EUR-Lex Access to European Union law

Back to EUR-Lex homepage

This document is an excerpt from the EUR-Lex website

Document 32015D1554

Durchführungsbeschluss (EU) 2015/1554 der Kommission vom 11. September 2015 mit Durchführungsbestimmungen zur Richtlinie 2006/88/EG hinsichtlich der Anforderungen an die Überwachung und der Diagnosemethoden (Bekanntgegeben unter Aktenzeichen C(2015) 6188) (Text von Bedeutung für den EWR)

OJ L 247, 23.9.2015, p. 1–62 (BG, ES, CS, DA, DE, ET, EL, EN, FR, HR, IT, LV, LT, HU, MT, NL, PL, PT, RO, SK, SL, FI, SV)

In force

ELI: http://data.europa.eu/eli/dec_impl/2015/1554/oj

23.9.2015   

DE

Amtsblatt der Europäischen Union

L 247/1


DURCHFÜHRUNGSBESCHLUSS (EU) 2015/1554 DER KOMMISSION

vom 11. September 2015

mit Durchführungsbestimmungen zur Richtlinie 2006/88/EG hinsichtlich der Anforderungen an die Überwachung und der Diagnosemethoden

(Bekanntgegeben unter Aktenzeichen C(2015) 6188)

(Text von Bedeutung für den EWR)

DIE EUROPÄISCHE KOMMISSION —

gestützt auf den Vertrag über die Arbeitsweise der Europäischen Union,

gestützt auf die Richtlinie 2006/88/EG des Rates vom 24. Oktober 2006 mit Gesundheits- und Hygienevorschriften für Tiere in Aquakultur und Aquakulturerzeugnisse und zur Verhütung und Bekämpfung bestimmter Wassertierkrankheiten (1), insbesondere auf Artikel 49 Absatz 3, Artikel 50 Absatz 4, Artikel 57 Buchstabe b und Artikel 61 Absatz 3,

in Erwägung nachstehender Gründe:

(1)

In der Richtlinie 2006/88/EG sind Mindestpräventivmaßnahmen für die Überwachung und Früherkennung der in Anhang IV der genannten Richtlinie aufgeführten Krankheiten (im Folgenden „aufgelistete Krankheiten“) bei Wassertieren festgelegt sowie die Bekämpfungsmaßnahmen, die bei einem Ausbruch der aufgelisteten Krankheiten oder bei Verdacht darauf zu ergreifen sind. Außerdem sind darin die Anforderungen festgelegt, denen Mitgliedstaaten oder deren Zonen oder Kompartimente genügen müssen, um den Seuchenfreiheitsstatus zuerkannt zu bekommen.

(2)

Die Tilgung aufgelisteter Krankheiten und die Erlangung des Seuchenfreiheitsstatus durch einen Mitgliedstaat, eine Zone oder ein Kompartiment sollten in der gesamten Union auf denselben Grundsätzen beruhen und nach demselben wissenschaftlichen Ansatz erfolgen. Daher müssen auf Unionsebene spezifische Anforderungen an Tilgungs- und Überwachungssysteme sowie an Probenahme- und Diagnosemethoden festgelegt werden, die von den Mitgliedstaaten zur Erlangung des Seuchenfreiheitsstatus für das gesamte Hoheitsgebiet eines Mitgliedstaats, für eine seiner Zonen oder für eines seiner Kompartimente zu verwenden sind.

(3)

Bei Bestätigung des Auftretens der aufgelisteten Krankheiten oder bei Verdacht darauf sollten unionsweit dieselben Laboruntersuchungen durchzuführen sein und sie sollten nach denselben wissenschaftlichen Standards und Protokollen erfolgen. Gemäß der Richtlinie 2006/88/EG müssen spezifische Diagnosemethoden und -verfahren festgelegt werden, die von den zu diesem Zweck von der zuständigen Behörde der Mitgliedstaaten benannten Labors einzusetzen sind.

(4)

Im Gesundheitskodex für Wassertiere der Weltorganisation für Tiergesundheit (OIE) sind Standards für die Verbesserung der Gesundheit von Wassertieren und des Wohls von Zuchtfischen weltweit festgelegt, darunter auch Standards für den sicheren internationalen Handel mit Wassertieren und deren Erzeugnissen. Mehrere Kapitel des Gesundheitskodexes für Wassertiere enthalten Empfehlungen bezüglich des Einsatzes bestimmter Diagnosetests. Solche Tests sind in dem OIE-Diagnosehandbuch für Wassertiere (im Folgenden „Wassertier-Diagnosehandbuch“) festgelegt. Damit gewährleistet ist, dass die Unionsanforderungen in Bezug auf die Diagnose von Wassertierkrankheiten den internationalen Standards entsprechen, sollten die in diesem Beschluss niedergelegten Regeln den Standards und Empfehlungen des Gesundheitskodexes für Wassertiere Rechnung tragen.

(5)

Für viele der aufgelisteten Krankheiten enthält das Wassertier-Diagnosehandbuch mehrere Tests und Verfahren für die Zwecke der Laboruntersuchungen. Um für die Diagnose der aufgelisteten Krankheiten eine einheitliche wissenschaftliche Grundlage auf Unionsebene zu schaffen, muss eine Auswahl unter den von der OIE empfohlenen Diagnosetests und -verfahren getroffen und präzisiert werden, welche Tests bei Laboruntersuchungen, die im Rahmen der Überwachungsprogramme und zur Ausräumung des Verdachts auf Vorliegen der aufgelisteten Krankheiten bzw. zur Bestätigung ihres Vorliegens durchgeführt werden, verpflichtend sein sollten. Für bestimmte Fälle müssen alternative Methoden und Verfahren verfügbar sein; es sollten eine Beschreibung und einige wissenschaftliche Erläuterungen dafür zur Verfügung gestellt werden, wann und wie diese alternativen Methoden angewendet werden können. Dies ist insbesondere bei den detaillierteren Diagnoseverfahren erforderlich.

(6)

Um präzise und reproduzierbare Diagnoseergebnisse zu erhalten, ist es wichtig, dass die zu verwendenden detaillierten Verfahren und Protokolle nach den einschlägigen Qualitätsstandards gemäß Anhang VI Teil I der Richtlinie 2006/88/EG validiert werden. Bei vielen der in diesem Beschluss genannten Diagnosemethoden ist die Verwendung kommerzieller Testkits ein notwendiger Teil des Diagnoseprotokolls; diese Testkits wurden in einem akkreditierten Test der europäischen Referenzlabors (EURL) für die jeweiligen Krankheiten validiert. Im Interesse rechtlicher Klarheit sollten die Bezeichnungen dieser validierten kommerziellen Testkits in diesem Beschluss namentlich aufgeführt werden.

(7)

Bestimmte Mitgliedstaaten könnten Schwierigkeiten haben, in Bezug auf eine oder mehrere aufgelistete Krankheiten für ihr gesamtes Hoheitsgebiet, eine Zone oder ein Kompartiment davon den Seuchenfreiheitsstatus zu erlangen. In einem solchen Fall wünscht der Mitgliedstaat den Seuchenfreiheitsstatus in Bezug auf diese aufgelisteten Krankheiten möglicherweise gar nicht zu erlangen oder zurückzuerhalten. Die Mindestbekämpfungsmaßnahmen, die anzuwenden sind, wenn der betreffende Mitgliedstaat den Seuchenfreiheitsstatus nicht zu erlangen oder zurückzuerhalten wünscht, sollten unionsweit identisch sein und identischen Kriterien genügen. Daher ist es im Einklang mit der Richtlinie 2006/88/EG erforderlich, detaillierte Regeln für die Eindämmung dieser aufgelisteten Krankheiten sowie die Mindestvoraussetzungen für die Aufhebung der betreffenden Eindämmungsmaßnahmen festzulegen.

