isolat pathogène issu de truite arc-en-ciel évoluant en eau douce et un isolat pathogène de turbot évoluant en eau de mer et, en ce qui concerne le VNHI, une souche pathogène de truite arc-en-ciel provenant de l'Union européenne. Il convient d'utiliser des isolats bien définis provenant des États membres. Des lots de virus ayant subi un petit nombre de passages sont propagés, dans des flacons de culture cellulaire, sur des cellules BF-2 ou RTG-2 dans le cas du VSHV, et sur des cellules EPC ou FHM dans le cas du VNHI. Il convient d'utiliser un milieu de culture contenant au moins 10 % de sérum. Pour l'inoculation, la multiplicité d'infection doit être faible (< 1).
At total CPE, the virus shall be harvested by centrifugation of cell culture supernatant at 2 000 × g for 15 minutes, filter sterilised through 0,45 μm membrane filter and distributed in labelled cryotubes. The virus shall be kept at – 80 °C.Ved fuld CPE skal der høstes virus ved centrifugering af cellekultursupernatanten ved 2 000 × g i 15 minutter; derefter filtersteriliseres det gennem et 0,45 μm membranfilter og fordeles i mærkede fryserør. Virusset skal opbevares ved – 80 °C.Lorsque l'ECP est total, le virus est récolté par centrifugation du surnageant de la culture cellulaire à 2 000 g pendant quinze minutes, stérilisé et filtré à travers une membrane de 0,45 μm, puis réparti dans des cryotubes étiquetés. Le virus doit être conservé à – 80 °C.
1 week after freezing, three replicate vials with each virus shall be thawed under cold water and titrated on their respective cell lines. At least every 6 months, or if it is suspected that the susceptibility of a cell line has decreased, each virus isolate shall be thawed and titrated.En uge efter frysning optøs tre glas med hvert virus i koldt vand, og det titreres på deres respektive cellelinjer. Mindst hver sjette måned, eller hvis der er mistanke om, at cellelinjernes modtagelighed for infektion er mindsket, optøs og titreres hvert virusisolat.Une semaine après la congélation, trois fioles de chaque virus sont décongelées sous eau froide et titrées sur leurs lignées cellulaires respectives. Chaque isolat de virus doit être décongelé et titré tous les six mois au moins, ou dès que l'on suspecte une diminution de la sensibilité d'une lignée cellulaire.
Titration procedures must be described in detail and the same procedure followed each time.Titreringsprocedurerne skal nøje beskrives, og der anvendes samme metode hver gang.Les procédures de titrage doivent être décrites en détail et la même procédure doit être appliquée à chaque fois.
Titration by end point dilution shall include at least six replicates at each dilution step. The titres shall be compared with previously obtained titres. If the titre of any of the three virus isolates drops by a factor of 2 logs or more, compared with the initial titre, the cell line shall no longer be used for surveillance purposes.Titrering indtil fortyndingsslutpunktet gentages seks gange på hvert fortyndingstrin. Titerne sammenlignes med tidligere titere. Hvis titeren af et af de tre virusisolater er mindst to logaritmer lavere end den oprindelige titer, må cellelinjen ikke længere anvendes til overvågningsformål.Le titrage par dilution limite doit comprendre au moins six réplicats de chaque série de dilutions. Les titres doivent être comparés à ceux obtenus antérieurement. Si le titre d'un des trois isolats viraux baisse d'un facteur 100 ou plus par rapport au titre initial, la lignée cellulaire ne doit plus être utilisée à des fins de surveillance.
If different cell lines are kept in the laboratory each line shall be examined separately.Hvis der anvendes flere cellelinjer i laboratoriet, skal hver cellelinje undersøges for sig.Si différentes lignées cellulaires sont conservées au laboratoire, chaque lignée doit être examinée séparément.
Records shall be kept for a period of at least 10 years.Data og optegnelser skal opbevares i mindst 10 år.Des registres sont conservés pendant dix ans au moins.
PART 2DEL 2PARTIE 2
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR THE SURVEILLANCE AND CONFIRMATION OF KHV DISEASE (KHVD)DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF KOI-HERPESVIRUS-SYGDOM (KHV)MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'HERPÈSVIROSE DE LA CARPE KOÏ (HVCK)
I.   Detailed diagnostic methods and procedures for the confirmation of the presence of or to rule out the suspicion of KHVDI.   Detaljerede diagnosemetoder og -procedurer for at bekræfte forekomst af eller udelukke mistanke om KHVI.   Méthodes et procédures de diagnostic détaillées pour écarter une suspicion d'HVCK ou confirmer la présence de cette maladie
When a laboratory examination is required for the purpose of confirmation of the presence of or to rule out the suspicion of KHVD in accordance with Article 57(b) of Directive 2006/88/EC, using the diagnostic methods set out in Section III of Part 2 of Annex I, the detailed diagnostic methods and procedures set out in points I.1 – I.2 of this Part shall apply.Hvis der i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF kræves laboratorieundersøgelser for at bekræfte forekomst af eller udelukke mistanke om KHV ved hjælp af diagnosemetoderne i bilag I, del 2, afsnit III, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1-I.2 nedenfor.Lorsqu'un examen de laboratoire est requis pour confirmer la présence de l'HVCK ou pour écarter une suspicion de cette maladie, conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic établies à l'annexe I, partie 2, section III, les méthodes et procédures de diagnostic détaillées indiquées aux points I.1 à I.2 de la présente partie doivent être appliquées.
I.1.   Preparation of samples from fishI.1.   Præparation af fiskeprøverI.1.   Préparation des échantillons de poissons
For diagnostic purposes the fish (sent alive or killed and packed separately in sealed aseptic containers) or alternatively frozen organs or organ pieces preserved in 80 % to absolute ethanol or viral transport medium (to be processed within 48 hours after collection) may be used for testing with conventional PCR or qPCR based methods.Til diagnostiske formål kan fisken (sendt levende eller død og pakket separat i forseglede aseptiske beholdere) eller alternativt frosne organer eller stykker af organer konserveret i 80 % til absolut ethanol eller transportmedium til virus (skal behandles senest 48 timer efter indsamlingen) anvendes til undersøgelse med konventionel PCR eller qPCR-baserede metoder.À des fins de diagnostic, il est possible d'utiliser des poissons (expédiés vivants ou morts et emballés séparément dans des conteneurs aseptiques hermétiques) ou bien des organes ou des morceaux d'organes congelés conservés dans de l'éthanol de concentration comprise entre 80 % et la concentration de l'éthanol absolu, ou dans un milieu de transport viral (en vue d'un traitement dans les 48 heures suivant le prélèvement) pour procéder aux essais par des méthodes fondées sur la PCR classique ou la qPCR.
For the detection of KHV, gill and kidney shall be collected; in addition spleen, encephalon and intestine may be included in an additional separated sample. In acute cases, tissue material of up to five fish may be pooled.Til påvisning af KHV indsamles gæller og nyre; desuden kan milt, hjerne og tarm indgå i en yderligere separat prøve. I akutte tilfælde kan vævsmateriale fra op til fem fisk udgøre en samleprøve.Pour la détection de l'HVK, les branchies et les reins doivent être prélevés; en outre, la rate, l'encéphale et les intestins peuvent être inclus dans un échantillon supplémentaire distinct. En cas d'infection aiguë, il est possible de regrouper des tissus provenant de cinq poissons au maximum.
Furthermore, non-lethal samples such as blood, gill swabs, gill biopsy, mucus scrape may be used in certain cases (namely very valuable fish may be used in the case of the suspicion of the presence of KHV).Endvidere kan prøver, der kan udtages uden at slå dyret ihjel, som f.eks. blod, svaberprøver fra gæller, biopsi fra gæller og skrab fra slimhinder, anvendes i visse tilfælde (således at der kan anvendes meget værdifulde fisk i tilfælde af mistanke om forekomst af KHV).De surcroît, des échantillons non létaux tels que du sang, des frottis et des biopsies de branchies et des prélèvements de mucus peuvent être utilisés dans certains cas (c'est-à-dire que des poissons de grande valeur peuvent être utilisés lorsque l'on suspecte la présence de l'HVK).
I.1.1.   DNA extractionI.1.1.   DNA-ekstraktionI.1.1.   Extraction de l'ADN
DNA shall be extracted in accordance with standard procedures.DNA skal ekstraheres i henhold til standardprocedurerne.L'ADN doit être extrait conformément aux procédures standard.
The commercially available DNA extraction kits that produce high quality DNA suitable for use with the PCR protocols referred to in point I.2 may be used.Der kan anvendes kommercielt tilgængelige DNA-ekstraktionskit, der giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er omhandlet i punkt I.2.Il est possible d'utiliser les kits d'extraction de l'ADN disponibles dans le commerce, qui permettent d'obtenir un ADN de qualité utilisable dans les protocoles de PCR décrits au point I.2.
I.2.   Agent detection and identification by Polymerase chain reaction (PCR) based methodsI.2.   Agenspåvisning og -identifikation med metoder, der er baseret på polymerasekædereaktion (PCR)I.2.   Détection et identification de l'agent infectieux par des méthodes basées sur l'amplification en chaîne par polymérase (PCR)
I.2.1.   qPCR for KHV detectionI.2.1.   qPCR til påvisning af KHVI.2.1.   qPCR pour la détection de l'HVK
For qPCR detection of KHV, the following qPCR assay shall be used:Til qPCR-påvisning af KHV skal følgende qPCR-analyse anvendes:Pour la détection de l'HVK par qPCR, le protocole suivant doit être appliqué:
  | Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;  | Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′  | amorce sens (KHV-86f): 5′-GACGCCGGAGACCTTGTG-3′;
  | Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;  | Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′  | amorce antisens (KHV-163r): 5′-CGGGTTCTTATTTTTGTCCTTGTT-3′
  | and probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.  | og probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.  | et sonde (KHV-109p): 5′-FAM-CTTCCTCTGCTCGGCGAGCACG-3′.
Cycling conditions: one cycle of 95 °C at 15 minutes, followed by 40 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.Cyklusbetingelser: 1 cyklus ved 95 °C i 15 minutter efterfulgt af 40 cyklusser ved 94 °C i 15 sekunder og 60 °C i 60 sekunder. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre qPCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.Succession de cycles: un cycle de 95 °C pendant 15 minutes, suivi de 40 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
I.2.2.   Conventional PCR for KHV detectionI.2.2.   Konventionel PCR til påvisning af KHVI.2.2.   PCR classique pour la détection de l'HVK
The assay described in this point targeting the Thymine kinase (TK) gene of KHV shall be used. However, other PCR assays with demonstrated similar sensitivities and specificities to the described assay may be used instead.Der skal anvendes den i dette punkt beskrevne analyse, som er målrettet thyminkinase-genet (TK) i KHV. Andre PCR-analyser med dokumenteret sensitivitet og specificitet svarende til den beskrevne analyses kan dog også anvendes.Le protocole décrit au présent point, qui cible le gène codant pour la thymine kinase (TK) de l'HVK, doit être utilisé. Toutefois, d'autres protocoles de PCR dont la sensibilité et la spécificité sont, de toute évidence, similaires à celles du protocole décrit peuvent être utilisés à la place de ce dernier.
  | Forward primer (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′;  | Forward primer (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′  | Amorce sens (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′;
  | Reverse primer (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.  | Reverse primer (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.  | amorce antisens (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.
Cycling conditions: one cycle of 95 °C for 5 minutes followed by 35 cycles of 95 °C for 30 seconds, 52 °C for 30 seconds, 72 °C for one minute and one cycle of 72 °C for 10 minutes. Product size should be 409 bp.Cyklusbetingelser: 1 cyklus ved 95 °C i 5 minutter efterfulgt af 35 cyklusser ved 95 °C i 30 sekunder, 52 °C i 30 sekunder, 72 °C i et minut og 1 cyklus ved 72 °C i 10 minutter. Der anvendes en produktstørrelse på 409 bp.Succession de cycles: un cycle de 95 °C pendant 5 minutes, suivi de 35 cycles de 95 °C pendant 30 secondes, 52 °C pendant 30 secondes et 72 °C pendant une minute et d'un cycle de 72 °C pendant 10 minutes. La taille du produit doit être de 409 bp.
The results of the PCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or contamination. Negative template controls and positive controls shall be included on each plate run. However, other PCR versions of proven similar efficacy may be used instead.Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller kontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre PCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
The first detection in an area shall be confirmed by sequencing or sent to a to a national reference laboratory or to the EU reference laboratory for fish diseases referred to in Annex VI to Directive 2006/88/EC, for immediate identification.Den første påvisning i et område skal bekræftes ved sekventering eller sendes til et nationalt referencelaboratorium eller til EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF, med henblik på øjeblikkelig identifikation.La première détection du virus dans une zone doit être confirmée par séquençage ou par envoi d'échantillons à un laboratoire de référence national ou au laboratoire de référence de l'Union pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE en vue d'une identification immédiate.
II.   Detailed diagnostic methods and procedures for the surveillance of KHVDII.   Detaljerede diagnosemetoder og -procedurer for overvågning af KHVDII.   Méthodes et procédures de diagnostic détaillées pour la surveillance de l'HVCK
When sampling and laboratory examination for the purpose of obtaining or maintaining certain health statuses with regard to KHVD as set out in Section I of Part 2 of Annex I are carried out using the diagnostic methods set out in Sections II or III of Part 2 of that Annex, the detailed diagnostic methods and procedures set out in the following points II.1 and II.2 of this Part shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde en bestemt sundhedsstatus for så vidt angår KHVD som fastsat i bilag I, del 2, afsnit I, ved hjælp af diagnosemetoderne i del 2, afsnit II og III, i samme bilag, anvendes de detaljerede diagnosemetoder og -procedurer i følgende punkt II.1 og II.2.Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou du maintien d'un statut sanitaire donné en ce qui concerne l'HVCK comme indiqué à l'annexe I, partie 2, section I, à l'aide des méthodes de diagnostic décrites dans la partie 2, sections II ou III, de ladite annexe, les méthodes et procédures de diagnostic figurant aux points II.1 et II.2 de la présente partie doivent être appliquées.
II.1.   Preparation of samples from fishII.1.   Præparation af fiskeprøverII.1.   Préparation des échantillons de poisson
If possible, fish that have been kept for a prolonged time period at the virus permissive temperature range (namely, 2 to 3 weeks at 15 °C to 26 °C) shall be sampled. If possible, samples shall be collected 24 hours but not later than 72 hours after management practices that may reactivate the virus in fish with a carrier status, such as netting or transport, in order to enhance the chance of KHV detection.Hvis det er muligt, skal der udtages prøver af fisk, der i en længere periode har været holdt ved temperaturer, ved hvilke virus udvikler sig (dvs. to til tre uger ved 15-26 °C). Hvis det er muligt, skal der udtages prøver 24 timer, og senest 72 timer, efter driftspraksis, der kan reaktivere virusset i fisk med status som virusbærer, f.eks. brug af net eller transport, for at forbedre chancen for at påvise KHV.Dans la mesure du possible, les poissons qui ont été maintenus longtemps à des températures propices au développement du virus (c'est-à-dire entre 15 et 26 °C pendant deux à trois semaines) doivent faire l'objet d'un échantillonnage. Si possible, les échantillons doivent être prélevés au minimum 24 heures et au maximum 72 heures après des pratiques de gestion susceptibles de réactiver le virus dans les poissons vecteurs, telles que la capture en filet ou le transport, afin d'augmenter les chances de détection de l'HVK.
For the purpose of the surveillance of KHVD, the fish may be sent alive or killed and packed separately in sealed aseptic containers or alternatively frozen organs or organ pieces preserved in 80 % to 100 % alcohol or viral transport medium (to be processed within 48 hours after collection) may be used for testing PCR based methods. For the surveillance of KHVD, gill and kidney tissue shall be collected.Med henblik på overvågning af KHVD kan fisken (sendt levende eller død og pakket separat i forseglede aseptiske beholdere) eller alternativt frosne organer eller stykker af organer konserveret i 80-100 % alkohol eller transportmedium til virus (skal behandles senest 48 timer efter indsamlingen) anvendes til undersøgelse med PCR-baserede metoder. Med henblik på overvågning af KHVD udtages væv fra gæller og nyre.Aux fins de la surveillance de l'HVCK, les poissons peuvent être expédiés vivants ou morts et emballés séparément dans des conteneurs aseptiques hermétiques; sinon, il est aussi possible d'utiliser des organes ou des morceaux d'organes congelés conservés dans de l'alcool de concentration comprise entre 80 % et 100 % ou dans un milieu de transport viral (en vue d'un traitement dans les 48 heures suivant le prélèvement) pour des tests par des méthodes fondées sur la PCR. Pour la surveillance de l'HVCK, les branchies et les reins doivent être prélevés.
For the purpose of surveillance of KHVD, pooling shall be avoided where possible. If pooling is necessary, tissue material from a maximum of two fish may be pooled. Larger samples shall be homogenised in mortar and pestle or stomacher, and subsamples retrieved for DNA extraction before clarification. Alternatively, subsamples may be collected from each tissue included in the sample and placed in ‘lysis-tubes’.Med henblik på overvågning af KHVD undgås så vidt muligt samling af prøverne. Hvis samling af prøver er nødvendig, kan vævsmateriale fra højst to fisk udgøre en samleprøve. Større prøver skal homogeniseres med morter og pistil eller stomacher, og delprøver skal udtages til DNA-ekstraktion inden klaring. Alternativt kan delprøver udtages fra hvert væv, som indgår i prøven, og anbringes i »lysisrør«.Le regroupement de tissus de plusieurs poissons doit être évité dans la mesure du possible. Si ce regroupement est nécessaire, il ne portera que sur deux poissons au maximum. Les échantillons de plus grande taille doivent être homogénéisés au moyen d'un ensemble mortier-pilon ou d'un malaxeur, et des sous-échantillons devront être prélevés avant la clarification en vue de l'extraction de l'ADN. Une autre solution consiste à prélever des sous-échantillons de chaque tissu présent dans l'échantillon et à les placer dans des tubes de lyse.
II.1.1.   DNA extractionII.1.1.   DNA-ekstraktionII.1.1.   Extraction de l'ADN
DNA shall be extracted in accordance with standard procedures. Commercially available DNA extraction kits that produce high quality DNA suitable for use with the PCR protocols set out in point II.2 may be used.DNA skal ekstraheres i henhold til standardprocedurerne. Der kan anvendes kommercielt tilgængelige DNA-ekstraktionskit, der giver DNA af høj kvalitet, som er egnet til anvendelse med PCR-protokollerne i punkt II.2.L'ADN doit être extrait conformément aux procédures standard. Il est possible d'utiliser les kits d'extraction de l'ADN disponibles dans le commerce, qui permettent d'obtenir un ADN de qualité utilisable dans les protocoles de PCR décrits au point II.2.
The acceptable tissue medium ratio shall be 1:9 w/v. 20 to 25 mg tissue material shall be included in the tests.Det acceptable forhold mellem væv og medium er 1:9 w/v. I prøverne skal indgå 20-25 mg vævsmateriale.Le rapport acceptable entre les tissus et le milieu est de 1:9 p/v. Les essais doivent porter sur 20 à 25 mg de tissus.
II.2.   Surveillance of KHVD by PCR based methodsII.2.   Overvågning af KHVD med PCR-baserede metoderII.2.   Surveillance de l'HVCK par méthodes fondées sur la PCR
For the surveillance of KHV, a qPCR shall be used. If positive samples appear in an area not previously confirmed positive, the test results shall be confirmed either:Til overvågning af KHV anvendes qPCR. Hvis der forekommer positive prøver i et område, der ikke tidligere er bekræftet positivt, skal undersøgelsesresultaterne bekræftes enten:Pour la surveillance de l'HVCK, il y a lieu de recourir à la qPCR. Si des échantillons positifs apparaissent dans une zone qui n'a pas été préalablement confirmée positive, les résultats de l'essai doivent être confirmés:
(a) | by sequencing of a PCR or nested PCR product from the samples. | The obtained clean consensus sequence shall match (by at least 98 %) with these reference sequences.a) | ved sekventering af et PCR-produkt eller et nested PCR-produkt fra prøverne. | Der skal mindst være 98 % match mellem den opnåede rene konsensussekvens og disse referencesekvensera) | par séquençage d'un produit de PCR ou de PCR nichée («nested PCR») obtenu à partir des échantillons. | La séquence consensus obtenue doit coïncider (à 98 % au moins) avec les séquences de référence;
(b) | or alternatively, samples may be sent to a national reference laboratory for confirmation.b) | eller alternativt ved at sende prøverne til et nationalt referencelaboratorium med henblik på bekræftelse af resultaterne.b) | ou par envoi des échantillons à un laboratoire national de référence.
II.2.1.   qPCR for KHV detectionII.2.1.   qPCR til påvisning af KHVII.2.1.   qPCR pour la détection de l'HVK
The qPCR described as follows shall be used:Følgende qPCR skal anvendes:Le protocole de qPCR décrit ci-dessous doit être appliqué:
  | Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;  | Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′  | amorce sens (KHV-86f): 5′-GACGCCGGAGACCTTGTG-3′;
  | Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;  | Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′  | amorce antisens (KHV-163r): 5′-CGGGTTCTTATTTTTGTCCTTGTT-3′
  | and probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.  | og probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.  | et sonde (KHV-109p): 5′-FAM-CTTCCTCTGCTCGGCGAGCACG-3′.
Cycling conditions: one cycle of 95 °C at 15 minutes, followed by 50 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds.Cyklusbetingelser: 1 cyklus ved 95 °C i 15 minutter efterfulgt af 50 cyklusser ved 94 °C i 15 sekunder og 60 °C i 60 sekunder.Succession de cycles: un cycle de 95 °C pendant 15 minutes, suivi de 50 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes.
The results of the qPCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or laboratory contamination. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.Resultaterne af qPCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre qPCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.Les résultats de la qPCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
II.2.2.   Conventional PCR for confirmation of KHV detectionII.2.2.   Konventionel PCR til bekræftelse af KHV-påvisningII.2.2.   PCR classique pour confirmer la détection de l'HVK
For confirmation of the presence of infection with KHV, the generic nested PCR described in the following Table 2.1 shall be used followed by sequencing of the amplified product.Til bekræftelse af forekomst af infektion med KHV skal den generiske nested PCR, som er beskrevet i tabel 2.1, anvendes efterfulgt af sekventering af det amplificerede produkt.Pour confirmer la présence d'une infection par l'HVK, le protocole générique de PCR nichée décrit dans le tableau 2.1 ci-dessous doit être utilisé, suivi d'un séquençage du produit d'amplification.
Table 2.1Tabel 2.1Tableau 2.1
Primers and conditions for the nested PCR assay targeting all cyprinid herpesviruses (CyHV-1, CyHV-2 and CyHV-3)Primere og betingelser for nested PCR-analysen, der er målrettet alle cyprinidherpesvirus (CyHV-1, CyHV-2 og CyHV-3)Amorces et conditions pour le protocole de PCR nichée ciblant tous les herpèsvirus des cyprinidés (CyHV-1, CyHV-2 et CyHV-3)
Primer name | Sequence | Cycling conditions | Product sizePrimernavn | Sekvens | Cyklusbetingelser | ProduktstørrelseNom de l'amorce | Séquence | Succession de cycles | Taille du produit
CyHVpol-forward | 5′-CCAGCAACATGTGCGACGG-3′ | First round PCR | 1 cycle: | 95 °C 2 minutes | 40 cycles: |   | 95 °C for 30 seconds |   | 55 °C for 30 seconds |   | 72 °C for 45 seconds | 1 cycle: | 72 °C for 10 minutes | 362 bpCyHVpol-forward | 5′-CCAGCAACATGTGCGACGG-3′ | Første runde PCR | 1 cyklus: | 95 °C i 2 minutter | 40 cyklusser: |   | 95 °C i 30 sekunder |   | 55 °C i 30 sekunder |   | 72 °C i 45 sekunder | 1 cyklus: | 72 °C i 10 minutter. | 362 bpCyHVpol-sens | 5′-CCAGCAACATGTGCGACGG-3′ | Première phase de PCR | 1 cycle: | 95 °C pendant 2 minutes | 40 cycles: |   | 95 °C pendant 30 secondes |   | 55 °C pendant 30 secondes |   | 72 °C pendant 45 secondes | 1 cycle: | 72 °C pendant 10 minutes. | 362 pb
CyHVpol-reverse | 5′-CCGTARTGAGAGTTGGCGCA-3′CyHVpol-reverse | 5′-CCGTARTGAGAGTTGGCGCA-3′CyHVpol-antisens | 5′-CCGTARTGAGAGTTGGCGCA-3′
CyHVpol-internal forward | 5′-CGACGGVGGYATCAGCCC-3′ | Second round PCR | 1 cycle: | 95 °C 2 minutes, | 40 cycles: |   | 95 °C for 30 seconds |   | 55 °C for 30 seconds |   | 72 °C for 45 seconds | 1 cycle: | 72 °C for 10 minutes | 339 bpCyHVpol-internal forward | 5′-CGACGGVGGYATCAGCCC-3′ | Anden runde PCR | 1 cyklus: | 95 °C i 2 minutter | 40 cyklusser: |   | 95 °C i 30 sekunder |   | 55 °C i 30 sekunder |   | 72 °C i 45 sekunder | 1 cyklus: | 72 °C i 10 minutter | 339 bpCyHVpol-interne sens | 5′-CGACGGVGGYATCAGCCC-3′ | Deuxième phase de PCR | 1 cycle: | 95 °C pendant 2 minutes | 40 cycles: |   | 95 °C pendant 30 secondes |   | 55 °C pendant 30 secondes |   | 72 °C pendant 45 secondes | 1 cycle: | 72 °C pendant 10 minutes. | 339 pb
CyHVpol-internal reverse | 5′-GAGTTGGCGCAYACYTTCATC-3′CyHVpol-internal reverse | 5′-GAGTTGGCGCAYACYTTCATC-3′CyHVpol-interne antisens | 5′-GAGTTGGCGCAYACYTTCATC-3′
The results of the PCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or laboratory contamination. Negative template controls and positive controls shall be included on each plate run. PCR versions of proven similar efficacy may be used instead.Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. PCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. D'autres versions de PCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
Sequencing may be performed by the laboratory or at external specialised sequencing companies. Sequencing results shall be analysed by aligning the sequences to the known reference sequences of KHV (Gen Bank accession numbers AP008984, DQ657948 and DQ177346). The obtained clean consensus sequence must match at least to 98 % with those reference sequences.Sekventering kan foretages af laboratoriet eller hos eksterne specialiserede sekventeringsvirksomheder. Sekventeringsresultaterne skal analyseres ved at sammenligne sekvenserne med kendte referencesekvenser af KHV (GenBank, stammesamlingsnummer AP008984, DQ657948 og DQ177346). Der skal mindst være 98 % match mellem den opnåede rene konsensussekvens og disse referencesekvenserLe séquençage peut être effectué par le laboratoire ou confié à des sociétés extérieures spécialisées. Les résultats du séquençage doivent être analysés en comparant les séquences aux séquences de référence connues de l'HVK (numéros d'accès à GenBank AP008984, DQ657948 et DQ177346). La séquence consensus obtenue doit coïncider à 98 % au moins avec ces séquences de référence.
PART 3DEL 3PARTIE 3
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR THE SURVEILLANCE AND CONFIRMATION OF INFECTIOUS SALMON ANEMIA (ISA)DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTIØS LAKSEANÆMI (ISA)MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'ANÉMIE INFECTIEUSE DU SAUMON (AIS)
I.   Sampling procedures for the surveillance and control of ISAI.   Prøveudtagningsprocedurer for overvågning og bekæmpelse af ISAI.   Procédures d'échantillonnage pour la surveillance de l'AIS et la lutte contre cette maladie
When sampling and laboratory examination are carried out, for the purpose of the surveillance or eradication programmes set out in Part 3 of Annex I or to confirm or rule out the presence of ISA in accordance with Article 57(b) of Directive 2006/88/EC, the detailed methods and procedures set out in points I.1, I.2 and I.3 of this Section shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på overvågnings- eller udryddelsesprogrammerne i bilag I, del 3, eller for at bekræfte eller udelukke forekomst af ISA i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF, anvendes de detaljerede metoder og procedurer i punkt I.1, I.2 og I.3.Lors du prélèvement d'échantillons et des examens de laboratoire réalisés aux fins des programmes de surveillance ou d'éradication décrits à l'annexe I, partie 3, ou en vue de confirmer la présence de l'AIS ou d'écarter une suspicion d'AIS conformément à l'article 57, point b), de la directive 2006/88/CE, les méthodes et procédures détaillées établies aux points I.1, I.2 et I.3 de la présente section doivent être appliquées.
I.1.   Preparation of samples from fishI.1.   Præparation af fiskeprøverI.1.   Préparation des échantillons de poisson
For the purpose of laboratory examination for the presence of ISA, fish samples shall not be pooled where possible. However, for the purpose of surveillance for ISA, the pooling of 2 to be 5 fish is accepted.Fiskeprøver til laboratorieundersøgelser for forekomst af ISA må, hvis muligt, ikke samles. I forbindelse med overvågning af ISA må 2-5 fisk dog gerne samles i en prøve.Aux fins des examens de laboratoire visant à détecter un foyer d'AIS, les échantillons de poisson ne doivent pas être regroupés, dans la mesure du possible. Toutefois, aux fins de la surveillance de l'AIS, le regroupement de 2 à 5 poissons est acceptable.
Samples for Reverse Transcriptase polymerase chain reaction (RT-PCR) analysis shall be taken from all of the fish sampled. A piece of mid-kidney shall be removed from the fish using a sterile instrument and transferred to a microfuge tube containing one ml RNA preservative solution of proven efficacy. Tissue from up to five fish may be collected in one tube of transport solution and shall represent one pooled sample. The weight of tissue in one sample shall be 0,5 g. When the fish are too small to obtain a sample of the required weight, pieces of kidney, heart, spleen, liver or pyloric caeca may be taken, in that order of preference, to make up 0,5 g.Prøver til revers transkriptase-polymerasekædereaktion (RT-PCR) skal udtages af alle de af prøven omfattede fisk. Et stykke af mellemnyren fjernes fra fisken med et sterilt instrument og overføres til et mikrocentrifugeglas med 1 ml RNA-konserveringsvæske af dokumenteret effektivitet. Væv fra op til fem fisk kan samles i et rør med transportopløsning og udgøre en samleprøve. Vægten af vævet i en prøve skal være 0,5 g. Hvis fisken er for lille til, at der kan opnås en prøve af den krævede vægt, kan der tages stykker af nyre, hjerte, milt, lever eller blindtarm i nævnte rækkefølge, indtil der opnås 0,5 g.Des échantillons destinés à l'analyse par amplification en chaîne par polymérase en présence d'une transcriptase inverse (RT-PCR) doivent être prélevés sur tous les poissons présents dans l'échantillon. Un morceau de rein médian doit être prélevé sur chaque poisson à l'aide d'un instrument stérile et transféré dans un microtube de centrifugation contenant 1 ml de solution de conservation de l'ARN d'efficacité avérée. Les tissus de cinq poissons au maximum peuvent être regroupés dans un tube de solution de transport pour constituer un échantillon global. Le poids de tissu d'un échantillon doit être de 0,5 g. Quand les poissons sont trop petits pour constituer un échantillon pesant le poids requis, il est possible d'ajouter, par ordre de préférence, des morceaux de rein, de cœur, de rate, de foie ou de cæcum pylorique pour atteindre 0,5 g.
Tissue for histological examination shall only be taken from freshly killed fish with a normal constitution, exhibiting clinical signs or post-mortem findings consistent with the presence of ISA. Any external or internal lesions shall be sampled and in any case samples of mid-kidney, heart, liver, pancreas, gut, gills and spleen shall be removed from individual fish using a scalpel and transferred to 8 % to 10 % (vol:vol) buffered formol saline. The ratio of fixative to tissue shall be at least 20:1 to ensure satisfactory preservation of the tissues. For immunohistochemistry (IHC), samples from mid-kidney and heart shall be taken.Prøver til histologisk undersøgelse må kun udtages fra nyligt aflivede fisk med normal konstitution, der udviser kliniske tegn eller tegn ved obduktion, som tyder på forekomst af ISA. Alle ydre eller indre læsioner skal medtages i prøven, og der skal under alle omstændigheder udtages prøver af mellemnyre, hjerte, lever, bugspytkirtel, tarm, gæller og milt, som fjernes fra de enkelte fisk ved hjælp af en skalpel og overføres til en 8-10 % (v/v) bufferet formaldehyd/saltopløsning. Forholdet mellem fikseringsvæske og væv skal mindst være 20:1 for at sikre en tilfredsstillende konservering af vævet. Til immunhistokemi (IHC) skal der udtages prøver fra mellemnyre og hjerte.Les tissus destinés à l'examen histologique doivent être prélevés uniquement sur des poissons fraîchement sacrifiés de constitution normale, sur des poissons présentant des signes cliniques compatibles avec l'AIS ou sur des poissons ayant fait l'objet de constatations post-mortem compatibles avec la présence de l'AIS. Toute lésion externe ou interne constatée doit donner lieu au prélèvement de l'individu concerné, et dans tous les cas, des échantillons de rein médian, de cœur, de foie, de pancréas, d'intestin, de branchies et de rate doivent être prélevés sur chaque poisson à l'aide d'un scalpel et transférés dans une solution saline tamponnée de formol à 8-10 % (v/v). Le rapport entre le fixateur et les tissus doit être d'au moins 20:1 pour garantir une conservation satisfaisante des tissus. En vue d'une analyse immunohistochimique (IHC), des échantillons de rein médian et de cœur doivent être prélevés.
Tissues for virological examination on cell culture shall be taken from all of the fish sampled. Pieces of the liver, anterior or mid-kidney, heart and spleen shall be removed from the fish using a sterile instrument and transferred to plastic tubes containing 9 ml transport medium. Tissues from up to five fish may be collected in one tube containing transport solution and represent one pooled sample. The weight of tissue in one sample shall be 1,0 ± 0,5 g.Til virologisk undersøgelse i cellekultur udtages der væv af alle de af prøven omfattede fisk. Stykker af lever, for- eller mellemnyre, hjerte og milt fjernes fra fisken med et sterilt instrument og overføres til plastrør med 9 ml transportmedium. Væv fra op til fem fisk kan samles i et rør med transportopløsning og udgøre en samleprøve. Vægten af vævet i en prøve skal være 1,0 ± 0,5 g.Les tissus destinés à l'examen virologique sur culture cellulaire doivent être prélevés sur tous les poissons présents dans les échantillons. Des morceaux de foie, de rein antérieur ou médian, de cœur et de rate doivent être prélevés sur les poissons à l'aide d'un instrument stérile et transférés dans des tubes en plastique contenant 9 ml de milieu de transport. Des tissus prélevés sur cinq poissons au maximum peuvent être rassemblés dans un tube contenant une solution de transport pour constituer un échantillon global. Le poids de tissu d'un échantillon doit être de 1,0 ± 0,5 g.
I.2.   Shipment of samples from fishI.2.   Forsendelse af fiskeprøverI.2.   Expédition des échantillons de poissons
Whole fish may be transported to the laboratory if the temperature requirements during transportation, as described in paragraph 3 of this point can be fulfilled. Whole fish shall be wrapped in absorbent paper and shipped in a plastic bag, chilled as described in that paragraph.Hele fisk kan transporteres til laboratoriet, hvis de i tredje afsnit i dette punkt beskrevne krav til transporttemperaturen kan overholdes. Hele fisk skal indpakkes i absorberende papir og sendes i en plastpose, der køles som beskrevet i nævnte afsnit.Des poissons entiers peuvent être envoyés au laboratoire si les conditions de température pendant le transport qui sont décrites au paragraphe 3 du présent point peuvent être respectées. Les poissons entiers doivent être enveloppés dans du papier absorbant et expédiés dans un sac en plastique, réfrigéré comme indiqué dans ledit paragraphe.
Live fish may also be shipped, but only under the supervision of the National reference laboratory for fish diseases and taking into account the additional disinfection and biosecurity issues when transporting live fish.Der kan også sendes levende fisk, men kun under tilsyn af det nationale referencelaboratorium for fiskesygdomme, og idet der tages hensyn til de yderligere desinficerings- og biosikkerhedsaspekter i forbindelse med transport af levende fisk.Des poissons vivants peuvent également être expédiés, mais uniquement sous la supervision du laboratoire de référence national pour les maladies des poissons et compte tenu des règles supplémentaires de désinfection et de biosécurité applicables lors du transport de poissons vivants.
Blood samples and tubes containing fish tissues for virological examination or RT-PCR analysis shall be placed in insulated containers, such as thick-walled polystyrene boxes, together with sufficient ice or freeze blocks to ensure chilling of the samples during transportation to the laboratory. Freezing shall be avoided and ice must still be present in the transport box at receipt of the shipment or one or more of the ‘freeze blocks’ must still be partly or completely frozen. In exceptional circumstances, RT-PCR samples and samples for virological examination may be snap-frozen and transported to the laboratory at – 20 °C or below.Blodprøver og rør med fiskevæv til virologisk undersøgelse eller RT-PCR-analyse placeres i isolerede beholdere, f.eks. tykvæggede polystyren-kasser, sammen med tilstrækkeligt med is eller fryseblokke, så det sikres, at prøverne opbevares køligt under transporten til laboratoriet. Frysning skal undgås, og ved modtagelsen skal der stadig være is i transportbeholderen, eller en eller flere af fryseblokkene skal stadig være helt eller delvis frosset. Under ekstraordinære omstændigheder kan RT-PCR-prøver og prøver til virologisk undersøgelse lynfryses og transporteres til laboratoriet ved – 20 °C eller derunder.Les échantillons de sang et les tubes contenant les tissus de poisson destinés à l'examen virologique ou à l'analyse par RT-PCR doivent être placés dans des récipients isolés, tels que des boîtes en polystyrène à parois épaisses, contenant une quantité suffisante de glace ou de blocs réfrigérants pour garantir la réfrigération des échantillons pendant le transport vers le laboratoire. La congélation doit être évitée et le récipient de transport doit encore contenir de la glace lors de sa réception, ou bien un ou plusieurs des blocs réfrigérants doivent être encore partiellement ou totalement congelés. Exceptionnellement, les échantillons destinés à l'analyse par RT-PCR et ceux destinés à l'examen virologique peuvent être surgelés et transportés vers le laboratoire à une température inférieure ou égale à – 20 °C.
For RT-PCR analysis of tissues preserved in Ribonucleic acid(RNA)later, RNA extraction shall be carried out within the following time frames depending on the temperature the samples are stored at:Til RT-PCR-analyse af væv konserveret i ribonukleinsyre(RNA)later skal RNA-ekstraktion foretages inden for følgende tidsfrister afhængigt af den temperatur, som prøverne opbevares ved:Pour l'analyse l'ultérieure par RT-PCR de tissus conservés dans du réactif de stabilisation de l'ARN (RNAlater), l'extraction de l'ARN doit être réalisée dans les délais indiqués ci-dessous, en fonction de la température de stockage des échantillons:
  | samples stored at 37 °C: 1 day;  | prøver opbevaret ved 37 °C: en dag  | échantillons stockés à 37 °C: dans un délai d'un jour;
  | samples stored at 25 °C: 1 week;  | prøver opbevaret ved 25 °C: en uge  | échantillons stockés à 25 °C: dans un délai d'une semaine;
  | samples stored at 4 °C: 1 month;  | prøver opbevaret ved 4 °C: en måned  | échantillons stockés à 4 °C: dans un délai d'un mois;
  | samples stored at – 20 °C: indefinitely.  | prøver opbevaret ved – 20 °C: tidsubegrænset.  | échantillons stockés à – 20 °C: délai indéterminé.
If fish tissues are transported in fixative for histological examination, they shall be shipped in leak proof tubes in impact-resistant containers. Freezing of those samples shall be avoided.Hvis fiskevæv transporteres i fikseringsvæske til histologisk undersøgelse, skal det forsendes i lækagesikre rør i stødsikre beholdere. Nedfrysning af disse prøver skal undgås.Si les tissus de poisson sont transportés dans du fixateur pour examen histologique, ils doivent être expédiés dans des tubes étanches placés dans des récipients résistant aux chocs. Il y a toutefois lieu d'éviter la congélation de ces échantillons.
The virological examination on cell culture shall be started as soon as possible and no later than 48 hours after the collection of the samples. In exceptional cases, the virological examination may be started at the latest within 72 hours after the collection of the material, provided that the material to be examined is protected by a transport medium and that the temperature requirements during transportation can be fulfilled.Den virologiske undersøgelse i cellekultur skal påbegyndes hurtigst muligt og senest 48 timer efter prøveudtagningen. I undtagelsestilfælde kan den virologiske undersøgelse påbegyndes senest 72 timer efter indsamlingen af materialet, hvis materialet er beskyttet af transportmedium, og kravene til transporttemperaturen kan overholdes.L'examen virologique sur culture cellulaire doit commencer dès que possible et au plus tard 48 heures après le prélèvement des échantillons. Dans des cas exceptionnels, l'examen virologique peut commencer au plus tard 72 heures après la collecte du matériel à examiner à condition que celui-ci soit conservé dans le milieu de transport et que les conditions de température requises pendant le transport aient pu être respectées.
I.3.   Collection of supplementary diagnostic materialI.3.   Indsamling af supplerende diagnostisk materialeI.3.   Collecte de matériel de diagnostic supplémentaire
Subject to the approval of the diagnostic laboratory, fish tissues other than those referred to in point I.1 may be collected and prepared for supplementary examination.Under forudsætning af det diagnostiske laboratoriums godkendelse kan andet fiskevæv end det i punkt I.1 omhandlede indsamles og præpareres til supplerende undersøgelser.Sous réserve de l'approbation du laboratoire de diagnostic, des tissus de poisson autres que ceux visés au point I.1 peuvent être collectés et préparés en vue d'un examen supplémentaire.
II.   Detailed diagnostic methods and procedures for the surveillance and for the confirmation of the presence of or to rule out the suspicion of ISAII.   Detaljerede diagnosemetoder og -procedurer for overvågning af og for at bekræfte forekomst af eller for at udelukke mistanke om ISAII.   Méthodes et procédures de diagnostic détaillées pour la surveillance de l'AIS et pour confirmer la présence de l'AIS ou écarter une suspicion de cette maladie
When laboratory examination for the purpose of obtaining or maintaining a certain health status with regard to ISA as set out in Section I of Part 3 of Annex I, or for the purpose of the confirmation of the presence of or to rule out a suspicion of ISA in accordance with Article 57(b) of Directive 2006/88/EC, are carried out, using the diagnostic methods set out in Section II of Part 3 of Annex I, the detailed methods and procedures set out in the following points II.1 to II.5 shall apply.Hvis der foretages laboratorieundersøgelser for at opnå eller opretholde en bestemt sundhedsstatus med hensyn til ISA, jf. bilag I, del 3, afsnit I, eller for at bekræfte forekomst af eller udelukke mistanke om ISA i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 3, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt II.1-II.5 nedenfor.Lorsque des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne l'AIS comme indiqué à l'annexe I, partie 3, section I, ou afin de confirmer la présence de l'AIS ou d'écarter une suspicion d'AIS conformément à l'article 57, point b), de la directive 2006/88/CE à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 3, section II, les méthodes et procédures détaillées figurant aux points II.1 à II.5 ci-après doivent être appliquées.
II.1.   Examination of samples by RT-PCRII.1.   Undersøgelse af prøver ved hjælp af RT-PCRII.1.   Examen des échantillons par RT-PCR
The diagnostic method to be used for the screening for ISAV shall be RT-qPCR. As the results of the RT-qPCR can vary depending on the conditions under which it is performed, adequate positive and negative controls and amplicons shall be included to avoid any doubts.Den diagnosemetode, der skal anvendes til screening for ISAV, skal være RT-qPCR. Da resultaterne af RT-qPCR kan variere afhængigt af de betingelser, den foretages under, skal der anvendes passende negative og positive kontroller samt amplikon for at undgå enhver tvivl.La méthode de diagnostic à utiliser pour la détection du VAIS est la RT-qPCR. Étant donné que les résultats de la RT-pPCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, il y a lieu de prévoir des témoins positifs et négatifs et des amplicons adéquats afin de dissiper tout doute.
II.1.1.   Total RNA extractionII.1.1.   Total RNA-ekstraktionII.1.1.   Extraction de l'ARN total
All work with RNA shall be performed on ice, using gloves.Alt arbejde med RNA skal udføres på is, og der skal anvendes handsker.Toutes les manipulations sur l'ARN doivent être réalisées sur de la glace, et des gants doivent être utilisés.
Total RNA shall be extracted using the phenol-chloroform method or RNA affinity spin columns, according to the manufacturer's instructions.RNA ekstraheres efter phenolchloroformmetoden eller med kolonner til oprensning af RNA i henhold til fabrikantens anvisninger.L'ARN total doit être extrait par la méthode phénol/chloroforme ou par chromatographie d'affinité sur colonnes, selon les instructions du fabricant.