(8)

In der Entscheidung 2001/183/EG der Kommission (2) sind die Anforderungen an Probenahmepläne und Diagnoseverfahren zur Erkennung und zum Nachweis der infektiösen hämatopoetischen Nekrose und der viralen hämorrhagischen Septikämie festgelegt, die zu den aufgelisteten Krankheiten gehören. In der Entscheidung 2003/466/EG der Kommission (3) sind die Anforderungen an Probenahmepläne und Diagnoseverfahren zur Erkennung der infektiösen Anämie der Lachse sowie Kriterien für die Zonenabgrenzung und die amtliche Überwachung bei Verdacht auf die betreffende Krankheit oder deren Feststellung festgelegt. In der Entscheidung 2002/878/EG der Kommission (4) sind die Anforderungen an Probenahmepläne und Diagnoseverfahren zur Erkennung und zum Nachweis der Weichtierkrankheiten Bonamiose und Marteiliose festgelegt. Die drei genannten Entscheidungen sollten zwecks Aktualisierung der Anforderungen durch diesen Beschluss ersetzt werden. Die Entscheidungen 2001/183/EG, 2002/878/EG und 2003/466/EG sollten daher aufgehoben werden.

(9)

Da einige Mitgliedstaaten Zeit benötigen, um ihre nationalen Referenzlabors auf die Einhaltung der in diesem Beschluss festgelegten neuen Anforderungen vorzubereiten, sollte dieser Beschluss ab dem 1. April 2016 gelten.

(10)

Die in diesem Beschluss vorgesehenen Maßnahmen entsprechen der Stellungnahme des Ständigen Ausschusses für Pflanzen, Tiere, Lebensmittel und Futtermittel —

HAT FOLGENDEN BESCHLUSS ERLASSEN:

Artikel 1

Gegenstand

Dieser Beschluss enthält Maßnahmen für

a)

die Überwachung, die Pufferzonen und die von den Mitgliedstaaten im Zusammenhang mit dem Seuchenstatus der Mitgliedstaaten, ihrer Zonen oder Kompartimente in Bezug auf die in Anhang IV Teil II der Richtlinie 2006/88/EG aufgeführten nicht exotischen Wassertierkrankheiten (im Folgenden „aufgelistete Krankheiten“) einzusetzenden Probenahme- und Diagnosemethoden,

b)

die im Rahmen der Laboruntersuchungen bei Bestätigung des Auftretens aufgelisteter Krankheiten oder bei Verdacht darauf einzusetzenden Diagnosemethoden und

c)

die Mindestbekämpfungsmaßnahmen, die bei Bestätigung des Auftretens einer aufgelisteten Krankheit oder bei Verdacht darauf in einem Mitgliedstaat, einer Zone oder einem Kompartiment zu treffen sind, der, die bzw. das nicht als frei von der betreffenden aufgelisteten Krankheit erklärt wurde.

Artikel 2

Begriffsbestimmungen

Für die Zwecke dieses Beschlusses gelten die folgenden Begriffsbestimmungen:

a)

„Virale Hämorrhagische Septikämie“ (VHS) bezeichnet eine Krankheit, die von dem Virus der viralen hämorrhagischen Septikämie (VHSV) verursacht wird, das auch als Egtved-Virus bezeichnet wird und zur Gattung der Novirhabdoviren der Familie der Rhabdoviridae gehört;

b)

„Infektiöse Hämatopoetische Nekrose“ (IHN) bezeichnet eine Krankheit, die von dem Virus der Infektiösen Hämatopoetischen Nekrose (IHNV) verursacht wird, das zur Gattung der Novirhabdoviren der Familie der Rhabdoviridae gehört;

c)

„Koi-Herpesvirus-Infektion“ (KHV-I) bezeichnet eine Krankheit, die von dem Koi-Herpesvirus (KHV) verursacht wird, das zur Familie der Alloherpesviridae gehört; die wissenschaftliche Bezeichnung lautet Cypriniden-Herpesvirus-3 (CyHV-3).

d)

„Infektiöse Anämie der Lachse“ (ISA) bezeichnet eine Krankheit, die durch eine Infektion mit dem HPR-deletierten Virus der Infektiösen Anämie der Lachse (ISAV) verursacht wird, das zur Gattung der Isaviren der Familie der Orthomyxoviridae gehört;

e)

Marteilia-refringens-Infektion“ bezeichnet eine Krankheit, die durch eine Infektion mit dem Paramyx-Einzeller Marteilia refringens verursacht wird;

f)

Bonamia-ostreae-Infektion“ bezeichnet eine Krankheit, die durch eine Infektion mit dem Haplosporidium-Einzeller Bonamia ostreae verursacht wird;

g)

„Weißpünktchenkrankheit der Krebstiere“ bezeichnet eine Krankheit, die durch das Weißpünktchen-Syndrom-Virus (WSSV) verursacht wird; dabei handelt es sich um ein doppelsträngiges DNA-Virus der Gattung Whispovirus der Familie Nimaviridae.

Artikel 3

Mindestanforderungen an Tilgungs- und Überwachungsprogramme

Die Mitgliedstaaten stellen sicher, dass sowohl die in Anhang I aufgeführten Vorschriften für Überwachungs- und Tilgungsprogramme, Pufferzonen sowie Probenahme- und Diagnosemethoden als auch die in Anhang II enthaltenen spezifischen Methoden und detaillierten Verfahren befolgt werden, wenn einem Mitgliedstaat bzw. einer seiner Zonen oder einem seiner Kompartimente der Seuchenfreiheitsstatus in Bezug auf eine oder mehrere aufgelistete Krankheiten zuerkannt, aberkannt oder erneut zuerkannt werden soll.

Artikel 4

Mindestanforderungen an Diagnosemethoden und spezifische Verfahren

Die Mitgliedstaaten stellen sicher, dass bei der Durchführung von Laboruntersuchungen zur Bestätigung oder zum Ausschluss des Vorliegens einer aufgelisteten Krankheit die in Anhang I aufgeführten Bekämpfungsmaßnahmen und die in Anhang II enthaltenen spezifischen Methoden und detaillierten Verfahren befolgt werden.

Artikel 5

Mindestbekämpfungsmaßnahmen zur Eindämmung aufgelisteter Krankheiten und Mindestanforderungen an die Aufhebung der betreffenden Maßnahmen in Mitgliedstaaten, Zonen bzw. Kompartimenten, die nicht als frei von aufgelisteten Krankheiten anerkannt sind

Die Mitgliedstaaten stellen sicher, dass die in Anhang I aufgeführten Mindestbekämpfungsmaßnahmen und Mindestanforderungen für die Aufhebung der betreffenden Maßnahmen befolgt werden, wenn in einem Mitgliedstaat, einer seiner Zonen bzw. einem seiner Kompartimente, der/die/das nicht als frei von diesen aufgelisteten Krankheiten anerkannt ist, Bekämpfungsmaßnahmen durchgeführt bzw. aufgehoben werden.

Artikel 6

Aufhebungen

Die Entscheidungen 2001/183/EG, 2002/878/EG und 2003/466/EG werden aufgehoben.

Artikel 7

Geltungsbeginn

Dieser Beschluss gilt ab dem 1. April 2016.

Artikel 8

Adressaten

Dieser Beschluss ist an die Mitgliedstaaten gerichtet.

Brüssel, den 11. September 2015

Für die Kommission

Vytenis ANDRIUKAITIS

Mitglied der Kommission


(1)  ABl. L 328 vom 24.11.2006, S. 14.

(2)  Entscheidung 2001/183/EG der Kommission vom 22. Februar 2001 zur Festlegung der Probenahmepläne und Diagnoseverfahren zur Erkennung und zum Nachweis bestimmter Fischseuchen und zur Aufhebung der Entscheidung 92/532/EWG (ABl. L 67 vom 9.3.2001, S. 65).

(3)  Entscheidung 2003/466/EG der Kommission vom 13. Juni 2003 mit Kriterien für die Zonenabgrenzung und die amtliche Überwachung bei Verdacht auf oder Feststellung der infektiösen Anämie der Lachse (ISA) (ABl. L 156 vom 25.6.2003, S. 61).