Purified RNA shall be re-suspended in distilled RNase-free water (namely water treated with 0,1 % diethyl pyrocarbonate).RNA skal genopslæmmes i destilleret RNAse-frit vand (dvs. vand, der er behandlet med 0,1 % diethylpyrocarbonat).L'ARN purifié doit être remis en suspension dans de l'eau distillée exempte d'ARNase (c.-à-d. de l'eau traitée avec du pyrocarbonate de diéthyle à 0,1 %).
The concentration and purity of the extracted RNA shall be estimated by measuring the optical density at 260 nm and at 280 nm. An alternative approach may be to include internal controls targeted against the virus genome as referred to in point II.1.3.Det ekstraherede DNA's koncentration og renhed skal bestemmes ved at måle den optiske densitet ved 260 nm og ved 280 nm. En alternativ fremgangsmåde kan være at inkludere interne kontroller, der er målrettet virusgenomet, jf. punkt II.1.3.La concentration et la pureté de l'ARN extrait doivent être évaluées en mesurant la densité optique à 260 nm et à 280 nm. Il est également possible d'inclure des témoins internes ciblés contre le génome viral comme indiqué au point II.1.3.
II.1.2.   RT-PCR for ISAV detectionII.1.2.   RT-PCR til ISAV-påvisningII.1.2.   RT-PCR pour la détection du VAIS
Several RT-PCR methods may be used for ISAV genome amplification. A two-step RT-PCR may be performed whereby the RT and the PCR reactions steps are run in two separate tubes. However, a one-step reaction, where the two reactions are run in one tube, may also be performed. The one-step method shall be used where possible, as the one tube assay minimises the risk of cross-contamination as no transfer of content have to be made and it is regarded to be as sensitive as the two-step method.Der kan anvendes flere RT-PCR-metoder til ISAV-genomamplificering. Der kan foretages en totrins-RT-PCR, hvor RT- og PCR-reaktionstrinnene køres i to separate rør. Der kan dog også foretages en ettrins-reaktion, hvor de to reaktioner køres i ét rør. Hvor det er muligt, skal ettrins-metoden anvendes, da risikoen for krydskontaminering mindskes, idet indholdet ikke skal overføres, og denne metode anses for at være lige så sensitiv som totrins-metoden.Plusieurs méthodes de RT-PCR peuvent être utilisées pour l'amplification du génome du VAIS. Il est possible de procéder à une RT-PCR en deux étapes en réalisant les réactions de RT et de PCR dans deux tubes distincts. Toutefois, une réaction en une seule étape, dans laquelle les deux réactions sont réalisées dans un seul tube, est également possible. La méthode en une étape doit être privilégiée dans la mesure du possible car le tube unique réduit au minimum le risque de contamination croisée, puisque tout transfert de contenu est évité; de surcroît, cette méthode est considérée comme étant aussi sensible que la méthode en deux étapes.
The primers and assay described in this point, namely the ILA1 or ILA2 primer pair that target segment 8 and which have been found suitable for detection of ISAV in outbreaks and in carrier fish, shall be used. The ILA2 reverse primer does not match isolates from North America and an alternative primer set shall be used in those cases.Der skal anvendes de primere og analyser, der er beskrevet i dette punkt, dvs. primerparret ILA1 eller ILA2, der er målrettet segment 8, og som er fundet egnet til påvisning af ISAV ved udbrud og hos fisk, der er bærere. Den reverse primer ILA2 matcher ikke isolater fra Nordamerika, og der skal i sådanne tilfælde anvendes et alternativt primersæt.Il y a lieu d'utiliser les amorces et le protocole décrit dans le présent point, à savoir la paire d'amorces ILA1 ou ILA2 qui ciblent le segment 8 et qui ont été jugées adéquates pour la détection du VAIS dans des foyers d'infection ainsi que dans les poissons vecteurs. L'amorce antisens ILA2 ne convient pas pour les isolats provenant d'Amérique du Nord et une autre série d'amorces doit être utilisée dans ces cas.
  | Forward primer (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′;  | Forward primer (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′  | Amorce sens (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′;
  | Reverse primer (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.  | Reverse primer (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.  | amorce antisens (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.
Cycling conditions: one cycle of 50 °C for 30 minutes, 1 cycle of 94 °C for 15 minutes, 40 cycles of 94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for 60 seconds; one cycle of 72 °C for 5 min. Product size 155 bp.Cyklusbetingelser: 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 94 °C i 15 minutter, 40 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 72 °C i 60 sekunder; 1 cyklus ved 72 °C i 5 minutter. Produktstørrelse: 155 bp.Succession de cycles: un cycle de 50 °C pendant 30 minutes, 1 cycle de 94 °C pendant 15 minutes, 40 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 72 °C pendant 60 secondes; un cycle de 72 °C pendant 5 minutes. Taille du produit: 155 pb.
The results of the PCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or laboratory contamination. Negative template controls and positive controls shall be included on each plate run. However, other RT-PCR versions of proven similar efficacy may be used instead.Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre RT-PCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.Les résultats de la PCR peuvent varier en fonction des conditions dans lesquelles la technique est réalisée, c'est-à-dire qu'une optimisation des protocoles thermiques pourrait s'avérer nécessaire en fonction du thermocycleur utilisé. Par ailleurs, des faux-positifs sont possibles à la suite d'erreurs d'hybridation des amorces ou d'une contamination au laboratoire. À chaque «run» de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Cependant, d'autres versions de RT-PCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
II.1.3.   RT-qPCR for ISAV detectionII.1.3.   RT-qPCR til ISAV-påvisningII.1.3.   RT-qPCR pour la détection du VAIS
The use of RT-qPCR may increase specificity and probably also sensitivity. The method can be performed more rapidly as no gel electrophoresis step is required and it reduces the risk of cross contamination as it is possible to estimate the amount of viral genomic RNA within the sample tube. A drawback of the RT-qPCR assay is that it is often not possible to sequence amplified products. However, if there is doubt on the specificity of the amplified product, another ISAV specific assay must be run to verify the result.Anvendelsen af RT-qPCR kan øge specificiteten og muligvis også sensitiviteten. Metoden kan udføres hurtigere, da der ikke kræves gelelektroforese, og den mindsker risikoen for krydskontaminering, da det er muligt at estimere mængden af viralt genomisk RNA i prøverøret. En ulempe ved RT-qPCR-analyse er, at det ofte ikke er muligt at sekventere de amplificerede produkter. Hersker der imidlertid tvivl om det amplificerede produkts specificitet, skal der køres en anden ISAV-specifik analyse for at verificere resultatet.Le recours à la RT-qPCR peut accroître la spécificité et sans doute aussi la sensibilité. La méthode peut être réalisée plus rapidement car il n'y a pas d'étape d'électrophorèse sur gel, et le risque de contamination croisée est réduit puisqu'il est possible d'estimer la quantité d'ARN génomique viral dans le tube à essai. Un des inconvénients de l'essai par RT-qPCR est qu'il n'est souvent pas possible de séquencer les produits d'amplification. Toutefois, en cas de doute sur la spécificité du produit d'amplification, un autre essai spécifique du VAIS doit être effectué pour vérifier le résultat.
The assay described in this point, which is an assay that target segment 8, shall be used. This assay shall cover isolates from the European Union, the European Free Trade Association and North America. The one-step method shall be used where possible, because the one tube assay minimises the risk of cross-contamination.Den i dette punkt beskrevne analyse, som er en analyse, der er målrettet segment 8, skal anvendes. Denne analyse skal omfatte isolater fra Den Europæiske Union, Den Europæiske Frihandelssammenslutning og Nordamerika. Hvor det er muligt, skal ettrins-metoden anvendes, da metoden med ét rør mindsker risikoen for krydskontaminering.Il y a lieu de recourir à l'essai décrit au présent point, qui cible le segment 8. Cet essai doit être valable pour les isolats provenant de pays de l'Union européenne, de l'Association européenne de libre-échange et d'Amérique du Nord. La méthode en une étape doit être utilisée dans la mesure du possible car l'essai réalisé dans un seul tube réduit le risque de contamination croisée.
  | Forward primer: 5′- CTACACAGCAGGATGCAGATGT -3′;  | Forward primer: 5′- CTACACAGCAGGATGCAGATGT -3′  | Amorce sens: 5′-CTACACAGCAGGATGCAGATGT-3′;
  | Reverse primer: 5′- CAGGATGCCGGAAGTCGAT -3′;  | Reverse primer: 5′- CAGGATGCCGGAAGTCGAT -3′  | amorce antisens: 5′-CAGGATGCCGGAAGTCGAT-3′
  | and probe: 5′-FAM- CATCGTCGCTGCAGTTC – MGBNFQ-3′.  | og probe: 5′-FAM- CATCGTCGCTGCAGTTC — MGBNFQ-3′.  | et sonde: 5′-FAM-CATCGTCGCTGCAGTTC–MGBNFQ-3′.
Negative template controls and positive controls shall be included on each plate run. Cycling conditions: one cycle of 50 °C for 30 minutes, one cycle of 95 °C for 15 minutes, 40 cycles of 94 °C for 15 seconds, 60 °C for 60 seconds; it shall be adjusted if necessary. Other RT-PCR or RT-qPCR versions of proven similar efficacy may be used instead.Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser: 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 95 °C i 15 minutter, 40 cyklusser ved 94 °C i 15 sekunder, 60 °C i 60 sekunder; justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.À chaque série d'épreuves de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles: un cycle de 50 °C pendant 30 minutes, un cycle de 95 °C pendant 15 minutes, 40 cycles de 94 °C pendant 15 secondes et 60 °C pendant 60 secondes, à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
II.1.4.   Sequencing of amplified PCR productsII.1.4.   Sekventering af amplificerede PCR-produkterII.1.4.   Séquençage des produits d'amplification de la PCR
  | Forward primer (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA -3′;  | Forward primer (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA -3′  | Amorce sens (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA-3′;
  | Reverse primer (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA -3′.  | Reverse primer (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA -3′.  | amorce antisens (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA-3′.
Negative template controls and positive controls shall be included on each plate run. Cycling conditions (One-step RT-PCR): one cycle of 50 °C for 30 minutes, one cycle of 94 °C for 15 minutes, 40 cycles of 94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for 60 seconds, one cycle of 72 °C for 5 minutes; it shall be adjusted if necessary. Other RT-PCR or RT-qPCR versions of proven similar efficacy may be used instead.Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser (ettrins-RT-PCR): 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 94 °C i 15 minutter, 40 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 72 °C i 60 sekunder, 1 cyklus ved 72° i 5 minutter; justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.À chaque série d'épreuves de RT-qPCR, des témoins positifs et négatifs doivent être inclus sur la plaque. Succession de cycles (RT-PCR en une étape): un cycle de 50 °C pendant 30 minutes, un cycle de 94 °C pendant 15 minutes, 40 cycles de 94 °C pendant 30 secondes, 55 °C pendant 30 secondes et 72 °C pendant 60 secondes, un cycle de 72 °C pendant 5 minutes; à adapter si nécessaire. D'autres versions de RT-PCR ou de RT-qPCR présentant une efficacité similaire avérée peuvent aussi être utilisées.
Alternatively, the following method for sequencing HPR in segment 6 may be used:Alternativt kan følgende metode til sekventering af HPR i segment 6 anvendes:La méthode ci-après peut aussi être utilisée pour le séquençage de la RHP dans le segment 6:
  | Forward primer: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′;  | Forward primer: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′  | Amorce sens: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′;
  | Reverse primer: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′;  | Reverse primer: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′  | amorce antisens: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′;
  | Product size: 304 nt if HPR0.  | Produktstørrelse: 304 nt hvis HPR0.  | taille du produit: 304 nt si HPR0.
RT-PCR assays with similar sensitivities and specificities to the assays described in this point may also be used.RT-PCR-analyser med samme sensitivitet og specificitet som den analyse, der er beskrevet i dette punkt, kan også anvendes.Il est aussi possible de recourir à des essais par RT-PCR de sensibilité et de spécificité similaires à celles des essais décrits dans le présent point.
The purity of the amplified RT-PCR product shall be checked by gel electrophoresis before sequencing. If only one pure fragment appears, it shall be purified directly from the PCR reaction. If multiple amplified fragments are present, the fragment of interest shall be purified by gel electrophoresis. The purification of PCR fragments from solutions or agarose gels shall be made using PCR fragment affinity spin columns, according to the manufacturer's instructions.Det amplificerede RT-PCR-produkts renhed skal kontrolleres ved gelelektroforese inden sekventering. Hvis der kun forekommer ét rent fragment, skal det renses direkte fra PCR-reaktionen. Hvis der forekommer flere amplificerede fragmenter, skal det relevante fragment renses ved gelelektroforese. PCR-fragmenterne skal renses for opløsninger eller agarosegeler ved hjælp af kolonner til oprensning af PCR-fragmenter i henhold til fabrikantens anvisninger.La pureté du produit d'amplification par RT-PCR doit être vérifiée par électrophorèse sur gel avant le séquençage. Si un seul fragment pur apparaît, il doit être purifié directement à partir de la réaction de PCR. Si plusieurs fragments amplifiés sont présents, le fragment d'intérêt doit être purifié par électrophorèse sur gel. La purification des fragments amplifiés à partir de solutions ou de gels d'agarose doit être réalisée à l'aide de colonnes de chromatographie d'affinité pour fragments de PCR conformément aux instructions du fabricant.
Sequencing shall be performed using amplification primers at external specialised sequencing companies. The results shall be analysed with the search tool BLAST and the sequences shall be compared with other known sequences in the US National Centre for Biotechnical Information (NCBI) nucleotide database.Sekventering skal foretages med amplificeringsprimere hos eksterne specialiserede sekventeringsvirksomheder. Sekventeringsresultaterne skal analyseres ved hjælp af søgeværktøjet BLAST, og sekvenserne skal sammenlignes med andre kendte sekvenser i nucleotiddatabasen i det amerikanske »National Centre for Biotechnical Information« (NCBI).Le séquençage doit être réalisé à l'aide des amorces d'amplification par des sociétés de séquençage spécialisées extérieures. Les résultats du séquençage doivent être analysés à l'aide de l'outil de recherche BLAST, et les séquences comparées à d'autres séquences connues se trouvant dans la base de données des nucléotides du Centre national d'informations biotechnologiques des États-Unis (NCBI).
Sequencing must eliminate any doubt on the specificity of an amplified RT-PCR product.Sekventering skal fjerne al tvivl om et amplificeret RT-PCR-produkts specificitet.Le séquençage doit permettre de dissiper tout doute quant à la spécificité d'un produit amplifié par RT-PCR.
II.2.   ISAV isolation on cell culturesII.2.   ISAV-isolation i cellekulturerII.2.   Isolement du VAIS en culture cellulaire
II.2.1.   Preparation of samplesII.2.1.   Præparation af prøverII.2.1.   Préparation des échantillons
The tissue may be kept at – 80 °C. The tissue shall only be frozen and thawed once before examination. For surveillance and control purposes, the examination shall be undertaken as fast as possible.Vævet kan opbevares ved – 80 °C. Vævet må kun fryses og optøs én gang, inden det undersøges. I forbindelse med overvågning og kontrol skal undersøgelsen foretages så hurtigt som muligt.Les tissus peuvent être conservés à – 80 °C. Ils ne doivent être congelés et décongelés qu'une fois avant examen. Aux fins de la surveillance et des mesures de lutte, l'examen doit être entrepris aussi rapidement que possible.
Each sample (tissue pool in transport solution) shall be completely homogenised using a validated homogeniser, centrifuged at 2 000 to 4 000 × g for 15 minutes at 0 to 6 °C, and the supernatant shall be filtered (0,45 μm) and incubated with an equal volume of a suitably diluted pool of antisera to the indigenous serotypes of IPNV. The titre of the antiserum must be at least 1:2 000 in a 50 % plaque neutralisation test. The mixture shall be incubated for one hour at 15 °C. This shall represent the inoculum.Hver prøve (samlet vævsprøve i transportvæske) skal homogeniseres fuldstændigt ved hjælp af en valideret homogenisator, centrifugeres ved 2 000 til 4 000 × g i 15 minutter ved 0-6 °C, og supernatanten skal filtreres (0,45 μm) og inkuberes med en tilsvarende mængde passende fortyndet blanding af antiserum mod de indigene serotyper af IPNV. Antiserumtiteren skal være mindst 1:2 000 i en 50 % pladeneutraliseringsprøve. Blandingen inkuberes i 1 time ved 15 °C. Derved opnås inokulummet.Chacun des échantillons (regroupement de tissus dans une solution de transport) doit être complètement homogénéisé à l'aide d'un homogénéisateur validé, puis centrifugé entre 2 000 et 4 000 g pendant 15 minutes à une température comprise entre 0 et 6 °C, et le surnageant doit être filtré (0,45 μm) et incubé avec un volume égal d'un ensemble de sérums anti-sérotypes indigènes du virus de la NPI dûment dilués. Le titre de l'antisérum doit être d'au moins 1:2 000 dans un test de neutralisation sur plaque à 50 %. Le mélange doit être incubé pendant une heure à 15 °C; il constitue l'inoculum.
Treatment of all inocula with antiserum to Infectious pancreatic necrosis virus (a virus which in some parts of the Europe occurs in 50 % of fish samples) aims at preventing cytopatic effect (CPE) due to IPN virus from developing in inoculated cell cultures. To reduce the duration of the virological examinations as well as the number of cases in which occurrence of CPE would have to be considered potentially indicative of ISAV, such treatment may be carried out. When samples come from production units which are considered free from IPN, the treatment of inocula with antiserum to IPN virus may be omitted.Formålet med at behandle alle inokula med antiserum mod IPN-virus (et virus, som i nogle dele af Europa forekommer i 50 % af alle fiskeprøver) er at hindre, at der udvikles cytopatisk effekt (CPE) som følge af IPN-virus i podede cellekulturer. En sådan behandling kan gennemføres for at nedsætte de virologiske undersøgelsers varighed og antallet af tilfælde, hvor forekomst af CPE ellers måtte opfattes som en potentiel indikation af ISAV. Når prøverne kommer fra produktionsenheder, der anses for at være frie for IPN, kan behandling af inokula med antiserum mod IPN-virus undlades.Le traitement de tous les inoculums par un sérum antivirus de la nécrose pancréatique infectieuse (virus qui, dans certaines régions d'Europe, est présent dans 50 % des échantillons de poissons) vise à empêcher l'apparition d'un effet cytopathogène (ECP) dû au virus NPI dans les cultures cellulaires inoculées. Ce traitement peut être effectué pour réduire la durée des examens virologiques ainsi que le nombre de cas où l'apparition d'un ECP devrait être considérée comme une manifestation possible du VAIS. Lorsque les échantillons proviennent d'unités de production considérées comme indemnes de la NPI, le traitement des inoculums par le sérum antivirus de la NPI peut être omis.
II.2.2.   Inoculation on cell culturesII.2.2.   Podning i cellekulturerII.2.2.   Inoculation des cultures cellulaires
Atlantic salmon kidney (ASK) cells shall be used for primary ISAV isolation. Other cell lines of proven efficacy and sensitivity in isolating ISAV may be used, taking into consideration strain variability and the ability of different strains to replicate in different cell lines. The ASK cells seem to support isolation and growth of the hitherto known virus isolates, as long as a low passage level is used. A more distinct cytopathic effect (CPE) may appear in ASK cells than in other susceptible cell lines like SHK-1 (Salmon head kidney-1).Atlantic salmon kidney-celler (ASK-celler) skal anvendes til primær ISAV-isolation. Andre cellelinjer af dokumenteret effektivitet og sensitivitet ved isolation af ISAV kan anvendes under hensyntagen til stammevariabilitet og de forskellige stammers evne til replikation i forskellige cellelinjer. ASK-cellerne synes at støtte isolation og vækst af de hidtil kendte virusisolater, så længe der anvendes et lavt passageniveau. Der kan forekomme en tydeligere cytopatisk effekt i ASK-celler end i andre modtagelige cellelinjer som f.eks. SHK-1 (Salmon Head Kidney-1).Des cellules de rein de saumon de l'Atlantique (ASK) doivent être utilisées pour l'isolement primaire du VAIS. D'autres lignées cellulaires dont l'efficacité et la sensibilité sont avérées pour l'isolement du VAIS peuvent être utilisées, compte tenu de la variabilité de la souche et de la capacité des différentes souches de se multiplier dans différentes lignées cellulaires. Les cellules ASK semblent supporter l'isolement et la croissance des isolats de virus connus à ce jour, tant que le nombre de passages est faible. Un effet cytopathogène (ECP) peut se manifester plus distinctement dans les cellules ASK que dans d'autres lignées cellulaires sensibles telles que SHK-1 (cellules de rein antérieur de saumon-1).
ASK (pass 65 or lower) cells shall be grown in L-15 medium containing 10 % foetal bovine serum, 2 % (vol:vol) 200 mM L-glutamine, and 0,08 % (vol:vol) 50 mM 2-mercaptoethanol in multi-well plates. Antiserum-treated organ suspension shall be inoculated into young actively growing cell cultures to give a final dilution of tissue material to culture medium of 1:1 000. For each organ, suspension 40 μl of inoculum shall be added to one well containing 2 ml of culture medium. To minimise the risk of cross-contamination, separate 12- or 24-well plates shall be used for samples from different fish farm sites.ASK-celler (passage 65 eller derunder) skal dyrkes i et L-15-medium indeholdende 10 % føtalt kvægserum, 2 % (v/v) 200 mM L-glutamin og 0,08 % (v/v) 50 mM 2-mercaptoethanol i multibrøndplader. Antiserumbehandlet organopslæmning podes på unge aktivt voksende cellekulturer, så der fremkommer en slutopløsning af vævsmateriale i dyrkningssubstrat på 1:1 000. For hvert organ tilsættes en opslæmning af 40 μl podemateriale til én brønd med 2 ml dyrkningsmedium. For at mindske risikoen for krydskontaminering skal der anvendes separate plader med 12 eller 24 brønde til prøver fra forskellige akvakulturbrug.Des cellules ASK (65 passages au maximum) doivent être cultivées dans un milieu L-15 contenant du sérum fœtal bovin à 10 %, 200 mM de L-glutamine à 2 % (v/v) et 50 mM de 2-mercaptoéthanol à 0,08 % (v/v) dans des plaques multipuits. Une suspension d'organes traitée par antisérum est inoculée à de jeunes cultures cellulaires en phase de croissance active de manière à obtenir une dilution finale du matériel tissulaire dans le milieu de culture de 1:1 000. Pour chaque organe, 40 μl de la suspension d'inoculum sont ajoutés dans un puits contenant 2 ml de milieu de culture. Afin de minimiser le risque de contamination croisée, on utilisera des plaques à 12 ou 24 puits distinctes pour les échantillons provenant de différentes exploitations piscicoles.
One plate shall be left uninoculated to serve as a negative control. A separate plate shall be inoculated with a reference isolate of ISAV as a positive control, as follows. One hundred μl of a stock preparation of ISAV (minimum titre 107 Tissue culture infective dose at the 50 % end point (TCID50 ml– 1)) shall be inoculated into the first well and mixed. A volume of this material shall be transferred from the first well to the second well to make a 1:10 dilution and mixed. This shall be repeated across the plate to make six 10-fold dilutions. Stock ISAV may be stored at – 80 °C for at least 2 years but once thawed must be used within 3 days. Care shall be taken to prevent cross-contamination of test plates with positive control material. To avoid that risk, positive controls shall be set up and handled separately from test plates. A sensitivity test every 6 months of ASK cells towards ISAV isolates may replace the use of including a positive control at each inoculation.En plade lades upodet, så den kan bruges som negativ kontrol. En separat plade til positiv kontrol podes med et referenceisolat af ISAV på følgende måde: 100 μl af et stampræparat af ISAV (minimumstiter 107 50 % Tissue Culture Infective Dose (TCID50 ml– 1)) podes i den første brønd og omrøres. En mængde af dette materiale overføres fra den første brønd til den anden brønd, så der opnås en fortynding på 1:10, og omrøres. Dette gentages hen over pladen, så der opnås seks ti-fold-fortyndinger. ISAV-stampræparatet kan opbevares ved – 80 °C i mindst to år, men når det er optøet, skal det anvendes i løbet af tre dage. Det skal forhindres, at prøvepladerne krydskontamineres med positivt kontrolmateriale. For at undgå denne risiko skal positive kontroller opstilles og behandles adskilt fra prøvepladerne. Hvis ASK-cellerne gennemgår en sensitivitetstest mod ISAV-isolater hver sjette måned, kan dette erstatte anvendelsen af en positiv kontrol ved hver podning.Il convient de conserver une plaque non inoculée qui servira de témoin négatif. Une autre plaque doit être inoculée avec un isolat de référence du VAIS, qui servira de témoin positif, comme suit: inoculer 100 μl d'une préparation mère du VAIS [titre minimal 107 Dose infectant 50 % de la culture tissulaire (DICT50 ml – 1)] dans le premier puits et mélanger. Transférer une fraction de ce matériel du premier puits dans le deuxième afin d'obtenir une dilution au 1:10, puis mélanger. Répéter l'opération sur toute la plaque pour obtenir six dilutions au 1:10. La préparation mère du VAIS peut être conservée à – 80 °C pendant au moins deux ans, mais une fois décongelée, elle doit être utilisée dans les trois jours. Des précautions doivent être prises pour éviter la contamination croisée des plaques d'essai par le témoin positif. Pour éviter ce risque, les témoins positifs doivent être constitués et traités séparément des plaques d'essai. Plutôt que de prévoir un témoin positif à chaque inoculation, il est possible de réaliser tous les six mois un essai de sensibilité des cellules d'ASK au VAIS.
Samples shall be incubated at 15 ± 2 °C for up to 15 days. Using a microscope, cell cultures shall be examined for CPE twice, between 5 to 7 and 12 to 14 days following inoculation. If any pool shows CPE, virus identification procedures shall be initiated immediately in accordance with point II.2.4. If no CPE is observed by day 14, an Indirect fluorescent antibody test (IFAT), haemadsorption or RT-PCR shall be performed.Prøverne inkuberes ved 15 ± 2 °C i op til 15 dage. Cellekulturerne skal ved hjælp af et mikroskop undersøges for CPE to gange, nemlig 5-7 dage og 12-14 dage efter podningen. Hvis der i en samleprøve konstateres CPE, skal der straks foretages virusidentifikation i overensstemmelse med punkt II.2.4. Hvis der den 14. dag ikke er konstateret CPE, skal der foretages en IFAT, en hæmadsorptionstest eller en RT-PCR.Les échantillons doivent être incubés à 15 ± 2 °C pendant une durée maximale de 15 jours. Les cellules doivent être examinées au microscope deux fois pour détecter un ECP, d'abord entre le cinquième et le septième jour, puis entre le douzième et le quatorzième jour après inoculation. Si un ECP est détecté, les procédures d'identification du virus doivent être mises en œuvre immédiatement conformément au point II.2.4. Si aucun ECP n'est observé au quatorzième jour, il y a lieu de procéder à un test d'immunofluorescence indirecte (IFAT), à un test d'hémadsorption ou à une RT-PCR.
II.2.3.   SubcultivationII.2.3.   SubkultiveringII.2.3.   Repiquage
Subcultivation shall be carried out between days 13 to 15. Culture supernatant shall be added to wells containing fresh actively growing cells in appropriate dilution (1/10) in multi-well plates and incubated at 14 ± 2 °C for up to 18 days. Using a microscope, cell cultures shall be examined for CPE twice, between days five to seven and days 14 to 18 following inoculation. If any pool shows CPE, virus identification procedures shall be initiated immediately in accordance with point II.2.4. If no CPE is observed by days 14 to 18, a haemadsorption or an RT-PCR test shall be performed.Subkultivering foretages fra dag 13-15. Cellekulturens supernatant tilsættes til brønde indeholdende friske aktivt voksende celler i passende opløsning (1/10) i multibrøndplader og inkuberes ved 14 ± 2 °C i op til 18 dage. Cellekulturerne skal ved hjælp af et mikroskop undersøges for CPE to gange, nemlig 5-7 dage og 14-18 dage efter podningen. Hvis der i en samleprøve konstateres CPE, skal der straks foretages virusidentifikation i overensstemmelse med punkt II.2.4. Hvis der i perioden fra dag 14 til dag 18 ikke konstateres CPE, skal der foretages en hæmadsorptionstest eller en RT-PCR.Le repiquage doit être effectué entre le treizième et le quinzième jour. Du surnageant de culture doit être ajouté dans les puits de plaques multipuits contenant des cellules fraîches en phase de croissance active, à la dilution appropriée (1/10), et les plaques doivent ensuite être incubées à 14 ± 2 °C pendant une durée maximale de 18 jours. Les cultures cellulaires doivent être examinées deux fois au microscope pour rechercher un ECP, d'abord entre le cinquième et le septième jour puis entre le quatorzième et le dix-huitième jour après inoculation. Si un ECP est détecté, les procédures d'identification du virus doivent être mises en œuvre immédiatement conformément au point II.2.4. Si aucun ECP n'est observé entre le quatorzième et le dix-huitième jour, il faut procéder à un test d'hémadsorption ou à une RT-PCR.
If cytotoxicity occurs within the first 7 days of incubation, subcultivation shall be performed at that stage, and the cells shall be incubated for 14 to 18 days and sub cultivated again with a further period of 14 to 18 days incubation. If cytotoxicity occurs after 7 days, subcultivation shall be performed once and the cells shall be incubated to achieve the total period of 28 to 36 days incubation from the primary inoculation.Hvis der inden for de første syv inkubationsdage optræder cytotoksicitet, skal der på dette tidspunkt foretages subkultivering, og cellerne inkuberes i 14-18 dage og subkultiveres igen med yderligere inkubation i 14-18 dage. Hvis der optræder cytotoksicitet efter den syvende dag, skal der foretages subkultivering én gang, og cellerne inkuberes, indtil den samlede inkubationsperiode fra primærpodningen er på 28-36 dage.Si un effet cytotoxique est observé au cours des sept premiers jours suivant l'incubation, il faut procéder à ce stade à un repiquage et incuber les cellules pendant quatorze à dix-huit jours, puis réaliser un nouveau repiquage suivi d'une nouvelle période d'incubation de quatorze à dix-huit jours. Si l'effet cytotoxique apparaît au bout de sept jours, le repiquage n'est effectué qu'une fois et les cellules sont incubées de manière à parvenir à un total de vingt-huit à trente-six jours d'incubation à partir de l'inoculation primaire.
If bacterial contamination occurs in the primary culture, the test shall be set up again using the tissue homogenate stored at – 80 °C. Prior to inoculation, the tissue homogenate shall be centrifuged at 4 000 × g for 15 to 30 minutes at 0 to 6 °C and the supernatant shall be filtered at 0,22 μm. If bacterial contamination occurs during the subcultivation step the supernatant shall be filtered at 0,22 μm, inoculated onto fresh cells and incubated for a further 14 to 18 days.Hvis der optræder bakteriekontamination i primærkulturen, skal testen foretages på ny under anvendelse af det ved – 80 °C opbevarede vævshomogenat. Inden podningen centrifugeres vævshomogenatet ved 4 000 × g i 15-30 minutter ved 0-6 °C, og supernatanten filtreres gennem et 0,22 μm filter. Hvis bakteriekontaminationen optræder under subkultiveringen, filtreres supernatanten gennem et 0,22 μm filter, podes på friske celler og inkuberes i yderligere 14-18 dage.En cas de contamination bactérienne de la culture primaire, le test doit être recommencé avec l'homogénat de tissus conservé à – 80 °C. Avant inoculation, l'homogénat de tissus doit être centrifugé à 4 000 g pendant 15 à 30 minutes à une température comprise entre 0 et 6 °C et le surnageant doit être filtré à 0,22 μm. Si la contamination bactérienne survient pendant l'étape de repiquage, le surnageant doit être filtré à 0,22 μm, puis inoculé à des cellules fraîches qui seront ensuite incubées pendant une nouvelle période de quatorze à dix-huit jours.
II.2.4.   Virus identification testsII.2.4.   VirusidentifikationstestII.2.4.   Tests d'identification du virus
If evidence of CPE is observed at any stage, or if a haemadsorption test is positive, virus identification shall be carried out. The methods of choice for the identification of ISAV shall be RT-PCR in accordance with point II.1 and Immunofluorescence (IF) in accordance with point II.2.6. If it is considered that other viruses may be present, supplementary virus identification tests shall be carried out. If those tests have not resulted in a definitive identification of the virus within 1 week, the supernatant shall be forwarded for immediate identification to:Hvis der på noget tidspunkt konstateres tegn på CPE, eller hvis en hæmadsorptionstest er positiv, skal der foretages virusidentifikation. De metoder, der vælges til identifikation af ISAV, skal være RT-PCR i overensstemmelse med punkt II.1 og immunfluorescens (IF) i overensstemmelse med punkt II.2.6. Hvis det formodes, at andre virus kan være til stede, skal der foretages supplerende virusidentifikationstest. Hvis sådanne test ikke i løbet af en uge har ført til en definitiv identifikation af virusset, skal supernatanten sendes til et af følgende laboratorier med henblik på øjeblikkelig identifikation:Si un ECP est observé à quelque stade que ce soit, ou si le test d'hémadsorption est positif, il faut procéder à l'identification du virus. Les méthodes de prédilection pour l'identification du VAIS sont la RT-PCR conformément au point II.1 et l'immunofluorescence (IF) conformément au point II.2.6. Si l'on soupçonne la présence d'autres virus, des tests supplémentaires d'identification du virus doivent être effectués. Si ces tests n'ont pas permis d'identifier le virus de façon certaine dans un délai d'une semaine, le surnageant doit être envoyé en vue d'une identification immédiate:
(a) | the World Organisation for Animal Health (OIE) reference laboratory for ISA, or;a) | OIE's (Verdensorganisationen for Dyresundhed) referencelaboratorium for ISA ellera) | au laboratoire de référence de l'Organisation mondiale de la santé animale (OIE) pour l'AIS ou
(b) | a national reference laboratory or the EU reference laboratory for fish diseases as referred to in Annex VI to Directive 2006/88/EC.b) | et nationalt referencelaboratorium eller EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF.b) | à un laboratoire national de référence ou au laboratoire de référence de l'Union européenne pour les maladies des poissons visé à l'annexe VI de la directive 2006/88/CE.
II.2.5.   HaemadsorptionII.2.5.   HæmadsorptionII.2.5.   Hémadsorption
As replication of ISAV in cell cultures does not always result in a CPE, every well shall be subject to an RT-PCR test or a haemadsorption test in accordance with this point, or an IF test in accordance with point II.2.6.Da replikation af ISAV i cellekulturer ikke altid resulterer i CPE, skal hver brønd underkastes en RT-PCR-test eller en hæmadsorptionstest i overensstemmelse med nærværende punkt eller en IF-test i overensstemmelse med punkt II.2.6.Comme la réplication du VAIS dans des cultures cellulaires n'entraîne pas toujours l'apparition d'un ECP, chaque puits doit être soumis à une épreuve de RT-PCR ou à un test d'hémadsorption conformément au présent point, ou bien à un test IF conformément au point II.2.6.
Cell culture medium shall be removed from each well, including those of positive and negative controls, and placed in labelled sterile tubes. 500 μl of a 0,2 % (vol:vol) suspension of washed rabbit or horse red blood cells, or a 0,05 % (vol:vol) suspension of washed rainbow trout or Atlantic salmon red blood cells, shall be added to each well and incubated at room temperature for 45 minutes. The red blood cells shall be removed and each well shall be washed twice with L-15 medium. Each well shall be examined using a microscope.Celledyrkningsmediet fjernes fra hver brønd, også fra dem til positiv og negativ kontrol, og anbringes i sterile mærkede rør. 500 μl af en 0,2 % (v/v) opløsning af vaskede røde blodlegemer fra kanin eller hest eller en 0,05 % (v/v) opløsning af vaskede røde blodlegemer fra regnbueørred eller atlantisk laks tilsættes i hver brønd og inkuberes ved rumtemperatur i 45 minutter. Derefter fjernes de røde blodlegemer, og hver brønd vaskes to gange med L-15-medium. Hver brønd undersøges ved hjælp af et mikroskop.Du milieu de culture cellulaire doit être prélevé dans chacun des puits, y compris ceux des témoins positifs et négatifs, et placé dans des tubes stériles étiquetés. Ajouter dans chaque puits 500 μl d'une suspension à 0,2 % (v/v) d'hématies de cheval ou de lapin lavées ou d'une suspension à 0,05 % (v/v) d'hématies de truite arc-en-ciel ou de saumon de l'Atlantique lavées, puis incuber à température ambiante pendant 45 minutes. Éliminer les hématies et rincer chaque puits deux fois avec du milieu L-15. Chaque puits doit être examiné au microscope.
The presence of clusters of red blood cells attaching to the surface of ASK cells shall be indicative of presumptive infection with an orthomyxovirus. If a haemadsorption test is positive, a virus identification test shall be performed immediately in accordance with point II.2.4.Forekomst af ansamlinger af røde blodlegemer på overfladen af ASK-celler tages som tegn på en formodet infektion med en orthomyxovirus. Hvis en hæmadsorptionstest er positiv, skal der straks foretages en virusidentifikationstest i overensstemmelse med punkt II.2.4.La présence d'amas d'érythrocytes adhérant à la surface des cellules d'ASK est révélatrice d'une possible infection par un orthomyxovirus. Si le test d'hémadsorption est positif, un test d'identification du virus doit être réalisé immédiatement conformément au point II.2.4.
II.2.6.   Immunofluorescence (IF)II.2.6.   Immunfluorescens (IF)II.2.6.   Immunofluorescence (IF)
ASK (pass 65 or lower) shall be grown in a L-15 medium containing 10 % foetal bovine serum, 2 % (vol:vol) 200 mM L-glutamine, and 0,08 % (vol:vol) 50 mM 2-mercaptoethanol in multi-well plates and used at greater than 50 % confluence. Other cell lines or growth medium of proven efficacy may also be used. 225 μl of putative virus-infected culture supernatant shall be added to each of two wells, mixed and 225 μl transferred to two further wells, namely a 1:5 dilution. Two additional wells shall be left uninoculated to act as controls. Samples from each fish farm site shall be handled on separate plates, as shall the virus control. A virus control shall be established using a reference isolate of ISAV.ASK-celler (passage 65 eller derunder) dyrkes i L-15-medium indeholdende 10 % føtalt kvægserum, 2 % (v/v) 200 mM L-glutamin og 0,08 % (v/v) 50 mM 2-mercaptoethanol i multibrøndplader med mere end 50 % sammenflydning. Andre cellelinjer eller vækstmedium af dokumenteret effektivitet kan også anvendes. 225 μl supernatant af den kultur, der formodes inficeret med virus, tilsættes til hver af to brønde og omrøres, hvorefter 225 μl overføres til to yderligere brønde (en fortynding på 1:5). To yderligere brønde lades upodede, så de kan fungere som kontroller. Prøver fra de enkelte akvakulturbrug skal behandles på separate plader, og det samme gælder viruskontrollen. Der etableres en viruskontrol ved hjælp af et referenceisolat af ISAV.Des cellules ASK (65 passages au maximum) doivent être cultivées dans du milieu L-15 contenant du sérum fœtal bovin à 10 %, 200 mM de L-glutamine à 2 % (v/v) et 50 mM de 2-mercaptoéthanol à 0,08 % (v/v) dans des plaques multipuits, et doivent être utilisées à plus de 50 % de confluence. Il est également possible d'utiliser d'autres lignées cellulaires ou un autre milieu de culture d'efficacité avérée. Ajouter respectivement 225 μl de surnageant de culture infectée par le virus présumé dans deux puits, mélanger puis transférer 225 μl de chaque puits dans deux autres puits, de façon à obtenir une dilution au 1:5. Deux autres puits non inoculés serviront de témoins. Les échantillons provenant de chaque site d'une ferme piscicole doivent être traités sur des plaques distinctes, de même que les témoins. Un témoin viral doit être constitué à l'aide d'un isolat de référence du VAIS.
Plates shall be incubated at 14 ± 2 °C and examined microscopically for up to 7 days. When early CPE is observed, or if no CPE is observed within 7 days, the next step shall be fixation. Wells shall be washed with Phosphate buffered saline (PBS) and fixed by incubation with 80 % acetone for 20 minutes at room temperature. Plates shall be air-dried and stained immediately or stored at 0 to 6 °C for no more than 24 hours prior to staining.Pladerne inkuberes ved 14 ± 2 °C og undersøges mikroskopisk i op til syv dage. Hvis tidlig CPE konstateres, eller hvis der ikke i løbet af syv dage konstateres CPE, er næste skridt fiksering. Brøndene vaskes med phosphat-bufferet saltopløsning (PBS) og fikseres ved inkubation med 80 % acetone i 20 minutter ved rumtemperatur. Pladerne lufttørres og farves med det samme eller efter højst 24 timers opbevaring ved 0-6 °C.Les plaques doivent être incubées à 14 ± 2 °C et examinées au microscope sept jours durant au maximum. Si un ECP précoce est observé ou si aucun ECP n'est observé dans un délai de sept jours, l'étape suivante est la fixation. Les puits doivent être lavés à l'aide d'une solution saline tamponnée au phosphate (PBS) et fixés par incubation avec de l'acétone à 80 % pendant 20 minutes à température ambiante. Les plaques doivent être séchées à l'air puis immédiatement colorées ou bien conservées entre 0 et 6 °C pendant au maximum 24 heures avant coloration.
Replicate wells shall be stained with a mix of monoclonal antibodies (MAb) 3H6F8 and 1OC9F5 against ISAV, or other MAb of proven efficacy and specificity, diluted in PBS and incubated at 37 ± 4 °C for 30 minutes. MAb shall be removed and plates washed three times with 0,05 % Tween 20 in PBS. Anti-mouse IgG Fluorescein isothiocyanate (FITC) conjugate diluted in PBS shall be added to each well and incubated at 37 ± 4 °C for 30 minutes. The dilutions of different batches of MAb and FITC conjugate shall be optimised in each laboratory. Antibody shall be removed and plates shall be washed three times with 0,05 % Tween 20 in PBS.Replikationsbrønde farves med en blanding af monoklonale antistoffer (MAb) 3H6F8 og 1OC9F5 mod ISAV eller et andet MAb af dokumenteret effektivitet og specificitet, opløst i PBS, og inkuberes ved 37 ± 4 °C i 30 minutter. MAb fjernes, og pladerne vaskes tre gange med 0,05 % Tween 20 i PBS. Et anti-muse-IgG-FITC-konjugat opløst i PBS tilsættes til hver brønd og inkuberes ved 37 ± 4 °C i 30 minutter. Opløsningerne af forskellige batcher af MAb og FITC-konjugat optimeres i hvert laboratorium. Antistoffet fjernes, og pladerne vaskes tre gange med 0,05 % Tween 20 i PBS.Les puits répliques doivent être colorés à l'aide d'un mélange d'anticorps monoclonaux (AcM) 3H6F8 et 1OC9F5 anti-VAIS, ou d'autres AcM d'efficacité et de spécificité avérées, dilués dans du PBS, et les plaques doivent être incubées à 37 ± 4 °C pendant 30 minutes. Après élimination des AcM, les plaques doivent être lavées trois fois au Tween 20 à 0,05 % dans du PBS. Des anti-IgG de souris conjuguées à de l'isothiocyanate de fluorescéine (FITC) diluées dans du PBS doivent être ajoutées dans chaque puits et les plaques doivent être incubées à 37 ± 4 °C pendant 30 minutes. Les dilutions des différents lots de conjugués d'AcM et de FITC doivent être optimisées dans chaque laboratoire. Après élimination des anticorps, les plaques doivent être lavées trois fois au Tween 20 à 0,05 % dans du PBS.
Wells shall be examined immediately using an inverted microscope set up for fluorescence microscopy with a suitable filter for excitation of FITC. A test shall be considered positive if fluorescent cells are observed. For a test to be valid, the positive controls shall score positive and the negative controls shall score negative.Brøndene undersøges straks ved hjælp af et inverteret mikroskop forberedt til fluorescensmikroskopi med et filter egnet til excitering af FITC. En test betragtes som positiv, hvis der iagttages fluorescerende celler. For at en test er gyldig, skal de positive kontroller give positivt resultat og de negative kontroller give negativt resultat.Les puits doivent être examinés immédiatement au microscope inversé équipé pour la fluorescence avec un filtre adapté pour exciter le FITC. Le test est considéré comme positif si des cellules fluorescentes sont observées. Pour que le test soit valable, les témoins positifs doivent donner un résultat positif et les témoins négatifs, un résultat négatif.