(4)  Entscheidung 2002/878/EG der Kommission vom 6. November 2002 zur Erstellung der Probenahmepläne und Diagnoseverfahren zur Erkennung und zum Nachweis der Weichtierkrankheiten Bonamiose (Bonamia ostreae) und Marteiliose (Marteilia refringens) (ABl. L 305 vom 7.11.2002, S. 57).


ANHANG I

ÜBERWACHUNGS- UND BEKÄMPFUNGSMETHODEN

I.   Einleitung

In diesem Anhang wird Folgendes dargelegt:

a)

Anforderungen an Tilgungs- und Überwachungsprogramme gemäß Artikel 44 der Richtlinie 2006/88/EG sowie die Probenahme- und Diagnosemethoden, die zu verwenden sind, um einen Mitgliedstaat, eine seiner Zonen oder eines seiner Kompartimente als seuchenfrei gemäß Kapitel VII der genannten Richtlinie zu erklären;

b)

die bei Laboruntersuchungen zur Bestätigung des Auftretens der nicht exotischen Krankheiten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG („aufgelistete Krankheiten“) oder bei Verdacht auf ein solches Auftreten einzusetzenden Probenahme- und Diagnosemethoden gemäß Artikel 28 Buchstabe a und Artikel 57 Buchstabe b der genannten Richtlinie;

c)

die bei Bestätigung des Auftretens einer aufgelisteten Krankheit gemäß Artikel 39 der Richtlinie 2006/88/EG zu treffenden Sperrmaßnahmen sowie die Maßnahmen, die erforderlich sind, damit einem Mitgliedstaat, einer Zone oder einem Kompartiment mit einem Gesundheitsstatus der Kategorie V der Gesundheitsstatus der Kategorie III zuerkannt werden kann.

Die in diesem Anhang aufgeführten Anforderungen gelten für folgende Krankheiten:

1.

Virale hämorrhagische Septikämie (VHS)

Teil 1

2.

Infektiöse hämatopoetische Nekrose (IHN)

Teil 1

3.

Koi-Herpesvirus-Infektion (KHV-I)

Teil 2

4.

Infektiöse Anämie der Lachse (ISA)

Teil 3

5.

Marteilia-refringens-Infektion

Teil 4

6.

Bonamia-ostreae-Infektion

Teil 5

7.

Weißpünktchenkrankheit der Krebstiere (WSD)

Teil 6

II.   Begriffsbestimmungen

Für die Zwecke der Anhänge I und II gelten folgende Begriffsbestimmungen:

a)

„Binnenkompartiment“ bezeichnet einen oder mehrere im Binnengebiet eines Mitgliedstaats oder mehrerer Mitgliedstaaten gelegene Betriebe, die einem gemeinsamen Biosicherheitssystem angehören und über eine Wassertierpopulation mit einem bestimmten Gesundheitsstatus in Bezug auf eine spezifische Seuche verfügen;

b)

„Binnenbetrieb“ bezeichnet einen Betrieb, in dem Tiere in Aquakultur gehalten werden und der im Binnengebiet eines Mitgliedstaats liegt;

c)

„Binnenzone“ bezeichnet ein im Binnengebiet eines Mitgliedstaats oder mehrerer Mitgliedstaaten gelegenes, genau abgegrenztes geografisches Gebiet mit einem homogenen System von Wasserressourcen, bestehend aus Teilen eines Wassereinzugsgebiets von der (den) Quelle(n) der Wasserläufe bis zu einem natürlichen oder künstlichen Hindernis, das die Aufwärtswanderung von Wassertieren aus den unteren Wasserläufen verhindert, aus einem gesamten Wassereinzugsgebiet von der (den) Quelle(n) bis zur Mündung oder — bedingt durch die epidemiologische Verbindung zwischen den Einzugsgebieten über die Mündung — mehreren Wassereinzugsgebieten, einschließlich der Mündungen;

d)

„offiziell für verseucht erklärter Betrieb“ bezeichnet einen Betrieb, in dem Wassertiere gehalten werden und in dem eine oder mehrere der aufgelisteten Krankheiten von der zuständigen Behörde gemäß Artikel 28 Buchstabe a, Artikel 29 und Artikel 57 Buchstabe b der Richtlinie 2006/88/EG bestätigt wurde(n);

e)

„Kontaktbetrieb“ bezeichnet einen Betrieb, in dem Wassertiere gehalten werden und der nachweislich mit infektiösem Material von einem offiziell für verseucht erklärten Betrieb kontaminiert wurde oder bei dem ein starker Verdacht auf eine solche Kontamination besteht.

TEIL 1

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG DER VIRALEN HÄMORRHAGISCHEN SEPTIKÄMIE (VHS) UND DER INFEKTIÖSEN HÄMATOPOETISCHEN NEKROSE (IHN)

I.   Anforderungen an Überwachungs- und Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf IHN und VHS und Eindämmungsmaßnahmen für die genannten aufgelisteten Krankheiten

I.1.   Allgemeine Anforderungen an Gesundheitsuntersuchungen und Probenahmen im Hinblick auf VHS und IHN:

a)

Die Gesundheitsuntersuchungen und gegebenenfalls die Probenahmen erfolgen in dem Zeitraum des Jahres, in dem die Wassertemperatur unter 14 °C liegt bzw. zu dem Zeitpunkt, zu dem die Wassertemperatur ihre wahrscheinlich niedrigsten jährlichen Werte erreicht hat;

b)

ist gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG eine gezielte Überwachung der Wildpopulationen erforderlich, so sind Anzahl und geografische Verteilung der Probenahmestellen so zu bestimmen, dass eine angemessene Abdeckung des Mitgliedstaats, der Zone oder des Kompartiments gegeben ist. Die Probenahmestellen müssen repräsentativ für die verschiedenen Ökosysteme sein, in denen Wildpopulationen empfänglicher Arten leben;

c)

müssen Betriebe oder Wildpopulationen häufiger als einmal pro Jahr einer Gesundheitsuntersuchung und Probenahme unterzogen werden, so müssen die Intervalle zwischen den Untersuchungen bzw. den Probenahmen mindestens vier Monate betragen bzw. so lang wie möglich sein, wobei die Temperaturanforderungen gemäß Buchstabe a zu berücksichtigen sind;

d)

alle Produktionseinheiten wie Teiche, Tanks, Netzkäfige usw. müssen auf verendete, geschwächte oder verhaltensgestörte Fische kontrolliert werden. Besondere Beachtung ist dem Wasserabflussbereich zu widmen, in dem sich geschwächte Fische strömungsbedingt besonders häufig aufhalten.

e)

Für die Probenahme bestimmte Fische der empfänglichen Arten werden wie folgt ausgewählt:

i)

Sind Regenbogenforellen vorhanden, so sind nur Fische dieser Art für die Beprobung zu wählen, es sei denn, es sind andere empfängliche Arten vorhanden, die typische Anzeichen von VHS oder IHN aufweisen; sind keine Regenbogenforellen vorhanden, so muss die Probe repräsentativ für alle anderen vorhandenen empfänglichen Arten sein;

ii)

sind geschwächte, verhaltensgestörte oder soeben verendete Fische (jedoch ohne Anzeichen der Zersetzung) vorhanden, so sind solche Fische auszuwählen; wird für die Fischproduktion mehr als eine Wasserquelle verwendet, so müssen die Fische für die Probenahme so ausgewählt werden, dass alle Wasserquellen berücksichtigt werden;

iii)

die Fische sind so auszuwählen, dass sich die Probe proportional aus Fischen aller Produktionseinheiten des Betriebs sowie aller Jahresklassen zusammensetzt.

I.2.   Spezifische Anforderungen bezüglich der Erlangung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf VHS und IHN

I.2.1.   Überwachungsprogramme:

a)

ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie III gemäß Anhang III Teil B der Richtlinie 2006/88/EG in Bezug auf VHS und/oder IHN kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelisteten Krankheiten erlangen, sofern alle Betriebe in diesem Mitgliedstaat, dieser Zone oder diesem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, den Anforderungen des Anhangs V der genannten Richtlinie entsprechen, und alle diese Betriebe und, soweit gemäß Anhang V Teil I Nummer 2 der genannten Richtlinie erforderlich, die nach der genannten Bestimmung ausgewählten Probenahmestellen in den Wildpopulationen einem der nachstehenden Überwachungsprogramme unterzogen wurden:

i)

Modell A — zweijähriges Überwachungsprogramm

Die Betriebe oder Probenahmestellen müssen mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt II Tabelle 1.A. unterzogen worden sein;

während dieses Zweijahreszeitraums müssen die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für VHS und/oder IHN ergeben haben, und jeglicher Verdacht auf Vorliegen von VHS oder IHN muss gemäß den in Nummer II.3 dargelegten Probenahme- und Diagnosemethoden ausgeschlossen worden sein;

ii)

Modell B — vierjähriges Überwachungsprogramm mit verringerter Probengröße

Die Betriebe oder Probenahmestellen müssen mindestens über einen Zeitraum von vier aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt II Tabelle 1.B. unterzogen worden sein;

während dieses Vierjahreszeitraums müssen die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für VHS und/oder IHN ergeben haben, und jeglicher Verdacht auf Vorliegen von VHS oder IHN muss gemäß den in Nummer II.3 dargelegten Probenahme- und Diagnosemethoden ausgeschlossen worden sein;

b)

wenn während der Durchführung des Überwachungsprogramms gemäß Buchstabe a in einem an dem Überwachungsprogramm teilnehmenden Betrieb eine Infektion mit VHS und/oder IHN bestätigt wird, und diesem daher der Gesundheitsstatus der Kategorie II entzogen wird, kann dem Betrieb sofort wieder der Gesundheitsstatus der Kategorie II zuerkannt werden und das Überwachungsprogramm zur Erlangung des Seuchenfreiheitsstatus kann weiter durchgeführt werden, ohne dass ein Tilgungsprogramm gemäß Nummer I.2.2 erforderlich wäre, sofern der Betrieb folgende Bedingungen erfüllt:

i)

Es handelt sich um einen Binnenbetrieb, dessen Gesundheitsstatus in Bezug auf VHS und/oder IHN gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von dem Gesundheitsstatus der Wassertierpopulationen in den angrenzenden natürlichen Gewässern in Bezug auf diese aufgelisteten Krankheiten ist;

ii)

er wurde geleert, gereinigt, desinfiziert und stillgelegt, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

iii)

er wurde mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf VHS und/oder IHN wiederaufgestockt.

I.2.2.   Tilgungsprogramme

I.2.2.1.   Allgemeine Anforderungen

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf VHS und/oder IHN kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelisteten Krankheiten erlangen, sofern alle Betriebe in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, einem Tilgungsprogramm gemäß den Buchstaben a bis e unterzogen wurden:

a)

Die Mindestbekämpfungsmaßnahmen gemäß Kapitel V Abschnitt 4 der Richtlinie 2006/88/EG müssen wirksam angewandt worden sein und es muss in unmittelbarer Nähe des Betriebs/der Betriebe, der/die offiziell für mit VHS, IHN oder diesen beiden aufgelisteten Krankheiten verseucht erklärt worden ist/sind, ein Sperrgebiet gemäß Artikel 32 Buchstabe b der genannten Richtlinie eingerichtet worden sein, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt worden sein; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung der aufgelisteten Krankheit auf Zucht- und Wildfische beeinflussen, z. B.: Zahl, Prozentsatz und Verteilung der verendeten Fische in dem mit VHS und/oder IHN verseuchten Betrieb; Entfernung zu benachbarten Betrieben und Besatzdichte in diesen Betrieben; Nähe zu Schlachthöfen; Kontaktbetriebe; in den Betrieben gehaltene Arten; Bewirtschaftungsmethoden in den betroffenen Betrieben und in den benachbarten Betrieben; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- bzw. der Überwachungszone gelten folgende Mindestanforderungen hinsichtlich der geografischen Abgrenzung der Zonen:

i)

In unmittelbarer Nähe eines Betriebs, der offiziell für mit VHS oder IHN oder diesen beiden aufgelisteten Krankheiten verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die Folgendes umfasst:

(1)

in Küstengebieten: ein Gebiet im Umkreis von mindestens einer Gezeitenzonenbreite oder von mindestens 5 km um den offiziell für mit VHS und/oder IHN verseucht erklärten Betrieb (je nachdem, welches dieser Gebiete das größere ist) oder ein gleichwertiges Gebiet, das unter Berücksichtigung der geeigneten hydrodynamischen oder epidemiologischen Daten bestimmt wird;

(2)

in Binnenwassergebieten: das gesamte Wassereinzugsgebiet des offiziell für mit VHS und/oder IHN verseucht erklärten Betriebs; die zuständige Behörde kann die Zone auf Teile des Wassereinzugsgebiets oder die Fläche des landwirtschaftlichen Betriebs beschränken, sofern dadurch die Verhinderung der Ausbreitung von VHS und/oder IHN nicht beeinträchtigt wird;

ii)

die zuständige Behörde richtet außerhalb der Schutzzone eine Überwachungszone ein, die Folgendes umfasst:

(1)

in Küstengebieten: ein Gebiet sich überschneidender Gezeitenzonen um die Schutzzone herum oder ein Gebiet um die Schutzzone herum, das einen Umkreis von 10 km um den Mittelpunkt der Schutzzone erfasst oder ein gleichwertiges Gebiet, das unter Berücksichtigung der geeigneten hydrodynamischen oder epidemiologischen Daten bestimmt wird

(2)

in Binnenwassergebieten: ein erweitertes Gebiet außerhalb der ausgewiesenen Schutzzone;

b)

alle Betriebe in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit VHS und/oder IHN verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens folgende Elemente umfasst:

i)

die Entnahme von Proben für die Untersuchung von zehn Fischen, wenn klinische oder postmortale Anzeichen einer Infektion mit VHS und/oder IHN beobachtet werden, oder von mindestens 30 Fischen, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden;

ii)

eine Gesundheitsuntersuchung: in den Betrieben, in denen die Untersuchungen gemäß Ziffer i Negativbefunde ergeben haben, werden bis zur Aufhebung der Schutzzone gemäß Nummer I.2.2.1 Buchstabe c weiterhin einmal pro Monat Gesundheitsuntersuchungen durchgeführt, und zwar während des Zeitraums, in dem die Wassertemperatur unter 14 °C liegt, es sei denn, die Fischteiche oder Netzkäfige sind von Eis bedeckt;

c)

alle Betriebe, die offiziell für mit VHS und/oder IHN verseucht erklärt wurden, werden geleert, gereinigt, desinfiziert und stillgelegt, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen muss. Nach Leerung aller offiziell für verseucht erklärten Betriebe in einer Schutzzone ist eine mindestens dreiwöchige gleichzeitige Stilllegung erforderlich. Dieser Absatz gilt auch für neue Betriebe, die während der Durchführung des Tilgungsprogramms offiziell für verseucht erklärt werden.

Während der Stilllegung der offiziell für verseucht erklärten Betriebe werden die Schutzzonen in Überwachungszonen umgewandelt.

Die zuständige Behörde kann beschließen, die Leerung, Reinigung, Desinfektion und Stilllegung anderer Betriebe in den ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer der Stilllegung dieser Betriebe entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle Betriebe, die offiziell für mit VHS, IHN oder diesen beiden aufgelisteten Krankheiten verseucht erklärt wurden sowie alle anderen Betriebe, die innerhalb der Schutz- und Überwachungszonen gemäß Buchstabe c stillgelegt wurden, müssen mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf VHS und/oder IHN wiederaufgestockt werden.

Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Nummer I.2.2.1 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, und, sofern eine Überwachung der Wildpopulationen durchzuführen ist, alle gemäß Nummer I.1 ausgewählten Probenahmestellen werden in der Folge dem in Nummer I.2.1 festgelegten Überwachungssystem unterworfen.