II.3.   Examination of other tissuesII.3.   Undersøgelse af andet vævII.3.   Examen d'autres tissus
The technique referred to in point II.2.6 may be applied to other fish tissues such as liver, spleen and heart providing a reasonable quantity of endothelial cells, leucocytes or lymphocytes can be deposited on the slide. The staining procedure shall remain the same for each tissue, although for some tissues it may be preferable to omit the propidium iodide staining and rely on the phase illumination to identify the cell types present in the imprint.Den i punkt II.2.6 omhandlede metode kan anvendes for andet fiskevæv såsom lever, milt og hjerte, forudsat at en rimelig mængde endoteliale celler, leukocytter eller lymfocytter kan anbringes på objektglasset. Farvningsmetoden er den samme for alt væv, idet det dog for nogle former for væv kan være at foretrække at undgå farvning med propidiumjodid og i stedet anvende fasebelysning ved identifikationen af de celletyper, der forekommer i aftrykket.La technique visée au point II.2.6 peut être appliquée à d'autres tissus de poisson tels que le foie, la rate et le cœur, à condition qu'une quantité suffisante de cellules endothéliales, de leucocytes ou de lymphocytes puisse être déposée sur la lame. Si la procédure de marquage est la même pour tous les tissus, il peut être préférable pour certains de renoncer à la coloration à l'iodure de propidium et de recourir à l'éclairage en contraste de phase pour identifier les types de cellules présents sur l'empreinte.
II.4.   HistologyII.4.   HistologiII.4.   Analyse histologique
Paraffin-embedded sections shall be cut at 5 μm and stained using haematoxylin and eosin.De i paraffin indstøbte snit skæres i 5 μm tynde skiver og farves med hæmatoxylin og eosin.Des coupes de 5 μm d'épaisseur doivent être réalisées à partir des tissus inclus en paraffine, puis colorées à l'hématoxyline et à l'éosine.
Histological changes in clinically diseased Atlantic salmon are variable, but may include the following:De histologiske ændringer i klinisk syg atlantisk laks varierer, men de kan omfatte følgende:Les modifications histologiques observables chez le saumon de l'Atlantique présentant des signes cliniques de la maladie sont variables, mais elles peuvent inclure les éléments suivants:
(a) | numerous erythrocytes in the central venous sinus and lamellar capillaries of the gills, where erythrocyte thrombi also may be formed;a) | talrige erytrocytter i den centrale venøse sinus og gællernes lamellære kapillærer, hvor der også kan dannes tromber af erytrocyttera) | nombreux érythrocytes dans le sinus veineux central et dans les capillaires lamellaires des branchies, où ces érythrocytes peuvent également former des thrombus;
(b) | multifocal to confluent petechiae or hepatocyte necrosis or both at some distance from larger vessels in the liver; multifocal accumulation of erythrocytes in dilated hepatic sinusoids;b) | multifokale til sammenflydende petekkier eller nekrose af hepatocytter eller begge dele i nogen afstand fra de større blodkar i leveren; multifokal akkumulering af erytrocytter i dilaterede sinusoider i leverenb) | pétéchies multifocales à confluentes ou nécrose des hépatocytes, ou les deux, à une certaine distance des plus gros vaisseaux du foie; accumulation multifocale d'érythrocytes dans des sinusoïdes hépatiques dilatés;
(c) | accumulation of erythrocytes in blood vessels of the intestinal lamina propria and eventually haemorrhage into the lamina propria;c) | akkumulering af erytrocytter i blodkarrene i tarmens lamina propria, eventuelt resulterende i blødninger i lamina propriac) | accumulation d'érythrocytes dans les vaisseaux sanguins de la lamina propria intestinale, pouvant aboutir à une hémorragie de celle-ci;
(d) | spleen stroma distended by erythrocyte accumulation;d) | miltens stroma udspilet på grund af akkumulering af erytrocytterd) | distension du stroma splénique due à l'accumulation d'érythrocytes;
(e) | slight multifocal to extensive diffuse interstitial haemorrhage with tubular necrosis in the haemorrhagic areas, erythrocyte accumulation in the glomeruli in the kidney;e) | let multifokal til meget udbredt interstitiel blødning med tubulær nekrose i de blødende områder og akkumulering af erytrocytter i glomeruli i nyrene) | légère hémorragie interstitielle diffuse multifocale à généralisée avec nécrose tubulaire dans les zones hémorragiques, accumulation d'érythrocytes dans les glomérules rénaux;
(f) | erythrophagocytosis in the spleen and secondary haemorrhages in liver and kidney.f) | erytrofagocytose i milten og sekundære blødninger i lever og nyre.f) | érythrophagocytose dans la rate et hémorragies secondaires dans le foie et les reins.
II.5.   Immunohistochemistry (IHC)II.5.   Immunhistokemi (IHC)II.5.   Analyse immunohistochimique (IHC)
Polyclonal antibody against ISAV nucleoprotein shall be used on paraffin sections from formalin-fixed tissue. The organs to be examined shall be mid-kidney and heart (transitional area including all three chambers and valves). Suspected cases due to pathological signs shall be verified with a positive IHC. Histological sections shall be prepared in accordance with standard methods.Polyklonale antistoffer mod ISAV-nukleoprotein anvendes på paraffinsnit fra formalinfikseret væv. De organer, som skal undersøges, er mellemnyre og hjerte (overgangsområde inklusive alle tre kamre og klapper). Mistanke som følge af patologiske tegn skal verificeres med en positiv IHC. Histologiske snit skal præpareres i overensstemmelse med standardmetoder.Des anticorps polyclonaux anti-nucléoprotéines du VAIS doivent être utilisés sur des coupes de tissus fixés au formol et inclus en paraffine. Les organes à examiner sont le rein médian et le cœur (zone de transition, y compris les trois chambres et les valves). Les cas suspects en raison de signes pathologiques doivent être confirmés par un examen IHC positif. Les coupes histologiques doivent être préparées conformément aux méthodes standard.
(1) | Preparation of tissue sections | The tissues shall be fixed in neutral phosphate-buffered 10 % formalin for at least 1 day, dehydrated in a graded ethanol series, cleared in xylene and embedded in paraffin, according to standard protocols. Approximately 5 μm thick sections (for IHC placed on poly-L-lysine-coated slides) shall be heated at 56 °C to 58 °C (maximum 60 °C) for 20 minutes, dewaxed in xylene, rehydrated through a graded ethanol series, and stained with haematoxylin and eosin for pathomorphology and IHC in accordance with point (2).1) | Præparation af vævssnit | Væv fikseres i neutral phosphat-bufferet 10 % formalin i mindst 1 dag, dehydreres i ethanol i stigende koncentrationer, klares i xylen og indstøbes i paraffin i henhold til standardprotokollerne. Ca. 5 μm tykke snit (for IHC anbragt på poly-L-lysin-belagte objektglas) opvarmes ved 56-58 °C (højst 60 °C) i 20 minutter, voksen fjernes i xylen, snittene rehydreres i ethanol i faldende koncentrationer og farves med hæmatoxylin og eosin med henblik på patomorfologi og IHC i overensstemmelse med nr. 2).1. | Préparation des coupes de tissus | Les tissus doivent être fixés à l'aide d'une solution neutre de formol à 10 % tamponnée au phosphate pendant au moins un jour, puis déshydratés dans une série de bains d'éthanol de concentration croissante, rincés au xylène et inclus en paraffine, conformément aux protocoles standard. Des coupes d'environ 5 μm d'épaisseur (pour IHC sur lames traitées à la poly-L-lysine) doivent être chauffées à une température comprise entre 56 et 58 °C (60 °C au maximum) pendant 20 minutes, déparaffinées au xylène, réhydratées dans une série de bains d'éthanol de concentration décroissante, et colorées à l'hématoxyline et à l'éosine en vue d'une analyse pathomorphologique et immunohistochimique conformément au point 2.
(2) | Staining procedure for IHC | All incubations shall be carried out at room temperature on a rocking platform, unless otherwise provided for in this decision: | (a) | antigen retrieval shall be done by boiling sections in 0,1 M citrate buffer pH 6,0 for 2 × 6 minutes followed by blocking with 5 % non-fat dry milk and 2 % goat serum in 50 mM TBS (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH 7,6) for 20 minutes; | (b) | sections shall then be incubated overnight with primary antibody (monospecific rabbit antibody against ISAV nucleoprotein) diluted in TBS with 1 % non-fat dry milk, followed by three washes in TBS with 0,1 % Tween 20; | (c) | for detection of bound antibodies, sections shall be incubated with Alkaline phosphatase-conjugated antibodies to rabbit IgG for 60 minutes. Following a final wash, Fast Red (1 mg ml– 1) and Naphthol AS-MX phosphate (0,2 mg ml– 1) with 1 mM Levamisole in 0,1 M TBS (pH 8,2) shall be added to develop for 20 minutes. Sections shall then be washed in tap water before counterstaining with Harris haematoxylin and mounted in aqueous mounting medium. ISAV positive and ISAV negative tissue sections shall be included as controls in every setup.2) | Farvningsmetode for IHC | Alle inkubationer foretages ved rumtemperatur på et vippebord, medmindre andet er fastsat i denne afgørelse: | a) | Udtræk af antigen foretages ved at koge snittene i 0,1 M citratbuffer (pH 6,0) i 2 × 6 minutter efterfulgt af blokering med 5 % fedtfri tørmælk og 2 % gedeserum i 50 mM TBS (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH 7,6) i 20 minutter. | b) | Derefter inkuberes snittene natten over med primært antistof (monospecifikt kaninantistof mod ISAV-nukleoprotein) opløst i TBS med 1 % fedtfri tørmælk efterfulgt af tre skylninger med TBS med 0,1 % Tween 20. | c) | Til påvisning af bundne antistoffer skal snittene inkuberes med antistoffer mod kanin-IgG, der er konjugeret med alkalisk phosphatase, i 60 minutter. Efter en sidste vaskning tilsættes Fast Red (1 mg ml– 1) og naphthol-AS-MX-phosphat (0,2 mg ml– 1) med 1 mM levamisol i 0,1 M TBS (pH 8,2); lad det udvikle sig i 20 minutter. Derefter vaskes snittene i ledningsvand inden kontrastfarvning med Harris-hæmatoxylin og monteres i vandigt monteringsmedium. ISAV-positive og ISAV-negative vævssnit skal indgå som kontroller ved hver udførelse.2. | Procédure de coloration pour l'IHC | Toutes les incubations doivent être réalisées à la température ambiante sur un agitateur à bascule, sauf disposition contraire prévue dans la présente décision: | a) | la récupération des antigènes doit être réalisée en faisant bouillir les coupes dans un tampon au citrate 0,1 M à pH 6 pendant 2 × 6 minutes, puis en procédant à l'étape de blocage avec 5 % d'extrait sec dégraissé de lait et 2 % de sérum de chèvre dans 50 mM de TBS (TBS; 50 mM de Tris/HCl, 150 mM de NaCl, pH 7,6) pendant 20 minutes; | b) | les coupes doivent ensuite être incubées pendant la nuit avec l'anticorps primaire (anticorps monospécifique de lapin anti-nucléoprotéines de VAIS) dilué dans du TBS additionné de 1 % d'extrait sec dégraissé de lait, puis lavées trois fois dans du TBS contenant du Tween 20 à 0,1 %; | c) | pour la détection des anticorps liés, les coupes doivent être incubées pendant 60 minutes avec des anticorps anti IgG de lapin conjugués à la phosphatase alcaline. Après un dernier rinçage, on ajoute du rouge neutre (1 mg ml– 1) et du Naphtol AS-MX phosphate (0,2 mg ml– 1) avec 1 mM de lévamisole dans 0,1 M de TBS (pH 8,2) et on laisse développer pendant 20 minutes. Les coupes doivent ensuite être lavées à l'eau du robinet avant contre-coloration à l'hématoxyline de Harris puis montage dans un milieu de montage aqueux. Des coupes de tissus positifs et négatifs au VAIS doivent être incluses en tant que témoins à chaque étape.
(3) | Interpretation of the result of IHC | The interpretation of the result of the IHC test shall be as set out in points (a) and (b): | (a) | control sections shall be considered as positive, when it is observed that the control sections have clearly visible red-coloured (reddish) cytoplasmic and intranuclear staining of endothelia cells in blood vessels of endocardium. A test sample section shall only be regarded as positive if such clear, intranuclear red staining of endothelial cells is found; | (b) | control sections shall be considered as negative if they don't have any significant colour reaction. | Since the intranuclear localisation is particular to the orthomyxovirus nucleoprotein during a stage of virus replication but concurrent cytoplasmic staining is often dominant, cytoplasmic and other staining patterns without intranuclear localisation shall be considered as nonspecific or inconclusive. | The strongest positive staining reactions are usually obtained in endothelial cells of heart and kidney. Endothelial staining reactions within very extensive haemorrhagic lesions may be slight or absent, possibly because of lysis of infected endothelial cells.3) | Fortolkning af resultaterne af IHC | Resultaterne af IHC-testen fortolkes som anført i litra a) og b): | a) | Kontrolsnittene anses for positive, når det konstateres, at kontrolsnittene har en klart synlig rød (rødlig) cytoplasmatisk og intranukleær farvning af endotelcellerne i endokardiets blodkar. Et prøvesnit anses kun for positivt, hvis der forekommer en sådan klar intranukleær rødfarvning af endotelcellerne. | b) | Kontrolsnit anses for negative, hvis de ikke har nogen markante farvereaktioner. | Da den intranukleære placering er specifik for orthomyxovirussets nukleoprotein i en fase af virusreplikationen, mens samtidig cytoplasmisk farvning ofte er dominerende, skal cytoplasmiske og andre farvningsmønstre uden intranukleær placering anses for ikkespecifikke eller inkonklusive. | De stærkeste positive farvningsreaktioner opnås normalt i endotelceller fra hjerte og nyre. Ved meget omfattende hæmoragiske læsioner kan endotel-farvningsreaktionerne være svage eller fraværende, muligvis på grund af lysis af inficerede endotelceller.3. | Interprétation des résultats de l'IHC | Les résultats du test IHC doivent être interprétés comme indiqué aux points a) et b): | a) | les coupes témoins doivent être considérées comme positives lorsqu'on observe une coloration rouge clairement visible du cytoplasme et de l'intérieur du noyau des cellules endothéliales des vaisseaux sanguins de l'endocarde. Une coupe d'échantillon d'essai ne doit être considérée comme positive que si l'on observe cette coloration rouge marquée à l'intérieur du noyau des cellules endothéliales; | b) | les coupes témoins doivent être considérées comme négatives si elles ne présentent aucune réaction de coloration particulière. | Étant donné que la localisation intranucléaire est spécifique des nucléoprotéines de l'orthomyxovirus pendant une étape de la réplication du virus, mais qu'une coloration cytoplasmique concomitante prédomine souvent, des zones de coloration cytoplasmiques et autres sans localisation intranucléaire doivent être considérées comme étant non spécifiques ou non concluantes. | Les plus fortes réactions positives de coloration sont généralement obtenues sur les cellules endothéliales cardiaques et rénales. Il se peut que la coloration des cellules endothéliales soit faible ou inexistante au niveau de lésions hémorragiques très étendues, sans doute en raison de la lyse des cellules endothéliales infectées.
PART 4DEL 4PARTIE 4
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR THE SURVEILLANCE AND CONFIRMATION OF INFECTION WITH MARTEILIA REFRINGENSDETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTION MED MARTEILIA REFRINGENSMÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'INFECTION À MARTEILIA REFRINGENS
I.   Detailed diagnostic methods and procedures for the diagnosis of infection with Marteilia refringensI.   Detaljerede diagnosemetoder og -procedurer for diagnose af infektion med Marteilia refringensI.   Méthodes et procédures de diagnostic détaillées pour le diagnostic de l'infection à Marteilia refringens
When sampling and laboratory examination are carried out for the purpose of obtaining or maintaining a health status with regard to infection with Marteilia refringens as set out in Section I of Part 4 of Annex I or to confirm or rule out the presence of that listed disease in accordance with Article 57(b) of Directive 2006/88/EC, using the diagnostic methods set out in Section II of Part 4 of Annex I, the detailed diagnostic methods and procedures set out in points I.1, I.2 and I.3 of this Part shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde en sundhedsstatus med hensyn til infektion med Marteilia refringens, jf. bilag I, del 4, afsnit I, eller for at bekræfte eller udelukke forekomst af denne listeopførte sygdom i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 4, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1, I.2 og I.3.Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne l'infection à Marteilia refringens comme indiqué à l'annexe I, partie 4, section I, ou afin de confirmer la présence de cette maladie répertoriée ou d'écarter une suspicion de cette maladie conformément à l'article 57, point b), de la directive 2006/88/CE à l'aide des méthodes de diagnostic décrites à l'annexe I, partie 4, section II, les méthodes et procédures détaillées de diagnostic figurant aux points I.1, I.2 et I.3 de la présente partie doivent être appliquées.
I.1.   Sampling procedureI.1.   PrøveudtagningsprocedureI.1.   Procédure d'échantillonnage
Gaping or freshly dead individual molluscs shall be sampled by priority, to increase the chances of finding infected animals.Bløddyr med åbne skaller eller nyligt døde bløddyr skal prioriteres ved prøveudtagningen for at øge chancerne for at finde inficerede dyr.Les mollusques bâillants ou qui viennent de mourir doivent être prélevés en priorité afin d'accroître les chances de trouver des animaux infectés.
Once sampled, oysters or mussels shall be maintained at 4 °C or on refrigerated ice for no more than 24 hours if samples include gaping molluscs and no more than 72 hours if not, in a plastic bag including a label with details related to the nature and the origin of the oysters or mussels. Gaping or freshly dead molluscs shall be maintained separately from other molluscs.De indsamlede østers eller muslinger opbevares ved 4 °C eller på køleis i højst 24 timer, hvis der er bløddyr med åbne skaller, og højst 72 timer, hvis dette ikke er tilfældet; de skal opbevares i en plastpose med en etiket med oplysninger om østernes eller muslingernes art og oprindelse. Bløddyr med åbne skaller eller nyligt døde bløddyr skal opbevares adskilt fra andre bløddyr.Une fois prélevées, les huîtres ou les moules doivent être maintenues à 4 °C ou réfrigérées sur de la glace pendant 24 heures au maximum si les échantillons comprennent des mollusques bâillants et pendant 72 heures tout au plus dans le cas contraire, dans un sac en plastique muni d'une étiquette sur laquelle figurent des informations relatives à la nature et à l'origine des huîtres ou des moules. Les mollusques bâillants ou qui viennent de mourir doivent être séparés des autres mollusques.
A 3 to 5 mm thick section of tissues including gills and heart tissue shall be used for the diagnostic of Marteilia refringens by histology. A piece of digestive gland shall be used for some tests, including imprints and polymerase chain reaction (PCR).Et 3-5 mm tykt vævssnit, der omfatter væv fra hjerte og gæller, skal anvendes til diagnosticering af Marteilia refringens ved hjælp af histologi. Et stykke af fordøjelseskirtlen skal anvendes til visse test, bl.a. aftryk og polymerasekædereaktion (PCR).Une coupe de tissus incluant les branchies et du tissu cardiaque, de 3 à 5 mm d'épaisseur, doit être utilisée pour le diagnostic histologique de Marteilia refringens. Un morceau de la glande digestive doit être utilisé pour certains tests, y compris pour les empreintes et la réaction en chaîne par polymérase (PCR).
I.2.   Microscopic techniquesI.2.   Mikroskopiske teknikkerI.2.   Techniques microscopiques
I.2.1.   Cytology (imprint cytology)I.2.1.   Cytologi (aftrykscytologi)I.2.1.   Cytologie (cytologie sur empreinte)
After drying digestive gland tissues on absorbent paper, several imprints shall be made on a glass slide. Slides shall be air-dried, fixed in methanol or in absolute ethanol and stained using a commercially available blood-staining kit such as Diff-Quik®/Hemacolor®, in accordance with the manufacturer's instructions. After rinsing in tap water and drying, the slides shall be mounted with a cover-slip using an appropriate synthetic resin. The slides shall be observed first at × 200 magnification and then under oil immersion at × 1 000 magnification.Efter tørring af væv fra fordøjelseskirtlen på absorberende papir skal der tages en række aftryk på et objektglas. Objektglassene skal lufttørres, fikseres i methanol eller i absolut ethanol og farves med et kommercielt tilgængeligt kit til farvning af blod, f.eks. Diff-Quick®/Hemacolor®, i henhold til fabrikantens anvisninger. Efter skylning i ledningsvand og tørring skal objektglassene monteres med dækglas ved hjælp af en egnet syntetisk harpiks. Dækglassene observeres først ved 200 × forstørrelse og derefter i immersionsolie ved 1 000 × forstørrelse.Après séchage des tissus de glande digestive sur du papier absorbant, plusieurs empreintes doivent être réalisées sur une lame de verre. Les lames doivent être séchées à l'air, fixées au méthanol ou à l'éthanol absolu et colorées à l'aide d'un kit de coloration disponible dans le commerce tel que tel que Diff-Quick®/Hemacolor® conformément aux instructions du fabricant. Après rinçage à l'eau du robinet et séchage, les lames doivent être montées avec une lamelle couvre-objet à l'aide d'une résine synthétique appropriée. Les lames doivent être observées dans un premier temps à un grossissement de × 200, puis en immersion dans l'huile, à un grossissement de × 1 000.
A positive result shall be the observation of cells ranging in size up to between 30 to 40 μm. The cytoplasm stains basophilic, whereas the nucleus stains eosinophilic. Pale halos around large, strongly stained (refringent) granules and, in larger cells, cell within cell arrangements are observed.Et positivt resultat er iagttagelse af celler i størrelser på op til 30-40 μm. Cytoplasmaet farves basofilt, mens cellekernen farves eosinofilt. Der observeres lyse haloer rundt om store stærkt farvede (lysbrydende) granula og celler intracellulært i større celler.Un résultat positif consiste en l'observation de cellules de taille comprise entre 30 et 40 μm. Leur cytoplasme est basophile, tandis que leur noyau est éosinophile. On observe des auréoles pâles autour de gros granules (réfringents) fortement colorés et, sur les cellules de plus grande taille, une organisation du type emboîtement de cellules.
The technique is not parasite species specific.Teknikken er ikke artsspecifik for parasitter.La technique n'est pas spécifique de l'espèce parasite.
I.2.2.   HistologyI.2.2.   HistologiI.2.2.   Analyse histologique
Sections of tissue that include gills, digestive gland, mantle, and gonad shall be fixed for at least 24 hours in Davidson's fixative followed by normal processing for paraffin histology and staining, for example with haematoxylin and eosin. Observations shall be made at increasing magnifications up to × 1 000.Vævssnit, som omfatter gæller, fordøjelseskirtel, kappe og gonade, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin og farvning, f.eks. med hæmatoxylin og eosin. Der foretages observationer ved stadig kraftigere forstørrelse op til 1 000 ×.Des fragments de tissus incluant branchies, glande digestive, manteau et gonades doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine et coloration, par exemple à l'hématoxyline et à l'éosine. Les observations doivent être effectuées à un grossissement maximal de × 1 000.
A positive result shall be the observation of cells ranging in size from 4 up to 40 μm. Early stages consist of multinucleate, spheric to elongated cells. These are mainly found in the epithelium of oesophagus and stomach and sometimes of labial palps. Sporulation involves divisions of cells within cells and takes place in the digestive gland tubules and ducts. Refringent granules appear in the course of sporulation, but are not observed in early stages. In late phases of infection, sporangia are observed free in the lumen of the digestive tract. The cytoplasm stains basophilic, whereas the nucleus stains eosinophilic. The granules can range from deep orange to deep red.Et positivt resultat er iagttagelse af celler i størrelser på 4-40 μm. De tidlige stadier består af multinukleære celler, som er sfæriske til aflange. Disse findes først og fremmest i epitel fra spiserør og mave og undertiden fra læbeflige. Sporedannelse omfatter celledelinger inden i celler og foregår i fordøjelseskirtlens tubuli og ducti. Lysbrydende granula forekommer i forbindelse med sporedannelsen, men observeres ikke i de tidlige stadier. I infektionens sene stadier iagttages der frie sporangia i lumen i fordøjelseskanalen. Cytoplasmaet farves basofilt, mens cellekernen farves eosinofil. Farvningen af granula kan gå fra dybt orange til dybrød.Un résultat positif consiste en l'observation de cellules de taille comprise entre 4 et 40 μm. Les premiers stades sont des cellules multinuclées, de forme sphérique à allongée. Ces cellules proviennent principalement de l'épithélium de l'œsophage et de l'estomac et parfois des palpes labiaux. La sporulation se traduit par la division de cellules à l'intérieur des cellules et se déroule dans les tubules et conduits de la glande digestive. Des granules réfringents apparaissent au cours de la sporulation, mais ne sont pas observés dans les premiers stades. Dans les dernières phases de l'infection, des sporanges libres sont observés dans la lumière du tube digestif. Leur cytoplasme est basophile, tandis que leur noyau est éosinophile. La couleur des granules peut aller de l'orange foncé au rouge foncé.
The technique is not parasite species specific.Teknikken er ikke artsspecifik for parasitter.La technique n'est pas spécifique de l'espèce parasite.
I.3.   Molecular techniquesI.3.   Molekylære teknikkerI.3.   Techniques moléculaires
I.3.1.   DNA extractionI.3.1.   DNA-ekstraktionI.3.1.   Extraction de l'ADN
DNA shall be extracted in accordance with standard procedures.DNA skal ekstraheres i henhold til standardprocedurerne.L'ADN doit être extrait conformément aux procédures standard.
DNA extraction kits, which are available commercially and usually produce high quality DNA suitable for use with the PCR protocols as described in point I.3.2, may be used.Der kan anvendes DNA-ekstraktionskit, der er kommercielt tilgængelige og normalt giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er beskrevet i punkt I.3.2.Il est possible d'utiliser des kits d'extraction de l'ADN disponibles dans le commerce, qui produisent généralement de l'ADN de haute qualité utilisable pour les protocoles de PCR, comme indiqué au point I.3.2.
I.3.2.   Polymerase chain reaction (PCR)I.3.2.   Polymerasekædereaktion (PCR)I.3.2.   Amplification en chaîne par la polymérase (PCR)
Several PCR protocols have been developed and published.Der er udarbejdet og offentliggjort en række PCR-protokoller.Plusieurs protocoles de PCR ont été élaborés et publiés.
PCR primers that target the internal transcribed spacer (ITS1) region shall be used as they are able to amplify only M. refringens.Der skal anvendes PCR-primere, der er målrettet ITS1-regionen (ITS = internal transcribed spacer), da de er i stand til kun at amplificere M. refringens.Il y a lieu d'utiliser des amorces PCR ciblant la région de l'espaceur transcrit interne (ITS1), car elles sont capables d'amplifier uniquement M. refringens.
PCR shall be carried out in a 50 μl volume. PCR mixtures shall contain buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 at 25 °C] and 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward and reverse primers, 0,02 units μl– 1 Taq DNA polymerase, and 10 to100 ng of extracted DNA. After denaturation of DNA at 94 °C for five minutes, 30 cycles shall be run as follows: denaturation at 94 °C for one minute, annealing at 55 °C for one minute, and elongation at 72 °C for one minute per kilo-base pair. A final elongation step of 10 minutes at 72 °C shall be performed. For the detection of M. refringens, PCR shall be performed with primers that target the ITS1 region (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ and 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).PCR skal foretages i en mængde på 50 μl. PCR-blandinger skal indeholde buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 ved 25 °C] og 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward og reverse primere, 0,02 enheder μl– 1 Taq DNA-polymerase og 10-100 ng ekstraheret DNA. Efter denaturering af DNA ved 94 °C i fem minutter, skal der køres 30 cyklusser som følger: denaturering ved 94 °C i ét minut, hybridisering ved 55 °C i ét minut og elongering ved 72 °C i ét minut pr. kilobasepar. Der foretages en endelig elongering i 10 minutter ved 72 °C. Til påvisning af M. refringens foretages der PCR med primere, der er målrettet ITS1-regionen (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ og 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).La PCR doit être réalisée dans un volume de 50 μl. Les mélanges pour PCR doivent contenir du tampon [500 mM de KCL, 100 mM de Tris/HCl (pH 9,0 à 25 °C) et 1 % de Triton® X-100], 2,5 mM de MgCl2, 0,2 mM de mélange dNTP, 1 μM d'amorces sens et antisens, 0,02 unités μl– 1 d'ADN Taq polymérase, et 10 à 100 ng d'ADN extrait. Après dénaturation de l'ADN à 94 °C pendant 5 minutes, 30 cycles doivent être effectués, comme suit: dénaturation à 94 °C pendant une minute, hybridation à 55 °C pendant une minute, et élongation à 72 °C pendant une minute par kilopaire de bases. Une étape d'élongation finale de 10 minutes à 72 °C doit être effectuée. Pour la détection de M. refringens, la PCR doit être réalisée avec des amorces qui ciblent la région ITS1 (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ et 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).
Positive controls shall consist of genomic DNA from a highly infected host or plasmidic DNA including the target region.Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen.Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible.
Negative controls shall consist of genomic DNA from non-infected hosts and PCR reactives without target DNA.Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA.Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible.
A positive result shall be positive PCR amplification at the expected size (412 bp), with all negative controls being negative and all positive controls being positive.Et positivt resultat er positiv PCR-amplificering i den forventede størrelse (412 bp), idet alle negative kontroller skal være negative, og alle positive kontroller positive.Un résultat positif consiste en un produit d'amplification positif de la taille escomptée (412 pb), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.
I.3.3.   In-situ hybridisation (ISH)I.3.3.   In-situ-hybridisering (ISH)I.3.3.   Hybridation in situ
Several ISH protocols have been developed and published.Der er udarbejdet og offentliggjort en række ISH-protokoller.Plusieurs protocoles d'hybridation in situ ont été élaborés et publiés.
Probe that targets the SSU of the rRNA gene complex shall be used because it has been validated against histology.Der skal anvendes den probe, der er målrettet rRNA-genkompleksets SSU, fordi det er valideret i forhold til histologi.Il faut utiliser une sonde ciblant la petite sous-unité du complexe de gènes de l'ARNr car elle a été validée par rapport à l'histologie.
Sections of tissue that include gills, digestive gland, shall be fixed for at least 24 hours in Davidson's fixative followed by normal processing for paraffin histology. Sections of 5 μm shall be cut and placed on aminoalkylsilane-coated slides, which shall then be baked overnight in an oven at 40 °C. The sections shall be dewaxed by immersing in xylene for 10 minutes. This step shall be repeated once and then the solvent shall be eliminated by immersion in two successive absolute ethanol baths for 10 minutes each. The sections shall then be dehydrated by immersion in a graded ethanol series. The sections shall be treated with proteinase K (100 μg ml– 1) in TE buffer (Tris [50 mM], EDTA [10 mM]), at 37 °C for 30 minutes. Slides shall be dehydrated by immersion in a graded ethanol series and then air dried. Sections shall be incubated with 100 μl of hybridisation buffer (4 × SSC [standard saline citrate], 50 % formamide, 1 × Denhardt's solution, 250 μg ml– 1 yeast tRNA, 10 % dextran sulphate) containing 10 ng (1 μl of the PCR reactants prepared as described in point I.3.2 using primers CCG-GTG-CCA-GGT-ATA-TCT-CG and TTC-GGG-TGG-TCT-TGA-AAG-GC) of the digoxigenin-labelled probe. Sections shall be covered with in-situ plastic cover-slips and placed on a heating block at 95 °C for five minutes. Slides shall then be cooled on ice for one minute before overnight hybridisation at 42 °C in a humid chamber. Sections shall be washed twice for five minutes in 2 × SSC at room temperature, and once for 10 minutes in 0,4 × SSC at 42 °C. The detection steps shall be performed according to the manufacturer's instructions. The slides shall then be rinsed in sterile distilled water (dH2O). The sections shall be counter-stained with Bismarck Brown Yellow, rinsed in dH2O, and cover-slips shall be applied using an aqueous mounting medium.Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin. Snit på 5 μm skæres og anbringes på aminoalkylsilan-belagte objektglas, som derefter opvarmes natten over i en ovn ved 40 °C. Voksen fjernes ved at nedsænke snittene i xylen i 10 minutter. Dette trin skal gentages én gang, og derefter skal opløsningsmidlet fjernes ved nedsænkning i to på hinanden følgende bade med absolut ethanol af 10 minutters varighed hver. Derefter dehydreres snittene ved nedsænkning i ethanol i stigende koncentrationer. Snittene behandles med proteinase K (100 μg ml–1) i TE-buffer (Tris [50 mM], EDTA [10 mM]) ved 37 °C i 30 minutter. Objektglassene dehydreres ved nedsænkning i ethanol i stigende koncentrationer og lufttørres derefter. Snittene inkuberes med 100 μl hybridiseringsbuffer (4 × SSC [standardsaltcitrat], 50 % formamid, 1 × Denhardts opløsning, 250 μg ml–1 gær-tRNA, 10 % dextransulphat) indeholdende 10 ng (1 μl af de PCR-reaktanter, der er præpareret som beskrevet i punkt I.3.2 ved hjælp af primerne CCG-GTG-CCA-GGT-ATA-TCT-CG og TTC-GGG-TGG-TCT-TGA-AAG-GC) af den digoxigenin-mærkede probe. Snittene dækkes med in-situ-dækglas af plast og anbringes på en varmeblok ved 95 °C i fem minutter. Objektglassene afkøles derefter på is i ét minut inden hybridisering natten over ved 42 °C i et fugtkammer. Snittene vaskes 2 × 5 minutter i 2 × SSC ved rumtemperatur og 1 × 10 minutter i 0,4 × SSC ved 42 °C. Påvisningen skal udføres i henhold til fabrikantens anvisninger. Objektglassene skylles derefter i sterilt destilleret vand (dH2O). Snittene kontrastfarves med Bismarck Brown Yellow og skylles i dH2O, og dækglassene placeres ved hjælp af et vandigt monteringsmedium.Des fragments de tissus incluant branchies et glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine. Des coupes de 5 μm d'épaisseur doivent être réalisées et placées sur des lames recouvertes d'aminoalkylsilane, puis incubées pendant une nuit dans une étuve à 40 °C. Les coupes doivent être déparaffinées par immersion dans du xylène pendant 10 minutes. Cette étape doit être répétée une fois, puis le solvant doit être éliminé par immersion dans deux bains successifs d'éthanol absolu de 10 minutes chacun. Les coupes doivent ensuite être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante. Elles doivent ensuite être traitées à la protéinase K (100 μg ml– 1) dans un tampon TE [Tris (50 mM), EDTA (10 mM)], à une température de 37 °C pendant 30 minutes. Les lames doivent être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante puis séchées à l'air. Les coupes doivent être incubées avec 100 μl de tampon d'hybridation [4 × SSC (solution saline de citrate), formamide à 50 %, 1 × solution de Denhardt, 250 μg ml– 1 d'ARNt de levure, sulfate de dextrane à 10 %] contenant 10 ng (1 μl des réactifs de la PCR préparés comme décrit au point I.3.2 à l'aide des amorces CCG-GTG-CCA-GGT-ATA-TCT-CG et TTC-GGG-TGG-TCT-TGA-AAG-GC) de la sonde marquée à la digoxigénine. Les coupes doivent être recouvertes de lamelles couvre-objet en plastique pour hybridation in situ et placées sur un bloc chauffant à 95 °C pendant 5 minutes. Les lames doivent ensuite être refroidies sur de la glace pendant une minute avant l'hybridation à une température de 42 °C pendant une nuit dans une étuve humide. Les coupes doivent être lavées deux fois pendant cinq minutes dans 2 × SSC à température ambiante, et une fois pendant 10 minutes dans 0,4 × SSC à 42 °C. Les étapes de détection doivent être réalisées selon les instructions du fabricant. Les lames doivent ensuite être rincées dans de l'eau distillée stérile (dH2O). Les coupes doivent être contre-colorées au brun Bismarck Y et rincées dans dH2O avant l'application de lamelles couvre-objet à l'aide d'un milieu de montage aqueux.
Positive and negative controls shall be sections from known infected and non-infected hosts respectively.Positive og negative kontroller skal være snit fra henholdsvis kendte inficerede og kendte ikkeinficerede værter.Des coupes provenant d'hôtes infectés et non infectés connus servent respectivement de témoins positifs et négatifs.
A positive result shall be demonstrated by the purple-black labelling of M. refringens cells within known target tissues, with all negative controls being negative and all positive controls being positive.Et positivt resultat vises ved sort-lilla mærkning af M. refringens-celler i kendte målvæv, idet alle negative kontroller skal være negative, og alle positive kontroller positive.Un résultat positif doit être établi par la coloration violet-noire des cellules de M. refringens dans les tissus des organes cibles connus, tandis que tous les témoins négatifs sont négatifs et tous les témoins positifs sont positifs.
I.3.4.   SequencingI.3.4.   SekventeringI.3.4.   Séquençage
Sequencing shall be carried out as one of the final steps for confirmatory diagnostic. Targeted regions are the SSU rDNA and ITS1.Sekventering foretages som et af de sidste trin ved diagnosebekræftelse. Målregioner er SSU rDNA og ITS1.Le séquençage est une des dernières étapes requises pour confirmer le diagnostic. Les régions ciblées sont la petite sous-unité de l'ARNr et ITS1.
II.   Detailed diagnostic methods and procedures for surveillance and confirmation of infection with Marteilia refringensII.   Detaljerede diagnosemetoder og -procedurer for overvågning og bekræftelse af infektion med Marteilia refringensII.   Méthodes et procédures de diagnostic détaillées pour la surveillance et la confirmation de l'infection à Marteilia refringens
For the purpose of surveillance programmes and to confirm the presence of an infection with Marteilia refringens or to rule out a suspicion of that listed disease, in accordance with the requirements laid down in Section II of Part 4 to Annex I, the diagnostic methods and corresponding procedures to be used shall be in accordance with the guidelines laid down in Table 4.1 as follows:I forbindelse med overvågningsprogrammer og for at bekræfte forekomst af infektion med Marteilia refringens eller for at udelukke mistanke om denne listeopførte sygdom i overensstemmelse med kravene i bilag I, del 4, afsnit II, skal de diagnosemetoder og tilhørende procedurer, der skal anvendes, følge de retningslinjer, der er fastsat i tabel 4.1.Aux fins des programmes de surveillance et afin de confirmer la présence d'une infection à Marteilia refringens ou d'écarter une suspicion de cette maladie répertoriée, conformément aux exigences fixées à l'annexe I, partie 4, section II, les méthodes de diagnostic et les procédures correspondantes à utiliser doivent être conformes aux lignes directrices fournies dans le tableau 4.1 ci-dessous:
Table 4.1Tabel 4.1Tableau 4.1
Guidelines for the use of diagnostic methods for the surveillance programmes and to confirm or rule out infection with Marteilia refringensRetningslinjer for anvendelse af diagnosemetoder for overvågningsprogrammerne og til bekræftelse eller udelukkelse af infektion med Marteilia refringensLignes directrices concernant les méthodes de diagnostic à appliquer aux fins des programmes de surveillance et pour confirmer une infection à Marteilia refringens ou écarter une suspicion de cette maladie
Method | Targeted surveillance | Presumptive diagnosis | Confirmatory diagnosisMetode | Målrettet overvågning | Sandsynlig diagnose | Bekræftende diagnoseMéthode | Surveillance ciblée | Diagnostic de présomption | Diagnostic confirmatif
Digestive gland imprints | X | X | X, orAftryk af fordøjelseskirtel | X | X | X ellerEmpreintes de glande digestive | X | X | X, ou
Histopathology | X |   | X, orHistopatologi | X |   | X ellerHistopathologie | X |   | X, ou
In situ hybridisation |   |   | X, andIn situ-hybridisering |   |   | X ogHybridation in situ |   |   | X, et
PCR | X | X | X, andPCR | X | X | X ogPCR | X | X | X, et
Sequencing |   |   | XSekventering |   |   | XSéquençage |   |   | X
PART 5DEL 5PARTIE 5
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR THE SURVEILLANCE AND CONFIRMATION OF INFECTION WITH BONAMIA OSTREAEDETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTION MED BONAMIA OSTREAEMÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE L'INFECTION À BONAMIA OSTREAE
I.   Procedures for diagnosis of Infection with Bonamia ostreaeI.   Procedurer for diagnose af infektion med Bonamia ostreaeI.   Procédures pour le diagnostic de l'infection à Bonamia ostreae
When sampling and laboratory examination are carried out for the purpose of obtaining or maintaining a certain health status with regard to Bonamia ostreae as set out in Section I of Part 5 of Annex I or to confirm or rule out the presence of that listed disease in accordance with Article 57(b) of Directive 2006/88/EC, using the diagnostic methods set out in Section II of Part 5 of Annex I, the detailed diagnostic methods and procedures set out in following points I.1, I.2 and I.3 shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse for at opnå eller opretholde en bestemt sundhedsstatus med hensyn til Bonamia ostreae, jf. bilag I, del 5, afsnit I, eller for at bekræfte eller udelukke forekomst af denne listeopførte sygdom i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 5, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1, I.2 og I.3 nedenfor.Lorsque des prélèvements et des examens de laboratoire sont réalisés en vue de l'obtention ou de la conservation d'un certain statut sanitaire en ce qui concerne les infections à Bonamia ostreae comme indiqué à l'annexe I, partie 5, section I, ou afin de confirmer la présence de cette maladie répertoriée ou d'écarter une suspicion de cette maladie conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 5, section II, les méthodes et procédures détaillées figurant aux points I.1, I.2 et I.3 ci-après doivent être appliquées.
I.1.   Sample processI.1.   PrøveudtagningsprocedureI.1.   Procédure d'échantillonnage
Gaping or freshly dead individual molluscs shall be sampled by priority, to increase the chances of finding infected animals.Bløddyr med åbne skaller eller nyligt døde bløddyr skal prioriteres ved prøveudtagningen for at øge chancerne for at finde inficerede dyr.Les mollusques bâillants ou qui viennent de mourir doivent être prélevés en priorité afin d'accroître les chances de trouver des animaux infectés.
Once sampled, oysters shall be maintained at 4 °C or on refrigerated ice for no more than 24 hours if samples include gaping molluscs and 72 hours if not, in a plastic bag including a label with details related to the nature and the origin of the oysters. Gaping or freshly dead molluscs shall be maintained separately from other molluscs.De indsamlede østers opbevares ved 4 °C eller på køleis i højst 24 timer, hvis der er bløddyr med åbne skaller, og 72 timer, hvis dette ikke er tilfældet; de skal opbevares i en plastpose med en etiket med oplysninger om østernes art og oprindelse. Bløddyr med åbne skaller eller nyligt døde bløddyr skal opbevares adskilt fra andre bløddyr.Une fois prélevées, les huîtres doivent être maintenues à 4 °C ou réfrigérées sur de la glace pendant 24 heures au maximum si les échantillons comprennent des mollusques bâillants et pendant 72 heures dans le cas contraire, dans un sac en plastique muni d'une étiquette sur laquelle figurent des informations relatives à la nature et à l'origine des huîtres. Les mollusques bâillants ou qui viennent de mourir doivent être séparés des autres mollusques.
A 3 to 5 mm thick section of tissues including gills and heart tissue shall be used for the diagnostic of Bonamia ostreae by histology. A piece of digestive gland shall be used for some tests, including imprints and polymerase chain reaction (PCR).Et 3-5 mm tykt vævssnit, der omfatter væv fra hjerte og gæller, skal anvendes til diagnosticering af Bonamia ostreae ved hjælp af histologi. Et stykke af fordøjelseskirtlen skal anvendes til visse test, bl.a. aftryk og polymerasekædereaktion (PCR).Une coupe de tissus incluant les branchies et du tissu cardiaque, de 3 à 5 mm d'épaisseur, doit être utilisée pour le diagnostic histologique de Bonamia ostreae. Un morceau de la glande digestive doit être utilisé pour certains tests, y compris pour les empreintes et la réaction en chaîne par polymérase (PCR).
I.2.   Microscopic techniquesI.2.   Mikroskopiske teknikkerI.2.   Techniques microscopiques
I.2.1.   Cytology (imprint cytology)I.2.1.   Cytologi (aftrykscytologi)I.2.1.   Cytologie (cytologie sur empreinte)
After drying gills or heart tissues on absorbent paper, several imprints shall be made on a glass slide. Slides shall be air-dried, fixed in methanol or in absolute ethanol and stained using a commercially available blood-staining kit (namely such as Diff- Quik®/Hemacolor®.), in accordance with the manufacturer's instructions. After rinsing in tap water and drying, the slides shall be mounted with a cover-slip using an appropriate synthetic resin. Slides shall be observed first at × 200 magnification and then under oil immersion at × 1 000 magnification.Efter tørring af væv fra gæller eller hjerte på absorberende papir skal der tages en række aftryk på et objektglas. Objektglassene skal lufttørres, fikseres i methanol eller i absolut ethanol og farves med et kommercielt tilgængeligt kit til farvning af blod (f.eks. Diff-Quick®/Hemacolor®) i henhold til fabrikantens anvisninger. Efter skylning i ledningsvand og tørring skal objektglassene monteres med dækglas ved hjælp af en egnet syntetisk harpiks. Dækglassene observeres først ved 200 × forstørrelse og derefter i immersionsolie ved 1 000 × forstørrelse.Après séchage des tissus branchiaux ou cardiaques sur du papier absorbant, plusieurs empreintes doivent être réalisées sur une lame de verre. Les lames doivent être séchées à l'air, fixées au méthanol ou à l'éthanol absolu et colorées à l'aide d'un kit de coloration disponible dans le commerce (tel que Diff-Quick®/Hemacolor®) conformément aux instructions du fabricant. Après rinçage à l'eau du robinet et séchage, les lames doivent être montées avec une lamelle couvre-objet à l'aide d'une résine synthétique appropriée. Les lames doivent être observées dans un premier temps à un grossissement de × 200, puis en immersion dans l'huile, à un grossissement de × 1 000.