I.2.2.2.   Anforderungen bezüglich der Wiedererlangung des Seuchenfreiheitsstatus für Binnenkompartimente, die einen einzigen Betrieb umfassen und zuvor als frei von IHN und/oder VHS erklärt worden waren

Ein einen einzigen Betrieb umfassendes Binnenkompartiment, das zuvor als frei von IHN, VHS oder diesen beiden aufgelisteten Krankheiten erklärt worden war, dessen Gesundheitsstatus in Bezug auf diese aufgelisteten Krankheiten gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von den angrenzenden natürlichen Gewässern ist und dem der Gesundheitsstatus der Kategorie I gemäß Artikel 53 Absatz 3 der genannten Richtlinie entzogen worden ist, kann den Gesundheitsstatus der Kategorie I sofort wiedererlangen, wenn die zuständige Behörde bestätigt hat, dass folgende Bedingungen erfüllt sind:

a)

Der offiziell für mit VHS und/oder IHN verseucht erklärte Betrieb muss geleert, gereinigt, desinfiziert und stillgelegt worden sein, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

b)

der offiziell für mit VHS und/oder IHN verseucht erklärte Betrieb wurde mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf VHS und/oder IHN wiederaufgestockt.

I.3.   Spezifische Anforderungen bezüglich der Erhaltung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf VHS und/oder IHN

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, Gesundheitsuntersuchungen unterzogen werden und die Fische müssen gemäß der Tabelle 1.C in Abschnitt II dieses Teil beprobt werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb in Bezug auf die Einschleppung von VHS, IHN oder diesen beiden aufgelisteten Krankheiten besteht.

Bei der Bestimmung der Häufigkeit der Gesundheitsuntersuchungen in Kompartimenten, die in Bezug auf VHS und/oder IHN den Gesundheitsstatus der Kategorie I innehaben, die in Binnengebieten liegen und deren Gesundheitsstatus in Bezug auf VHS oder IHN gemäß Anhang V Teil II Nummer 2 der Richtlinie 2006/88/EG von dem Gesundheitsstatus der Wassertierpopulationen in den angrenzenden natürlichen Gewässern abhängt, ist das Risiko der Einschleppung von VHS und/oder IHN als hoch zu betrachten.

Der Seuchenfreiheitsstatus bleibt nur erhalten, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für VHS und/oder IHN ergeben und jeglicher Verdacht auf Vorliegen von VHS und/oder IHN gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen ist.

I.4.   Anforderungen bezüglich der Aufhebung der Sperrmaßnahmen gemäß Artikel 39 der Richtlinie 2006/88/EG, nämlich Wechsel von einem Gesundheitsstatus der Kategorie V zu einem Gesundheitsstatus der Kategorie III

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf VHS und/oder IHN kann den Gesundheitsstatus der Kategorie III in Bezug auf diese aufgelisteten Krankheiten erlangen, sofern:

a)

die in Nummer I.2.2.1 Buchstaben a, b und c festgelegten allgemeinen Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die betroffenen Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung des IHNV und/oder des VHSV im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für verseucht erklärten Betriebe sowie alle anderen Betriebe, die stillgelegt wurden oder Gegenstand alternativer Maßnahmen nach Buchstabe a waren, die innerhalb der Schutz- und Überwachungszonen liegen, mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf VHS und/oder IHN wiederaufgestockt wurden;

c)

die Wiederaufstockung erst erfolgt ist, nachdem alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind.

II.   Diagnose- und Probenahmemethoden

II.1.   Zu beprobende Organe:

Untersucht werden müssen Milz und Vorderniere, sowie entweder Herz oder Gehirn. Bei der Beprobung von Laichfischen können auch Ovarien- oder Samenflüssigkeit untersucht werden.

Besteht die Probe aus Fischbrut, können ganze Fische von unter 4 cm Länge mit einer sterilen Schere oder einem sterilen Skalpell nach Entfernen des hinter der Darmöffnung liegenden Körperteils zerkleinert werden. Besteht die Probe aus ganzen Fischen von 4 bis 6 cm Länge, so müssen die Innereien einschließlich der Nieren entnommen werden.

Organteile von höchstens zehn Fischen können gepoolt werden.

II.2.   Diagnosemethoden für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf VHS und/oder IHN

Die Diagnosemethode für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf VHS und/oder IHN gemäß den in Anhang II Teil 1 Nummer I aufgeführten, zugelassenen Diagnosemethoden ist folgende:

a)

Virusisolation in Zellkulturen gefolgt von Identifizierung anhand eines Enzym-Immunassays (ELISA), eines indirekten Immunofluoreszenztests (IFAT), eines Virusneutralisationstests oder einer Echtzeit-Reverse-Transkriptase-Polymerase-Kettenreaktion (RT-qPCR) oder

b)

RT-qPCR.

II.3.   Probenahme- und Diagnosemethoden zur Bestätigung oder zum Ausschluss des Vorliegens von VHS oder IHN

Muss ein Verdacht auf VHS und/oder IHN gemäß Artikel 28 der Richtlinie 2006/88/EG bestätigt bzw. ausgeräumt werden, sind folgende Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

a)

in dem verdächtigen Betrieb wird mindestens eine Gesundheitsuntersuchung und eine Beprobung von zehn Fischen vorgenommen, wenn klinische oder postmortale Anzeichen einer Infektion mit VHS und/oder IHN beobachtet werden, oder von mindestens 30 Fischen, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden; die Proben werden anhand einer oder mehrerer der unter den Ziffern i und ii genannten Diagnosemethoden gemäß den in Anhang II Teil 1 Abschnitt II festgelegten detaillierten Diagnosemethoden und -verfahren untersucht:

i)

Herkömmliche Virusisolierung in Zellkultur mit anschließendem immunochemischem oder molekularem Virusnachweis;

ii)

Virusnachweis mittels RT-qPCR;

iii)

andere Diagnosemethoden mit nachweislich ähnlicher Wirksamkeit wie der indirekte Immunofluoreszenztests (IFAT), der Enzym-Immunassay (ELISA), RT-PCR) und Immunohistochemie (IHC).

b)

Das Auftreten von VHS gilt als bestätigt, wenn eine oder mehrere dieser Diagnosemethoden positive Befunde für VHSV ergeben. Das Auftreten von IHN gilt als bestätigt, wenn eine oder mehrere dieser Diagnosemethoden positive Befunde für IHNV ergeben. Die Bestätigung eines ersten Falls von VHS oder IHN in Mitgliedstaaten, Zonen oder Kompartimenten, die zuvor als nicht von der Seuche betroffen galten, muss auf der Grundlage einer herkömmlichen Virusisolierung in Zellkultur oder mittels RT-qPCR erfolgen.

c)

Ein Verdacht auf VHSV und/oder IHNV gilt als ausgeräumt, wenn Zellkultivierung oder RT-qPCR keine weiteren Nachweise für das Vorhandensein von VHSV und/oder IHNV ergeben.

Tabelle 1.A

Überwachungssystem für Zonen und Kompartimente während des zweijährigen Kontrollzeitraums gemäß Nummer I.2.1 Buchstabe a Ziffer i vor Erlangung des Seuchenfreiheitsstatus in Bezug auf VHS oder IHN

Art des Betriebs

Zahl der Gesundheitsuntersuchungen pro Jahr (zwei Jahre)

Zahl der Probenahmen pro Jahr (zwei Jahre)

Zahl der Fische in der Probe (1)

Zahl der Jungfische

Zahl der Laichfische (2)

a)

Betriebe mit Laichfischen

2

2

50 (erste Untersuchung)

75 (zweite Untersuchung)

30 (erste oder zweite Untersuchung)

0 (erste oder zweite Untersuchung)

b)

Betriebe, in denen ausschließlich Laichfische gehalten werden

2

1

0

75 (erste oder zweite Untersuchung)

c)

Betriebe ohne Laichfische

2

2

75 (3) (erste und zweite Untersuchung)

0

Höchstzahl Fische pro gepoolte Probe: 10


Tabelle 1.B

Überwachungssystem mit verringerter Probengröße während des vierjährigen Kontrollzeitraums gemäß Nummer I.2.1 Buchstabe a Ziffer ii vor Erlangung des Seuchenfreiheitsstatus in Bezug auf VHS oder IHN