A positive result shall be the presence of small spherical or ovoid organisms (2 to 5 μm wide) within haemocytes. However, the parasite might also occur extracellularly. These organisms show a basophilic cytoplasm and an eosinophilic nucleus (colours may vary with the stain used) and, because they spread on the slide, they can appear wider on imprints than on histological examination. Multinucleated cells may be observed. The technique is not parasite species specific.Et positiv resultat er forekomst af små sfæriske eller ovoide organismer (2-5 μm brede) inden i hæmocytterne. Parasitten kan dog også forekomme ekstracellulært. Disse organismer har et basofilt cytoplasma og en eosinofil cellekerne (farverne kan variere afhængigt af den anvendte farve), og fordi de spredes ud på objektglasset, kan de virke bredere på aftryk end ved histologisk undersøgelse. Der kan iagttages multinukleære celler. Teknikken er ikke artsspecifik for parasitter.Un résultat positif doit être constaté en présence de petits organismes sphériques ou ovoïdes (2 à 5 μm de large) à l'intérieur des hémocytes. Toutefois, le parasite peut également être présent à l'extérieur des cellules. Ces organismes ont un cytoplasme basophile et un noyau éosinophile (les couleurs peuvent varier en fonction du colorant utilisé) et, comme ils s'étalent sur la lame, ils peuvent paraître plus grands sur les empreintes qu'à l'examen histologique. Des cellules multinuclées peuvent être observées. La technique n'est pas spécifique de l'espèce parasite.
I.2.2.   HistologyI.2.2.   HistologiI.2.2.   Analyse histologique
Sections of tissue that include gills and digestive gland, shall be fixed for a period of at least 24 hours in Davidson's fixative followed by normal processing for paraffin histology and staining, for example with haematoxylin and eosin. Observations shall be made at increasing magnifications up to × 1 000.Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin og farvning, f.eks. med hæmatoxylin og eosin. Der foretages observationer ved stadig kraftigere forstørrelse op til 1 000 ×.Des fragments de tissus incluant les branchies et la glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine et coloration, par exemple à l'hématoxyline et à l'éosine. Les observations doivent être effectuées à des grossissements croissants, jusqu'à × 1 000.
A positive result shall be the presence of parasites as very small cells of 2 to 5 μm wide within the haemocytes or free in the connective tissue or sinuses of gill, gut and mantle epithelium, often associated with an intense inflammatory reaction. To avoid any doubt, the parasite shall be observed inside the haemocyte for a positive diagnosis. The technique is not parasite species specific.Et positivt resultat er forekomst af parasitter som meget små celler, der er 2-5 μm brede, inden i hæmocytterne eller frie i bindevævet eller sinus i gæller, tarm og kappeepitel, hvilket ofte kædes sammen med en intensiv inflammatorisk reaktion. For at undgå enhver tvivl skal parasitten iagttages inden i hæmocytten med henblik på en positiv diagnose. Teknikken er ikke artsspecifik for parasitter.Un résultat positif doit être établi en présence de parasites sous la forme de très petites cellules de 2 à 5 μm de large à l'intérieur des hémocytes ou libres dans le tissu conjonctif ou les sinus de l'épithélium des branchies, du tube digestif et du manteau, souvent associés à une réaction inflammatoire intense. Pour dissiper tout doute, le parasite doit être observé à l'intérieur de l'hémocyte afin de mettre en évidence un diagnostic positif. La technique n'est pas spécifique de l'espèce parasite.
I.3.   Molecular techniquesI.3.   Molekylære teknikkerI.3.   Techniques moléculaires
I.3.1.   DNA extractionI.3.1.   DNA-ekstraktionI.3.1.   Extraction de l'ADN
DNA shall be extracted in accordance with standard procedures.DNA skal ekstraheres i henhold til standardprocedurerne.L'ADN doit être extrait conformément aux procédures standard.
DNA extraction kits, which are available commercially and usually produce high quality DNA suitable for use with the PCR protocols as detailed below, may be used.Der kan anvendes DNA-ekstraktionskit, der er kommercielt tilgængelige og normalt giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er beskrevet nedenfor.Il est possible d'utiliser des kits d'extraction de l'ADN disponibles dans le commerce, qui produisent généralement de l'ADN de haute qualité utilisable pour les protocoles de PCR, comme indiqué ci-après.
I.3.2.   Polymerase chain reaction (PCR)I.3.2.   Polymerasekædereaktion (PCR)I.3.2.   Amplification en chaîne par polymérase (PCR)
Several PCR protocols have been developed and published.Der er udarbejdet og offentliggjort en række PCR-protokoller.Plusieurs protocoles de PCR ont été élaborés et publiés.
Two PCR protocols targeting the small subunit (SSU) rDNA may be used:Der kan anvendes to PCR-protokoller, der er målrettet den lille underenhed (SSU) af rDNA:Deux protocoles de PCR ciblant la petite sous-unité de l'ADNr peuvent être utilisés:
(a) | the first one is a conventional PCR that amplify several members of the Haplosporidia including Bonamia spp. Primers designated Bo and Boas are 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ and 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′ respectively, and amplify a 300 bp product. PCR mixtures contain buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 at 25 °C] and 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward and reverse primers, 0,02 units μl– 1 Taq DNA polymerase, and 0,2 ng μl– 1 of the DNA template in a total volume of 50 μl. Samples shall be denatured in a thermocycler for five minutes at 94 °C before being submitted to 30 cycles (94 °C for one minute, 55 °C for one minute, 72 °C for one minute) followed by a final extension of 10 minutes at 72 °C. | Positive controls shall consist of genomic DNA from a highly infected host or plasmidic DNA including the target region. | Negative controls shall consist of genomic DNA from non-infected hosts and PCR reactives without target DNA. | A positive result shall be positive PCR amplification at the expected size (namely, 300 bp), with all negative controls being negative and all positive controls being positive;a) | Den første er en konventionel PCR, der amplificerer adskillige medlemmer af Haplosporidia, herunder Bonamia spp. Primerne, som betegnes Bo og Boas, er henholdsvis 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ og 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′ og amplificerer et produkt på 300 bp. PCR-blandinger indeholder buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 ved 25 °C] og 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward og reverse primere, 0,02 enheder μl–1 Taq DNA-polymerase og 0,2 ng μl–1 af DNA-templatet i en samlet mængde på 50 μl. Prøverne denatureres i en thermocykler i fem minutter ved 94 °C efterfulgt af 30 cyklusser (94 °C i ét minut, 55 °C i et minut, 72 °C i ét minut) med en afsluttende elongering i 10 minutter ved 72 °C. | Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen. | Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA. | Et positivt resultat er positiv PCR-amplificering i den forventede størrelse (dvs. 300 bp), idet alle negative kontroller skal være negative, og alle positive kontroller positive.a) | le premier est un protocole de PCR classique permettant d'amplifier plusieurs membres du phylum des Haplosporidia, dont Bonamia spp. Les amorces, dénommées Bo et Boas, sont respectivement 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ et 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′, et elles amplifient un produit de 300 pb. Les mélanges pour PCR contiennent du tampon [500 mM de KCL, 100 mM de Tris/HCl (pH 9,0 à 25 °C) et 1 % de Triton® X-100], 2,5 mM de MgCl2, 0,2 mM de mélange dNTP, 1 μM d'amorces sens et antisens, 0,02 unités μl– 1 d'ADN Taq polymérase, et 0,2 ng μl– 1 de la matrice d'ADN dans un volume total de 50 μl. Les échantillons doivent être dénaturés dans un thermocycleur pendant cinq minutes à 94 °C avant d'être soumis à 30 cycles (94 °C pendant une minute, 55 °C pendant une minute, 72 °C pendant une minute), suivis d'une étape finale d'élongation à 72 °C pendant 10 minutes. | Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible. | Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible. | Un résultat positif consiste en un produit d'amplification positif de la taille escomptée (c.-à-d. 300 pb), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs;
(b) | the second PCR protocol is a SYBR® Green Real time PCR assay. It allows the specific detection of B. ostreae (described below) and may be combined with a SYBR® Green Real time PCR assay allowing the specific detection of B. exitiosa (Ramilo et al. 2013). | Primers BOSTRE-F (5′- TTACGTCCCTGCCCTTTGTA-3′) and BOSTRE-R (5′- TCGCGGTTGAATTTTATCGT-3′) amplify a 208 bp product. PCR mixtures contain SYBR® Green Master Mix (1X), 0,3 μM forward and reverse primers, and 200 ng of extracted DNA. Samples shall be denatured in a Real Time Detection System for 10 minutes at 95 °C before being submitted to 35 cycles (95 °C for 30 seconds, 55 °C for 45 seconds and 72 °C for one minute). Melting temperature curve analysis shall be carried out with temperature increments of 0,5 °C/s starting at 55 °C and ending at 95 °C and recording fluorescence at each change of temperature. | Positive controls shall consist in genomic DNA from a highly infected host or plasmidic DNA including the target region. | Negative controls shall consist in genomic DNA from non-infected hosts and PCR reactives without target DNA. | A positive result shall be positive PCR amplification with a unique melting temperature peak (78,25 ± 0,25 °C in the conditions published by Ramilo et al. 2013), with all negative controls being negative and all positive controls being positive.b) | Den anden PCR-protokol er en SYBR® Green realtids-PCR-metode. Den gør det muligt at påvise B. ostreae (beskrevet nedenfor) og kan kombineres med en SYBR® Green realtids-PCR-analyse, som gør det muligt at påvise B. exitiosa (Ramilo et al. 2013). | Primerne BOSTRE-F (5′- TTACGTCCCTGCCCTTTGTA-3′) og BOSTRE-R (5′- TCGCGGTTGAATTTTATCGT-3′) amplificerer et produkt på 208 bp. PCR-blandinger indeholder SYBR® Green Master Mix (1X), 0,3 μM forward og reverse primere og 200 ng ekstraheret DNA. Prøverne denatureres i et Real Time Detection System i 10 minutter ved 95 °C efterfulgt af 35 cyklusser (95 °C i 30 sekunder, 55 °C i 45 sekunder og 72 °C i ét minut). Kurven over smeltetemperaturen skal analyseres med temperaturstigninger på 0,5 °C/s begyndende ved 55 °C og indtil 95 °C, idet fluorescens registreres ved hver temperaturændring. | Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen. | Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA. | Et positivt resultat er positiv PCR-amplificering med en unik maksimal smeltetemperatur (78,25 ± 0,25 °C under de betingelser, som er publiceret af Ramilo et al. 2013), idet alle negative kontroller er negative, og alle positive kontroller positive.b) | le second protocole de PCR est une PCR en temps réel au SYBR®Green. Elle permet la détection spécifique de B. ostreae (décrite ci-après) et peut être couplée à une PCR en temps réel au SYBR®Green permettant la détection spécifique de B. exitiosa (Ramilo et al., 2013). | Les amorces BOSTRE-F (5′-TTACGTCCCTGCCCTTTGTA-3′) et BOSTRE-R (5′-TCGCGGTTGAATTTTATCGT-3′) amplifient un produit de 208 pb. Les mélanges pour PCR contiennent un mélange SYBR® Green Master Mix (1X), 0,3 μM d'amorces sens et antisens et 200 ng d'ADN extrait. Les échantillons doivent être dénaturés dans un système de détection en temps réel pendant 10 minutes à 95 °C avant d'être soumis à 35 cycles (95 °C pendant 30 secondes, 55 °C pendant 45 secondes et 72 °C pendant une minute). L'analyse de la courbe de fusion est réalisée en augmentant la température de 55 à 95 °C par paliers de 0,5 °C/s et en mesurant l'intensité de fluorescence à chaque changement de température. | Les témoins positifs doivent consister en ADN génomique d'un hôte très infecté ou en ADN plasmidique incluant la région cible. | Les témoins négatifs doivent consister en ADN génomique d'hôtes non infectés et en réactifs de PCR exempts d'ADN cible. | Un résultat positif consiste en un produit d'amplification positif avec un seul pic de température de fusion (78,25 ± 0,25 °C dans les conditions publiées par Ramilo et al. en 2013), tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.
I.3.3.   In-situ hybridisation (ISH)I.3.3.   In-situ-hybridisering (ISH)I.3.3.   Hybridation in situ
Several ISH protocols have been developed and published.Der er udarbejdet og offentliggjort række ISH-protokoller.Plusieurs protocoles d'hybridation in situ ont été élaborés et publiés.
A probe that targets the SSU of the rDNA gene complex shall be used although it was shown to cross react with some other members of the family Haplosporidia.Der skal anvendes en probe målrettet rDNA-genkompleksets SSU, selv om den har vist sig at krydsreagere med visse andre medlemmer af Haplosporidia-familien.Une sonde ciblant la petite sous-unité du complexe de gènes de l'ADNr doit être utilisée, même s'il a été démontré qu'elle pouvait interagir avec certains autres membres du phylum des Haplosporidia.
Sections of tissue that include gills and digestive gland shall be fixed for a period of at least 24 hours in Davidson's fixative followed by normal processing for paraffin histology. Sections of 5 μm shall be cut and placed on aminoalkylsilane-coated slides, which shall then be baked overnight in an oven at 40 °C. The sections shall be dewaxed by immersing in xylene for 10 minutes. This step shall be repeated once and then the solvent shall be eliminated by immersion in two successive absolute ethanol baths for 10 minutes each. The sections shall then be dehydrated by immersion in a graded ethanol series. The sections shall be treated with proteinase K (100 μg ml– 1) in TE buffer (Tris [50 mM], EDTA [10 mM]), at 37 °C for 30 minutes. Slides shall be dehydrated by immersion in a graded ethanol series and then air dried. Sections shall be incubated with 100 μl of hybridisation buffer (4 × SSC [standard saline citrate], 50 % formamide, 1 × Denhardt's solution, 250 μg ml– 1 yeast tRNA, 10 % dextran sulphate) containing 20 ng (2 μl of the PCR reaction prepared as described in point I.3.2 using primers Bo and Boas) of the digoxigenin-labelled probe. Sections shall be covered with in-situ plastic cover-slips and placed on a heating block at 95 °C for five minutes. Slides shall then be cooled on ice for one minute before overnight hybridisation at 42 °C in a humid chamber. Sections shall be washed twice for five minutes in 2 × SSC at room temperature, and once for 10 minutes in 0,4 × SSC at 42 °C. The detection steps shall be performed according to the manufacturer's instructions. The slides shall then be rinsed in sterile distilled water (dH2O). The sections shall be counter-stained with Bismarck Brown Yellow, rinsed in dH2O, and cover-slips shall be applied using an aqueous mounting medium.Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin. Snit på 5 μm skæres og anbringes på aminoalkylsilan-belagte objektglas, som derefter opvarmes natten over i en ovn ved 40 °C. Voksen fjernes ved at nedsænke snittene i xylen i 10 minutter. Dette trin skal gentages én gang, og derefter skal opløsningsmidlet fjernes ved nedsænkning i to på hinanden følgende bade med absolut ethanol af 10 minutters varighed hver. Derefter dehydreres snittene ved nedsænkning i ethanol i stigende koncentrationer. Snittene behandles med proteinase K (100 μg ml– 1) i TE-buffer (Tris [50 mM], EDTA [10 mM]) ved 37 °C i 30 minutter. Objektglassene dehydreres ved nedsænkning i ethanol i stigende koncentrationer og lufttørres derefter. Snittene inkuberes med 100 μl af hybridiseringsbuffer (4 × SSC [standardsaltcitrat], 50 % formamid, 1 × Denhardts opløsning, 250 μg ml– 1 gær-tRNA, 10 % dextransulphat) indeholdende 20 ng (2 μl af PCR-reaktionen, der er præpareret som beskrevet i punkt I.3.2 ved hjælp af primerne Bo og Boas) af den digoxigenin-mærkede probe. Snittene dækkes med in-situ-dækglas af plastik og anbringes på en varmeblok ved 95 °C i fem minutter. Objektglassene afkøles derefter på is i ét minut inden hybridisering natten over ved 42 °C i et fugtkammer. Snittene vaskes 2 × 5 minutter i 2 × SSC ved rumtemperatur og 1 × 10 minutter i 0,4 × SSC ved 42 °C. Påvisningen skal udføres i henhold til fabrikantens anvisninger. Objektglassene skylles derefter i sterilt destilleret vand (dH2O). Snittene kontrastfarves med Bismarck Brown Yellow og skylles i dH2O, og dækglassene placeres ved hjælp af et vandigt monteringsmedium.Des fragments de tissus incluant branchies et glande digestive doivent être fixés pendant au moins 24 heures dans du fixateur de Davidson, puis préparés normalement pour un examen histologique après inclusion en paraffine. Des coupes de 5 μm d'épaisseur doivent être réalisées et placées sur des lames recouvertes d'aminoalkylsilane, puis incubées pendant une nuit dans une étuve à 40 °C. Les coupes doivent être déparaffinées par immersion dans du xylène pendant 10 minutes. Cette étape doit être répétée une fois, puis le solvant doit être éliminé par immersion dans deux bains successifs d'éthanol absolu de 10 minutes chacun. Les coupes doivent ensuite être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante. Elles doivent ensuite être traitées à la protéinase K (100 μg ml– 1) dans un tampon TE [Tris (50 mM), EDTA (10 mM)], à une température de 37 °C pendant 30 minutes. Les lames doivent être déshydratées par immersion dans une série de bains d'éthanol de concentration croissante puis séchées à l'air. Les coupes doivent être incubées avec 100 μl de tampon d'hybridation [4 × SSC (solution saline de citrate), 50 % de formamide, 1 × solution de Denhardt, 250 μg ml– 1 d'ARNt de levure, 10 % de sulfate de dextrane] contenant 20 ng (2 μl de la réaction de PCR préparés comme décrit au point I.3.2 à l'aide des amorces Bo et Boas) de la sonde marquée à la digoxigénine. Les coupes doivent être recouvertes de lamelles couvre-objet en plastique pour hybridation in situ et placées sur un bloc chauffant à 95 °C pendant 5 minutes. Les lames doivent ensuite être refroidies sur de la glace pendant une minute avant l'hybridation à une température de 42 °C pendant une nuit dans une étuve humide. Les coupes doivent être lavées deux fois pendant cinq minutes dans 2 × SSC à température ambiante, et une fois pendant 10 minutes dans 0,4 × SSC à 42 °C. Les étapes de détection doivent être réalisées selon les instructions du fabricant. Les lames doivent ensuite être rincées dans de l'eau distillée stérile (dH2O). Les coupes doivent être contre-colorées au brun Bismarck Y et rincées dans dH2O avant l'application de lamelles couvre-objet à l'aide d'un milieu de montage aqueux.
Positive and negative controls shall be sections from known infected and non-infected hosts respectively.Positive og negative kontroller skal være snit fra henholdsvis kendte inficerede og kendte ikkeinficerede værter.Des coupes provenant d'hôtes infectés et non infectés connus servent respectivement de témoins positifs et négatifs.
A positive result shall correspond to labelled parasites inside the haemocytes, with all negative controls negative and all positive controls positive.Et positivt resultat skal svare til de mærkede parasitter inden i hæmocytterne, idet alle negative kontroller skal være negative, og alle positive kontroller positive.Un résultat positif consiste en parasites marqués à l'intérieur des hémocytes, tandis que tous les témoins négatifs sont négatifs et que tous les témoins positifs sont positifs.
I.3.4.   SequencingI.3.4.   SekventeringI.3.4.   Séquençage
Sequencing shall be carried out as one of the final steps for confirmatory diagnostic. Targeted regions shall be the SSU rDNA and ITS1.Sekventering foretages som et af de sidste trin ved diagnosebekræftelse. Målregioner er SSU rDNA og ITS1.Le séquençage est une des dernières étapes requises pour confirmer le diagnostic. Les régions ciblées sont la petite sous-unité de l'ARNr et ITS1.
II.   Procedures for surveillance and confirmation of infection with Bonamia ostreaeII.   Procedurer for overvågning og bekræftelse af infektion med Bonamia ostreaeII.   Procédures de surveillance et de confirmation de l'infection à Bonamia ostreae
For the purpose of surveillance and confirmation of the presence of or to rule out a suspicion of infection with Bonamia ostreae in accordance with the requirements laid down in Section II of Part 5 to Annex I, the diagnostic methods and corresponding procedures to be used shall be in accordance with the guidelines laid down in the following Table 5.1.I forbindelse med overvågning og bekræftelse af forekomst af eller for at udelukke mistanke om infektion med Bonamia ostreae i overensstemmelse med kravene i bilag I, del 5, afsnit II, skal de diagnosemetoder og tilhørende procedurer, der skal anvendes, følge de retningslinjer, der er fastsat i tabel 5.1.Aux fins de la surveillance des infections à Bonamia ostreae et pour confirmer la présence d'une telle infection ou écarter une suspicion de cette maladie conformément aux exigences fixées à l'annexe I, partie 5, section II, les méthodes de diagnostic et les procédures correspondantes à utiliser doivent être conformes aux lignes directrices fournies dans le tableau 5.1 ci-dessous:
Table 5.1Tabel 5.1Tableau 5.1
Guidelines for the use of diagnostic methods for the surveillance programmes and to rule out or confirm infection with Bonamia ostreaeRetningslinjer for anvendelse af diagnosemetoder for overvågningsprogrammerne og til udelukkelse eller bekræftelse af infektion med Bonamia ostreaeLignes directrices concernant les méthodes de diagnostic à appliquer aux fins des programmes de surveillance et pour confirmer une infection à Bonamia ostreae ou écarter une suspicion de cette maladie
Method | Targeted surveillance | Presumptive diagnosis | Confirmatory diagnosisMetode | Målrettet overvågning | Sandsynlig diagnose | Bekræftende diagnoseMéthode | Surveillance ciblée | Diagnostic de présomption | Diagnostic confirmatif
Heart or gill imprints | X | X | X, orAftryk af hjerte eller gæller | X | X | X ellerEmpreintes de cœur ou de branchies | X | X | X, ou
Histopathology | X |   | X, orHistopatologi | X |   | X ellerHistopathologie | X |   | X, ou
In situ hybridisation |   |   | X, andIn situ-hybridisering |   |   | X ogHybridation in situ |   |   | X, et
PCR | X | X | X, andPCR | X | X | X ogPCR | X | X | X, et
Sequencing |   |   | XSekventering |   |   | XSéquençage |   |   | X
PART 6DEL 6PARTIE 6
DETAILED DIAGNOSTIC METHODS AND PROCEDURES FOR SURVEILLANCE AND CONFIRMATION OF WHITE SPOT DISEASE (WSD)DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF WHITE SPOT DISEASE (WSD)MÉTHODES ET PROCÉDURES DE DIAGNOSTIC DÉTAILLÉES POUR LA SURVEILLANCE ET LA CONFIRMATION DE LA MALADIE DES POINTS BLANCS (MPB)
1.   Diagnostic procedures for detection of WSSV1.   Diagnoseprocedurer for påvisning af WSSV1.   Procédures de diagnostic pour la détection du virus du syndrome des points blancs (VSPB)
When sampling and laboratory examination for the purpose of the surveillance and eradication programmes set out in Section I of Part 6 of Annex I and for the confirmation of the presence of or to rule out a suspicion of infection with WSSV are carried out in accordance with Article 57(b) of Directive 2006/88/EC, using the diagnostic methods set out in Section II of Part 6 of Annex I, the detailed diagnostic methods and procedures set out in points 2 to 7 of this Part shall apply.Hvis der foretages prøveudtagning og laboratorieundersøgelse i forbindelse med overvågnings- og udryddelsesprogrammerne i bilag I, del 6, afsnit I, for at bekræfte forekomst af eller udelukke mistanke om infektion med WSSV i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 6, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt 2-7 nedenfor.Lorsque des prélèvements et des examens de laboratoire sont réalisés aux fins des programmes de surveillance et d'éradication décrits à l'annexe I, partie 6, section I, et pour confirmer la présence du VSPB ou écarter une suspicion d'infection par ce virus conformément à l'article 57, point b), de la directive 2006/88/CE, à l'aide des méthodes de diagnostic énoncées à l'annexe I, partie 6, section II, les méthodes et procédures détaillées figurant aux points 2 à 7 de la présente partie doivent être appliquées.
The methods and procedures described in this Part of Annex II are adapted from the ISO 17025 accredited test applied at the European Union Reference Laboratory for Crustacean Diseases. Alternative approaches, using equivalent conditions or kits produced by different manufacturers, but which offer equivalent sensitivity and specificity to those described in this Part may be applied. In all instances, PCR amplified product shall be sequenced to confirm identity as White spot syndrome virus (WSSV).De metoder og procedurer, der er beskrevet i denne del af bilag II, er udarbejdet på grundlag af ISO 17025-akkrediterede test, som anvendes på EU-referencelaboratoriet for krebsdyrsygdomme. Der kan anvendes alternative tilgange, hvor der bruges tilsvarende betingelser eller kit, som er produceret af forskellige fabrikanter, men som giver en sensitivitet og specificitet svarende til dem, der er beskrevet i denne del. Det PCR-amplificerede produkt skal altid sekventeres for at bekræfte WSSV.Les méthodes et procédures décrites dans la présente partie de l'annexe II ont été adaptées d'après l'essai préconisé par les laboratoires accrédités selon la norme ISO 17025 réalisé au laboratoire de référence de l'Union européenne pour les maladies des crustacés. Il est possible de recourir à d'autres méthodes utilisant des conditions équivalentes ou des kits produits par d'autres fabricants, mais dont la sensibilité et la spécificité sont équivalentes à celles décrites dans la présente partie. Dans tous les cas, le produit amplifié par PCR doit être séquencé pour confirmer qu'il s'agit bien du virus du syndrome des points blancs (VSPB).
2.   Sample process2.   Prøveudtagningsprocedure2.   Procédure d'échantillonnage
Tissue (pleopods and gills) containing WSSV from crustaceans may be stored in ethanol, RNAlater or snap frozen at – 80 °C. The stages required for the identification of WSSV from tissue samples shall be as follows: Homogenisation of the tissue, extraction of the DNA, specific amplification of WSSV DNA using PCR, visualisation of the amplified product on a gel, purification of the DNA and sequencing to confirm the identity of the pathogen.Væv (pleopoder og gæller) indeholdende WSSV fra krebsdyr kan opbevares i ethanol eller RNAlater eller lynfryses ved – 80 °C. Følgende trin kræves for at identificere WSSV fra vævsprøver: homogenisering af vævet, ekstraktion af DNA'et, specifik amplificering af WSSV-DNA'et ved hjælp af PCR, visualisering af det amplificerede produkt på en gel, rensning af DNA'et og sekventering for at bekræfte patogenets identitet.Les tissus (pléopodes et branchies) de crustacés abritant le VSPB doivent être stockés dans de l'éthanol ou dans un réactif de stabilisation de l'ARN (RNAlater), ou surgelés à – 80 °C. Les étapes nécessaires à l'identification du VSPB à partir d'échantillons de tissus sont les suivantes: homogénéisation des tissus, extraction de l'ADN, amplification spécifique de l'ADN du VSPB par PCR, visualisation du produit amplifié sur un gel, purification de l'ADN et séquençage pour confirmer l'identité de l'agent pathogène.
3.   Tissue homogenisation3.   Vævshomogenisering3.   Homogénéisation des tissus
The disruption of the tissues and the preparation of a homogenate in an appropriate buffer shall be carried out using the Fast Prep tissue disruptor and Lysing matrix A tubes (MP Biomedicals). The tissue shall be weighed, placed in Lysing Matrix A tubes, diluted 1 in 10 w/v or according to manufacturer's instructions, in an appropriate buffer (G2 and 10 μl Proteinase K for use with DNA Tissue kit (Qiagen)) and homogenised using the Fast Prep 24 homogeniser for two minutes. Homogenised samples shall be incubated at 56 °C for a minimum period of four hours or overnight. Samples shall be vortexed, centrifuged at 9 000 rpm for two minutes and 50 μl of supernatant or a volume equivalent to 5 mg of tissue (weight of tissue optimal for extraction kit) shall be added to a sample tube for DNA extraction and volume made up to 200 μl using G2 buffer.Findeling af væv og tilberedning af et homogenat i en passende buffer foretages ved hjælp af Fast Prep-vævshomogenisator og Lysing Matrix A-rør (MP Biomedicals). Vævet vejes, anbringes i Lysing Matrix A-rør, fortyndes 1:10 w/v eller i henhold til fabrikantens anvisninger i en passende buffer (G2 og 10 μl proteinase K til anvendelse med DNA Tissue kit (Qiagen)) og homogeniseres med Fast Prep 24-homogenisator i to minutter. Homogeniserede prøver skal inkuberes ved 56 °C i mindst fire timer eller natten over. Prøverne vortexes og centrifugeres ved 9 000 rpm i to minutter, og 50 μl supernatant eller en mængde svarende til 5 mg væv (den vævsvægt, som er optimal for ekstraktionskittet) tilsættes til et prøverør til DNA-ekstraktion, og der fyldes op med G2 buffer til en volumen på i alt 200 μl.Le broyage des tissus et la préparation d'un homogénat dans un tampon approprié doivent être réalisés à l'aide du broyeur Fast Prep et de tubes Lysing matrix A (MP Biomedicals). Les tissus doivent être pesés, placés dans des tubes Lysing Matrix A, dilués au 1:10 m/v ou selon les instructions du fabricant dans un tampon approprié [G2 et 10 μl de protéinase K à utiliser avec le kit d'extraction de l'ADN de tissus DNA Tissue kit (Qiagen)] et homogénéisés à l'aide de l'homogénéisateur Fast Prep24 pendant deux minutes. Les échantillons homogénéisés doivent être incubés à 56 °C pendant au minimum quatre heures ou pendant une nuit. Les échantillons doivent ensuite être passés au vortex, centrifugés à 9 000 tr/min pendant deux minutes, puis 50 μl de surnageant ou un volume équivalant à 5 mg de tissus (poids de tissu optimal pour le kit d'extraction) doivent être ajoutés dans un tube échantillon pour extraction d'ADN et le volume doit être complété à 200 μl à l'aide de tampon G2.
4.   DNA extraction4.   DNA-ekstraktion4.   Extraction de l'ADN
Total DNA shall be extracted using a DNA tissue extraction kit and the EZ1 Advanced XL Biorobot (Qiagen) following the manufacturers' instructions. An extraction control (Calf Thymus DNA) and a negative control (G2 buffer) shall run with each batch of samples. DNA shall be eluted into 50 μl volume. To ensure that the extraction has completed successfully, the DNA concentration for all samples and controls shall be determined using a Nano Drop machine. Extracted DNA shall be frozen at – 20 °C if not required immediately.Det totale DNA skal ekstraheres med et DNA-ekstraktionskit til væv og EZ1 Advanced XL Biorobot (Qiagen) i henhold til fabrikantens anvisninger. For hver batch af prøver medtages en ekstraktionskontrol (kalvethymus-DNA) og en negativ kontrol (G2-buffer). DNA elueres i en mængde på 50 μl. For at sikre, at ekstraktionen er lykkedes, skal DNA-koncentrationen for alle prøver og kontroller bestemmes ved hjælp af en Nano Drop-maskine. Ekstraheret DNA fryses ved – 20 °C, hvis det ikke skal anvendes med det samme.L'ADN total doit être extrait à l'aide d'un kit d'extraction de l'ADN de tissus et du Biorobot EZ1 Advanced XL (Qiagen) suivant les instructions des fabricants. Un témoin d'extraction (ADN de thymus de veau) et un témoin négatif (tampon G2) doivent accompagner chaque lot d'échantillons. L'ADN doit être élué dans un volume de 50 μl. Pour s'assurer que l'extraction a réussi, la concentration d'ADN de tous les échantillons et de tous les témoins doit être déterminée à l'aide d'un NanoDrop. L'ADN extrait doit être congelé à – 20 °C s'il ne doit pas être utilisé immédiatement.
5.   WSSV Polymerase Chain Reaction (PCR)5.   WSSV-polymerasekædereaktion (PCR)5.   Amplification du VSPB par réaction en chaîne par polymérase (PCR)
The method to be used for the detection of WSSV shall be the protocol for the detection of WSSV by nested PCR set out in the following paragraphs which amplifies a 1 447 bp and an 848 bp amplicon of the 18s rRNA gene in the first and second round PCRs respectively.Den metode, der skal anvendes til påvisning af WSSV, er protokollen for påvisning af WSSV ved hjælp af nested PCR, som beskrives i de følgende afsnit, og som amplificerer 18s rRNA-genets 1 447 bp- og 848 bp-amplikon i henholdsvis første og anden PCR-runde.La méthode à utiliser pour la détection du VSPB est le protocole de détection du VSPB par PCR nichée décrit dans les paragraphes ci-après, qui permet d'obtenir respectivement lors de la première et de la deuxième phase de PCR un amplicon de 1 447 pb et un amplicon de 848 pb du gène codant pour l'ARNr 18S.
The 1st round PCR reaction shall be set up in a 50 μl volume which contains final concentrations of 1 × GoTaq Buffer (Promega), 5 mM MgCl2, 1 pmol/μl WSSV 146 F1 primer, 1 pmol/μl WSSV 146 R1 primer (Table 1), 0,25 mM dNTPs, 1,25U Taq polymerase and 2,5 μl of DNA. Each sample shall be run in duplicate alongside a negative extraction control, a negative PCR control, (2,5 μl H2O added instead of DNA) and a positive control. The positive control shall be diluted WSSV plasmid made and validated for use in-house (available from the EURL).Den første PCR-reaktionsrunde udføres i en volumen på 50 μl, som indeholder endelige koncentrationer af 1 × GoTaq Buffer (Promega), 5 mM MgCl2, 1 pmol/μl WSSV 146 F1 primer, 1 pmol/μl WSSV 146 R1 primer (tabel 1), 0,25 mM dNTPs, 1,25U Taq polymerase og 2,5 μl DNA. Hver prøve køres i duplikat sammen med en negativ ekstraktionskontrol, en negativ PCR-kontrol (tilsat 2,5 μl H2O i stedet for DNA) og en positiv kontrol. Den positive kontrol skal være fortyndet WSSV-plasmid, der er fremstillet og valideret til brug i laboratoriet (fås hos EU-referencelaboratoriet).La réaction de la première phase de PCR est mise en œuvre dans un volume de 50 μl contenant, en concentration finale, 1 × GoTaq Buffer (Promega), 5 mM de MgCl2, 1 pmol/μl d'amorce VSPB 146 F1, 1 pmol/μl d'amorce VSPB 146 R1 (tableau 1), 0,25 mM de dNTP, 1,25 U de Taq polymérase et 2,5 μl d'ADN. Chaque échantillon est dupliqué et associé à un témoin d'extraction négatif, un témoin PCR négatif (ajout de 2,5 μl de H2O au lieu d'ADN) et un témoin positif. Le témoin positif doit être constitué de plasmide de VSPB dilué préparé et validé pour une utilisation en interne (disponible auprès du laboratoire de référence de l'Union européenne).
The 2nd round WSSV PCR reaction shall be set up in the same way as the first round but using the WSSV 146 F2/R2 primer set and using a second positive control to check that this stage of the PCR has worked.Anden WSSV-PCR-reaktionsrunde udføres på samme måde som første runde, men med WSSV 146 F2/R2-primersættet og med yderligere en positiv kontrol for at tjekke, om dette trin i PCR har virket.La réaction de la 2e phase de PCR doit être mise en œuvre comme la première, mais en utilisant le jeu d'amorces VSPB 146 F2/R2 et un deuxième témoin positif pour vérifier que cette étape de la PCR a réussi.
Primer | SequencePrimer | SekvensAmorce | Séquence
WSSV 146 F1 | ACTACTAACTTCAGCCTATCTAGWSSV 146 F1 | ACTACTAACTTCAGCCTATCTAGWSSV 146 F1 | ACTACTAACTTCAGCCTATCTAG
WSSV 146 R1 | TAATGCGGGTGTAATGTTCTTACGAWSSV 146 R1 | TAATGCGGGTGTAATGTTCTTACGAWSSV 146 R1 | TAATGCGGGTGTAATGTTCTTACGA
WSSV 146 F2 | GTAACTGCCCCTTCCATCTCCAWSSV 146 F2 | GTAACTGCCCCTTCCATCTCCAWSSV 146 F2 | GTAACTGCCCCTTCCATCTCCA
WSSV 146 R2 | TACGGCAGCTGCTGCACCTTGTWSSV 146 R2 | TACGGCAGCTGCTGCACCTTGTWSSV 146 R2 | TACGGCAGCTGCTGCACCTTGT
Both 1st and 2nd round PCRs shall be run using the following cycling conditions on a DNA Engine Tetrad 2 Peltier Thermal Cycler (or equivalent). An initial denaturation step of 94 °C for two minutes followed by 94 °C for 30 seconds, 62 °C for 30 seconds, 72 °C for 30 seconds repeated for 30 cycles, a 72 °C extension step for two minutes and held at 4 °C.Både første og anden PCR-runde udføres under følgende cyklusbetingelser på en DNA Engine Tetrad 2 Peltier-thermocykler (eller tilsvarende). En første denaturering ved 94 °C i to minutter efterfulgt af 94 °C i 30 sekunder, 62 °C i 30 sekunder, 72 °C i 30 sekunder gentaget 30 gange, en elongering ved 72 °C i to minutter og fastholdes ved 4 °C.La première comme la seconde phase de la PCR sont mises en œuvre en appliquant la succession de cycles ci-après à l'aide d'un thermocycleur DNA Engine Tetrad 2 Peltier (ou équivalent): une étape initiale de dénaturation à 94 °C pendant 2 minutes, suivie d'une étape à 94 °C pendant 30 secondes, puis 62 °C pendant 30 secondes et 72 °C pendant 30 secondes, répétée pendant 30 cycles, une étape d'élongation à 72 °C pendant deux minutes et maintien à 4 °C.
6.   Gel electrophoresis6.   Gelelektroforese6.   Électrophorèse sur gel
Amplified PCR products from both the 1st and 2nd round PCRs shall be visualised on 2 % agarose gels made using TAE buffer. 15 μl of each sample shall be run at 120 Volts for approximately 20 minutes and viewed under UV light. Positive samples will produce a band of 1 447 bp in the 1st round PCR and 848bp in the second round PCR. Samples of that size shall be cut out and placed into a 1,5 ml microfuge tube. The DNA contained within the gel slices shall be purified using Promega Wizard® SV Gel and PCR clean-Up System according to manufacturers' instructions. The concentration of the DNA shall be estimated using a Nano Drop machine. The purified DNA shall be frozen at – 20 °C if not being used immediately.Amplificerede PCR-produkter fra både første og anden PCR-runde skal visualiseres på 2 % agarosegel med TAE-buffer. 15 μl af hver prøve køres ved 120 volt i ca. 20 minutter og undersøges under UV-lys. Positive prøver vil give et bånd på 1 447 bp i første PCR-runde og 848 bp i anden PCR-runde. Prøver af denne størrelse skal udskæres og anbringes i et 1,5 ml mikrocentrifugeglas. Det DNA, som findes i gelstykkerne, renses med Promega Wizard® SV Gel og PCR Clean-Up System i henhold til fabrikantens anvisninger. DNA-koncentrationen bestemmes ved hjælp af en NanoDrop-maskine. Det rensede DNA skal fryses ved 20 °C, hvis det ikke skal anvendes med det samme.Les produits amplifiés résultant de la première comme de la deuxième phase de la PCR doivent être visualisés sur des gels d'agarose à 2 % préparés à l'aide de tampon TAE. 15 μl de chaque échantillon doivent être soumis à une tension de 120 volts pendant environ 20 minutes, puis examinés en lumière ultraviolette. Les échantillons positifs produiront une bande de 1 447 pb lors de la première phase de PCR et de 848 pb lors de la seconde. Les échantillons de cette taille doivent être découpés et placés dans un microtube de centrifugation de 1,5 ml. L'ADN contenu dans les tranches de gel doit être purifié à l'aide du kit Wizard® SV Gel and PCR Clean-Up System de Promega conformément aux instructions du fabricant. La concentration de l'ADN doit être estimée à l'aide d'un NanoDrop. L'ADN purifié doit être congelé à – 20 °C s'il n'est pas utilisé immédiatement.
7.   Sequencing of PCR products7.   Sekventering af PCR-produkter7.   Séquençage des produits de PCR
DNA shall be sequenced using the Big Dye Terminator Kit v3,1 (Applied Biosystems). The total volume in each reaction is 20 μl, the final concentrations being 1 × Big Dye terminator, 1 × sequencing buffer, 10 pmol/μl forward or reverse primer and 10 μl of purified DNA (diluted to approximately 10 ng/μl) run using the following cycling conditions on a DNA Engine Tetrad 2 Peltier Thermal Cycler (or equivalent): 94 °C for 30 seconds followed by 96 °C for 10 seconds, 50 °C for 10 seconds and 60 °C for four minutes, cycling the last three steps 30 times.DNA sekventeres med BigDye Terminator Kit v3,1 (Applied Biosystems). Den samlede volumen i hver reaktion er 20 μl, idet de endelige koncentrationer er 1 × BigDye Terminator, 1 × sekventeringsbuffer, 10 pmol/μl forward eller reverse primer og 10 μl renset DNA (fortyndet til ca. 10 ng/μl); følgende cyklusbetingelser anvendes på en DNA Engine Tetrad 2 Peltier Thermal Cycler (eller tilsvarende): 94 °C i 30 sekunder efterfulgt af 96 °C i 10 sekunder, 50 °C i 10 sekunder og 60 °C i fire minutter, idet de sidste tre trin gentages 30 gange.L'ADN doit être séquencé à l'aide du kit Big Dye Terminator v3.1 (Applied Biosystems). Le volume total de chaque réaction est de 20 μl, les concentrations finales étant 1 × Big Dye Terminator, 1 × tampon de séquençage, 10 pmol/μl d'amorce sens ou antisens et 10 μl d'ADN purifié (dilué à environ 10 ng/μl), et la succession de cycles suivante est appliquée à l'aide d'un thermocycleur DNA Engine Tetrad 2 Peltier (ou équivalent): 94 °C pendant 30 secondes, suivi de 96 °C pendant 10 secondes, 50 °C pendant 10 secondes et à 60 °C pendant quatre minutes, les trois dernières étapes étant reproduites 30 fois.
The PCR products shall be precipitated using a sodium acetate method where 20 μl DNA is added to 10 μl NaAc, 70 μl H2O and 250 μl ethanol, vortexed and centrifuged at 13 000 rpm for 20 minutes, the supernatant shall be removed and the pellet shall be washed with 200 μl absolute ethanol, centrifuging at 13 000 rpm for five minutes. The pellet shall be dried for five minutes at 37 °C. 25 μl of Hi-Di formamide shall be added to the pellets, heated to 95 °C for two minutes and vortexed thoroughly. Samples shall be sequenced using the ABI3130xl Avant Genetic analyser according to manufacturers' instructions. Sequencing results shall be analysed using Sequencher software and sequences matched to sequences on the NCBI database using the BLAST function.PCR-produkterne udfældes ved hjælp af en natriumacetatmetode, hvor 20 μl DNA tilsættes til 10 μl NaAc, 70 μl H2O og 250 μl ethanol, vortexes og centrifugeres ved 13 000 rpm i 20 minutter, supernatanten fjernes, og pelleten vaskes med 200 μl absolut ethanol efterfulgt af centrifugering ved 13 000 rpm i fem minutter. Pelleten tørres i 5 minutter ved 37 °C. Pelleterne tilsættes 25 μl Hi-Di-formamid, opvarmes til 95 °C i to minutter og vortexes grundigt. Prøverne sekventeres ved hjælp af ABI 3130xl Avant Genetic Analyzer i henhold til fabrikantens anvisninger. Sekventeringsresultaterne skal analyseres med Sequencher-software, og sekvenserne skal ved hjælp af BLAST-funktionen matches med sekvenser i NCBI-databasen.Les produits de PCR doivent être précipités par une méthode à base d'acétate de sodium, dans le cadre de laquelle on ajoute 20 μl d'ADN à 10 μl de NaAc, 70 μl de H2O et 250 μl d'éthanol; le tout est passé au vortex et centrifugé à 13 000 tr/min pendant 20 minutes, puis le surnageant est éliminé et le culot est lavé avec 200 μl d'éthanol absolu et centrifugé à 13 000 tr/min pendant cinq minutes. Le culot doit être séché à 37 °C pendant cinq minutes. 25 μl de Hi-Di formamide doivent être ajoutés aux culots que l'on chauffe ensuite à 95 °C pendant deux minutes avant de mélanger avec soin au vortex. Les échantillons doivent être séquencés à l'aide de l'analyseur ABI 3130xl Avant Genetic conformément aux instructions du fabricant. Les résultats du séquençage doivent être analysés à l'aide du logiciel Sequencher et les séquences rapprochées de celles qui se trouvent dans la base de données du NCBI, à l'aide de la fonction BLAST.