Art des Betriebs

Zahl der Gesundheitsuntersuchungen pro Jahr

Zahl der Probenahmen pro Jahr

Zahl der Fische in der Probe (4)

Zahl der Jungfische

Zahl der Laichfische (5)

Erste zwei Jahre des Überwachungszeitraums

a)

Betriebe mit Laichfischen

2

1

0 (erste Untersuchung)

30 (zweite Untersuchung)

0 (erste Untersuchung)

0 (zweite Untersuchung)

b)

Betriebe, in denen ausschließlich Laichfische gehalten werden

2

1

0

30 (erste oder zweite Untersuchung)

c)

Betriebe ohne Laichfische

2

1

30 (6) (erste oder zweite Untersuchung)

0

Letzte zwei Jahre des Überwachungszeitraums

a)

Betriebe mit Laichfischen

2

2

30 (erste Untersuchung)

0 (zweite Untersuchung)

0 (erste Untersuchung)

30 (zweite Untersuchung)

b)

Betriebe, in denen ausschließlich Laichfische gehalten werden

2

2

 

30 (erste und zweite Untersuchung)

c)

Betriebe ohne Laichfische

2

2

30 (6) (erste und zweite Untersuchung)

 

Höchstzahl Fische pro gepoolte Probe: 10


Tabelle 1.C

Überwachungssysteme für Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf VHS oder IHN gemäß Nummer I.3

Risikoniveau

Zahl der Gesundheitsuntersuchungen

Zahl der Fische in der Probe (9)

hoch

zweimal jährlich

30 (7)  (8)

mittel

einmal jährlich

30 (7)

gering

einmal alle zwei Jahre

30 (7)

Höchstzahl Fische pro gepoolte Probe: 10

TEIL 2

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG DER KOI-HERPESVIRUS-INFEKTION (KHV-I)

I.   Anforderungen an Überwachungs- und Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I und zur Eindämmung von Infektionen mit dem Koi-Herpesvirus (KHV)

I.1.   Allgemeine Anforderungen

Ist gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG eine gezielte Überwachung der Wildpopulationen erforderlich, so sind Anzahl und geografische Verteilung der Probenahmestellen so zu bestimmen, dass eine angemessene Abdeckung des Mitgliedstaats, der Zone oder des Kompartiments gegeben ist. Die Probenahmestellen müssen auch für die verschiedenen Ökosysteme repräsentativ sein, in denen die empfänglichen Wildpopulationen leben, d. h., Flusssysteme und Seen.

Die gezielte Überwachung muss auf einem regelmäßigen Monitoring von Standorten mit empfänglichen Arten beruhen. Standorte sind zu überwachen, wenn die Wassertemperaturen ein Niveau erreicht haben, das für die Entwicklung der Krankheit förderlich ist (> 15 °C), und zwar frühestens zwei Wochen nach dem Datum, an dem diese Temperaturen erreicht sind. Alle kranken Fische oder Fische mit Verhaltensstörungen, die an einem Standort vorgefundenen werden, sind zu beproben und zu untersuchen.

Nach Möglichkeit sind Fische zu beproben, die für einen längeren Zeitraum in dem für das Virus förderlichen Temperaturbereich gehalten wurden, d. h. zwei bis drei Wochen bei 15 bis 26 °C. Folgender Ansatz ist jedoch akzeptabel:

a)

Sammlung einer Teilpopulation bei der Umsetzung von Winter- in Sommerteiche, Haltung der Fische im gleichen Wasserkörper wie der Sommerteich, bis die Mindesttemperaturanforderungen erreicht sind, oder

b)

Probenahme bei der Ernte oder während einer anderen Handhabung der Fische im Rahmen der normalen Bewirtschaftungsvorgänge. Die Proben sind nach Möglichkeit zwischen 24 und 72 Stunden nach einem solchen Bewirtschaftungsvorgang zu ziehen, um die Chancen auf Erkennung von KHV zu verbessern.

Müssen Betriebe oder Wildpopulationen häufiger als einmal pro Jahr einer Gesundheitsuntersuchung und Probenahme unterzogen werden, so müssen die Intervalle zwischen den Untersuchungen bzw. den Probenahmen — innerhalb des Zeitraums, in dem die Wassertemperatur wahrscheinlich ihren Jahreshöchststand erreicht (ohne 28 °C zu überschreiten) — so lang wie möglich sein.

Alle Produktionseinheiten wie Teiche und Tanks müssen auf verendete, geschwächte oder verhaltensgestörte Fische kontrolliert werden.

Werden in dem Betrieb Cyprinus carpio und seine Hybride, wie Cyprinus carpio × Carassius auratus, gehalten, so sind diese zu beproben.

Fische für die Probenahme sind wie folgt auszuwählen:

i)

Sind geschwächte, verhaltensgestörte oder soeben verendete Fische (jedoch ohne Anzeichen der Zersetzung) vorhanden, so sind solche Fische auszuwählen;

ii)

wird für die Fischproduktion mehr als eine Wasserquelle verwendet, so müssen bei der Probenahme alle Wasserquellen berücksichtigt werden;

iii)

die Fische sind so auszuwählen, dass sich die Probe proportional aus Fischen aller Produktionseinheiten des Betriebs sowie aller Jahresklassen zusammensetzt.

I.2.   Spezifische Anforderungen bezüglich der Erlangung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf KHV-I

I.2.1.   Überwachungsprogramme

a)

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie III in Bezug auf KHV-I kann den Gesundheitsstatus der Kategorie I erlangen, wenn alle Betriebe in diesem Mitgliedstaat, dieser Zone oder diesem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, den in Anhang V der genannten Richtlinie festgelegten Anforderungen an den Seuchenfreiheitsstatus entsprechen und alle diese Betriebe und, soweit gemäß Teil I Nummer 2 des genannten Anhangs erforderlich, die nach der genannten Bestimmung ausgewählten Probenahmestellen in den Wildpopulationen einem der nachstehenden Überwachungsprogramme unterzogen wurden:

i)

Modell A — zweijähriges Überwachungsprogramm

Die Betriebe oder Probenahmestellen müssen mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt III Tabelle 2.A. unterzogen worden sein;

während dieses Zweijahreszeitraums müssen die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für KHV ergeben haben, und jeglicher Verdacht auf Vorliegen von KHV-I muss gemäß den in Nummer III.2 dargelegten Diagnosemethoden ausgeschlossen worden sein;

ii)

Modell B — vierjähriges Überwachungsprogramm mit verringerter Probengröße

Die Betriebe oder Probenahmestellen müssen mindestens über einen Zeitraum von vier aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt III Tabelle 2.B. unterzogen worden sein;

während dieses Vierjahreszeitraums müssen die Untersuchungen aller Proben mittels der in Nummer II.2 festgelegten Diagnosemethoden Negativbefunde für KHV ergeben haben, und jeglicher Verdacht auf Vorliegen von KHV-I muss gemäß den in Nummer III.2 dargelegten Diagnosemethoden ausgeschlossen worden sein;

b)

wenn während der Durchführung des vierjährigen Überwachungsprogramms gemäß Buchstabe a in einem an dem Überwachungsprogramm teilnehmenden Betrieb eine Infektion mit KHV bestätigt wird und diesem daher der Gesundheitsstatus der Kategorie II entzogen wird, kann dem Betrieb sofort wieder der Gesundheitsstatus der Kategorie II zuerkannt werden und das Überwachungsprogramm zur Erlangung des Seuchenfreiheitsstatus kann weiter durchgeführt werden, ohne dass ein Tilgungsprogramm gemäß Nummer I.2.2 erforderlich wäre, sofern der Betrieb folgende Bedingungen erfüllt:

i)

Es handelt sich um einen Binnenbetrieb, dessen Gesundheitsstatus in Bezug auf KHV-I gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von dem Gesundheitsstatus der Wassertierpopulationen in den angrenzenden natürlichen Gewässern in Bezug auf diese aufgelistete Krankheit ist;

ii)

er ist geleert, gereinigt, desinfiziert und stillgelegt worden, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

iii)

er wurde mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf KHV-I wiederaufgestockt.

I.2.2.   Tilgungsprogramme

I.2.2.1.   Allgemeine Anforderungen

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf KHV-I kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Tilgungsprogramm unterzogen wurden:

a)

Die Mindestbekämpfungsmaßnahmen gemäß Kapitel V Abschnitt 4 der Richtlinie 2006/88/EG sind wirksam angewandt worden und in unmittelbarer Nähe des Betriebs/der Betriebe, der/die offiziell für mit KHV verseucht erklärt worden ist/sind, ist ein Sperrgebiet gemäß Artikel 32 Buchstabe b der genannten Richtlinie eingerichtet worden, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt worden sein; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung von KHV-I auf Zucht- und Wildfische beeinflussen, z. B.: Zahl, Prozentsatz und Verteilung der verendeten Fische in dem mit KHV verseuchten Betrieb; Entfernung zu benachbarten Betrieben und Besatzdichte in diesen Betrieben; Nähe zu Schlachthöfen; Kontaktbetriebe; in den Betrieben gehaltene Arten; Bewirtschaftungspraxis im betroffenen Betrieb und in den benachbarten Betrieben; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- und Überwachungszonen gelten folgende Mindestanforderungen hinsichtlich der geografischen Abgrenzung der Zonen:

i)

In unmittelbarer Nähe eines Betriebs, der offiziell für mit KHV verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die das gesamte Wassereinzugsgebiet des offiziell für mit KHV verseucht erklärten Betriebs umfasst; die zuständige Behörde kann die Zone auf Teile des Einzugsgebiets begrenzen, sofern die Prävention der Verschleppung von KHV-I dadurch nicht beeinträchtigt wird;

ii)

außerhalb der Schutzzone wird eine Überwachungszone eingerichtet, die ein größeres Gebiet um die Schutzzone herum umfasst;

b)

alle Betriebe in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit KHV verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens folgende Elemente umfasst:

i)

die Entnahme von Proben für die Untersuchung von zehn Fischen, wenn klinische oder postmortale Anzeichen von KHV-I beobachtet werden, oder von 30 Fischen, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden;

ii)

eine Gesundheitsuntersuchung: in den Betrieben, in denen die Untersuchungen gemäß Nummer III.2 Negativbefunde ergeben haben; bis zur Aufhebung der Schutzzone gemäß Nummer I.2.2.1 Buchstabe c werden weiterhin einmal pro Monat Gesundheitsuntersuchungen durchgeführt, und zwar während des Zeitraums, in dem die Wassertemperatur wahrscheinlich 15 °C übersteigt;

c)

alle Betriebe, die offiziell für mit KHV verseucht erklärt wurden, werden geleert, gereinigt, desinfiziert und stillgelegt, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen muss; Nach Leerung aller offiziell für verseucht erklärten Betriebe in einer Schutzzone ist eine mindestens dreiwöchige gleichzeitige Stilllegung erforderlich. Dieser Absatz gilt auch für neue Betriebe, die während der Durchführung des Tilgungsprogramms offiziell für verseucht erklärt werden.

Während der Stilllegung der offiziell für verseucht erklärten Betriebe werden die Schutzzonen in Überwachungszonen umgewandelt.

Die zuständige Behörde kann beschließen, die Leerung, Reinigung, Desinfektion und Stilllegung von anderen Betrieben in den ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer der Stilllegung entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle offiziell für mit KHV verseucht erklärten Betriebe sowie alle anderen stillgelegten Betriebe in der Schutz- und Überwachungszone werden wiederaufgestockt

i)

mit Fischen, die aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf KHV-I stammen, oder

ii)

für einen Übergangszeitraum bis zum 31. Dezember 2020 mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem genehmigten KHV-I-Überwachungsprogramm.

Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für mit KHV verseucht erklärt worden waren, gemäß Nummer I.2.2.1 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, und, sofern eine Überwachung der Wildpopulationen durchzuführen ist, alle gemäß Nummer I.1 dieses Abschnitts ausgewählten Probenahmestellen müssen in der Folge mindestens dem in Nummer I.2.1 festgelegten Überwachungsprogramm unterworfen worden sein.

I.2.2.2.   Anforderungen bezüglich der Wiedererlangung des Seuchenfreiheitsstatus für Binnenkompartimente, die einen einzigen Betrieb umfassen und zuvor als frei von KHV-I erklärt worden waren

Ein einen einzigen Betrieb umfassendes Binnenkompartiment mit einem Gesundheitsstatus der Kategorie I in Bezug auf KHV-I, dessen Gesundheitsstatus gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von den angrenzenden natürlichen Gewässern ist und dem der Gesundheitsstatus der Kategorie I gemäß Artikel 53 Absatz 3 der genannten Richtlinie entzogen worden ist, kann den Gesundheitsstatus der Kategorie I in Bezug auf KHV-I sofort wiedererlangen, wenn die zuständige Behörde bestätigt hat, dass folgende Bedingungen erfüllt sind:

a)

Der Betrieb ist geleert, gereinigt, desinfiziert und stillgelegt worden, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

b)

er wurde mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I oder aus einem Kompartiment mit einem genehmigten KHV-I-Überwachungsprogramm (Gesundheitsstatus der Kategorie II) wiederaufgestockt.

I.3.   Besondere Anforderungen bezüglich der Erhaltung des Status der Kategorie I in Bezug auf KHV-I

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, Gesundheitsuntersuchungen unterzogen werden und gemäß der Tabelle 2.B in Abschnitt III beprobt werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb in Bezug auf die Einschleppung von KHV besteht.

Die Häufigkeit der Gesundheitsuntersuchungen in Kompartimenten, die in Bezug auf KHV-I einen Gesundheitsstatus der Kategorie I innehaben, in Binnengebieten liegen, einen oder mehrere Betriebe umfassen und deren Gesundheitsstatus in Bezug auf KHV-I gemäß Anhang V Teil II Nummer 2 der Richtlinie 2006/88/EG von dem Gesundheitsstatus in Bezug auf die aufgelistete Krankheit in den angrenzenden natürlichen Gewässern abhängt, entspricht der in Tabelle 2.C bei hohem Risiko vorgeschriebenen Zahl.

In Mitgliedstaaten, Zonen oder Kompartimenten, in denen die Zahl der Betriebe begrenzt ist und in denen die gezielte Überwachung dieser Betriebe nicht genügend epidemiologische Daten ergibt, umfassen die Überwachungssysteme für die Erhaltung des Seuchenfreiheitsstatus Probenahmestellen, die gemäß den Anforderungen in Nummer I.1 ausgewählt wurden.

Diese Probenahmestellen müssen nach dem Rotationsprinzip (50 % der Probenahmestellen pro Jahr) untersucht und beprobt werden. Die Beprobung erfolgt gemäß Tabelle 2.C in Abschnitt III. Die Proben sind gemäß Abschnitt II auszuwählen, aufzubereiten und zu untersuchen, und die Befunde der Laboruntersuchungen müssen KHV-I-negativ sein.

Der Seuchenfreiheitsstatus bleibt nur erhalten, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für KHV-I ergeben und jeglicher Verdacht auf Vorliegen von KHV-I gemäß den in Nummer III.2 dargelegten Diagnosemethoden ausgeschlossen ist.

I.4.   Spezifische Anforderungen bezüglich der Aufhebung der Sperrmaßnahmen gemäß Artikel 39 der Richtlinie 2006/88/EG zur Erlangung des Gesundheitsstatus der Kategorie III in Bezug auf KHV-I in Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie V

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf KHV-I kann den Gesundheitsstatus der Kategorie III in Bezug auf diese aufgelistete Krankheit erlangen, sofern:

a)

die in Nummer I.2.2.1 Buchstaben a, b und c festgelegten Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die betroffenen Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung des KHV im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für verseucht erklärten Betriebe sowie alle anderen Betriebe, die stillgelegt wurden oder Gegenstand alternativer Maßnahmen nach Buchstabe a waren, die innerhalb der Schutz- und Überwachungszonen liegen, mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf KHV-I wiederaufgestockt wurden;

c)

die Wiederaufstockung erst erfolgt ist, nachdem alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind.

II.   Diagnose- und Probenahmemethoden für die Überwachung zwecks Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I

II.1.   Proben

Untersucht werden müssen Teile von Kieme und Niere. Organteile von höchstens zwei Fischen können gepoolt werden.

II.2.   Diagnosemethoden für die Überwachung zwecks Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I

Die Diagnosemethode zur Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I ist die Echtzeit-PCR (qPCR) gemäß den in Anhang II Teil 2 Nummer II festgelegten genauen Diagnosemethoden und -verfahren.

III.   Diagnose- und Probenahmeverfahren für amtliche Untersuchungen zur Bestätigung von KHV-I oder zur Ausräumung eines Verdachts auf KHV-I

III.1.   Proben

Untersucht werden müssen Teile von Kieme und Niere. Organteile von höchstens zwei Fischen können gepoolt werden.

III.2   Amtliche Untersuchung und Diagnosemethoden für den Ausschluss bzw. die Bestätigung einer KHV-Infektion

Muss ein Verdacht auf KHV-I gemäß Artikel 28 der Richtlinie 2006/88/EG bestätigt bzw. ausgeräumt werden, so ist im Einklang mit folgendes Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

a)

Die amtliche Untersuchung umfasst mindestens eine Gesundheitsuntersuchung und eine Beprobung von zehn Fischen, wenn klinische oder postmortale Anzeichen einer KHV-Infektion beobachtet werden, oder von 30 Fischen, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden. Die Proben werden anhand der unter Buchstabe b genannten Diagnosemethoden gemäß den in Anhang II Teil 2 Nummer II festgelegten detaillierten Diagnosemethoden und -verfahren untersucht;

b)

das Vorhandensein einer KHV-Infektion gilt als bestätigt, wenn KHV mittels PCR festgestellt wird;

ein Verdacht auf KHV-I gilt als ausgeräumt, wenn dieser Test keine weiteren Nachweise für das Vorhandensein von KHV ergibt.

Tabelle 2.A

Überwachungssystem für Zonen und Kompartimente während des zweijährigen Kontrollzeitraums gemäß Nummer I.2.1 vor der Erreichung des Seuchenfreiheitsstatus in Bezug auf KHV-I

 

 

Zahl der klinischen Untersuchungen pro Jahr (zwei Jahre)

Zahl der Laboruntersuchungen pro Jahr (zwei Jahre)

Zahl der Fische in der Probe

Betriebe/Probenahmestellen

Erste zwei Jahre des Überwachungszeitraums

2

2

75 (10)

 

Höchstzahl Fische pro gepoolte Probe: 2


Tabelle 2.B

Überwachungssystem für Zonen und Kompartimente während des vierjährigen Kontrollzeitraums gemäß Nummer I.2.1 vor der Erreichung des Seuchenfreiheitsstatus in Bezug auf KHV-I

 

 

Zahl der klinischen Untersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der Fische in der Probe

Betriebe/Probenahmestellen

Erste zwei Jahre des Überwachungszeitraums

1

1

30

Betriebe/Probenahmestellen

Letzte zwei Jahre des Überwachungszeitraums

2

2

30

 

Höchstzahl Fische pro gepoolte Probe: 2


Tabelle 2.C

Überwachungssystem für Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I gemäß Nummer I.3

Risikoniveau

Zahl der Gesundheitsuntersuchungen

Zahl der Fische in der Probe

hoch

zweimal jährlich

30

mittel

einmal jährlich

30

gering

einmal alle zwei Jahre

30

Höchstzahl Fische pro gepoolte Probe: 2


Tabelle 2.D

Überwachungssystem zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I in Mitgliedstaaten, Zonen oder Kompartimenten mit einer begrenzten Zahl an Betrieben, in denen die gezielte Überwachung keine ausreichenden epidemiologischen Daten ergibt (siehe Nummer I.3)

 

Zahl der klinischen Untersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der Fische in der Probe

Probenahmestellen

einmal alle zwei Jahre

einmal alle zwei Jahre

30

Höchstzahl Fische pro gepoolte Probe: 2

TEIL 3

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG DER INFEKTIÖSEN ANÄMIE DER LACHSE (ISA)

I.   Anforderungen an Überwachungs- und Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf ISA und zur Eindämmung von Infektionen mit dem HPR-deletierten ISAV

I.1.   Allgemeine Anforderungen

Müssen Gesundheitsuntersuchungen und Probenahmen in Betrieben gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG häufiger als einmal pro Jahr durchgeführt werden, so müssen die Intervalle zwischen den Untersuchungen bzw. den Probenahmen so lang wie möglich sein.

Ist gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG eine gezielte Überwachung der Wildpopulationen erforderlich, so sind Anzahl und geografische Verteilung der Probenahmestellen so zu bestimmen, dass eine angemessene Abdeckung des Mitgliedstaats, der Zone oder des Kompartiments gegeben ist. Die Probenahmestellen müssen auch für die verschiedenen Ökosysteme repräsentativ sein, in denen die empfänglichen Wildpopulationen leben.

Bei den Gesundheitsuntersuchungen müssen alle Produktionseinheiten wie Teiche, Tanks und Netzkäfige auf verendete, geschwächte oder verhaltensgestörte Fische kontrolliert werden. Besondere Beachtung ist dem Wasserabflussbereich zu widmen, in dem sich geschwächte Fische strömungsbedingt besonders häufig aufhalten.

Fische für die Probenahme sind wie folgt auszuwählen:

a)

Es sind nur moribunde oder soeben verendete Fische (jedoch ohne Anzeichen der Zersetzung) auszuwählen; insbesondere sind Fische, die Anämie, Blutungen oder andere klinischen Krankheitsanzeichen aufweisen, die auf Durchblutungsstörungen hindeuten, vorrangig zur Probenahme auszuwählen;

b)

befindet sich unter den im Betrieb gehaltenen empfänglichen Arten atlantischer Lachs, so ist dieser vorrangig zu beproben. Wird in dem Fischbetrieb kein atlantischer Lachs gehalten, so sind andere empfängliche Arten zu beproben;

c)

wird für die Fischproduktion mehr als eine Wasserquelle verwendet, so müssen die Fische für die Probenahme so ausgewählt werden, dass alle Wasserquellen berücksichtigt werden;

d)

die Fische sind so auszuwählen, dass sich die Probe proportional aus Fischen aller Produktionseinheiten (Netzkäfige, Tanks und Teiche) des Betriebs sowie aller Jahresklassen zusammensetzt.

I.2.   Besondere Anforderungen bezüglich der Erlangung des Gesundheitsstatus der Kategorie I in Bezug auf die ISA

I.2.1.   Überwachungsprogramme

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie III gemäß Anhang III Teil B der Richtlinie 2006/88/EG in Bezug auf die ISA kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, sofern alle Betriebe in diesem Mitgliedstaat, dieser Zone oder diesem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, den einschlägigen Anforderungen des Anhangs V der genannten Richtlinie entsprechen, und alle diese Betriebe und, soweit gemäß Anhang V Teil I Nummer 2 Absatz 2 der genannten Richtlinie erforderlich, die nach der genannten Bestimmung ausgewählten Probenahmestellen in den Wildpopulationen dem nachstehenden Überwachungsprogramm unterzogen wurden:

a)

Die Betriebe oder Probenahmestellen sind mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt II Tabelle 3.A. unterzogen worden;

b)

während dieses Zweijahreszeitraums müssen die Untersuchungen aller Proben mittels der in Nummer II.2 festgelegten Diagnosemethoden Negativbefunde für HPR-deletierten ISAV ergeben haben, und jeglicher Verdacht auf Vorliegen der ISA muss gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen worden sein;

c)

wenn während der Durchführung des Überwachungsprogramms in einem an dem Überwachungsprogramm teilnehmenden Betrieb das Auftreten der ISA bestätigt und diesem daher der Gesundheitsstatus der Kategorie II entzogen worden war, muss ein Tilgungsprogramm gemäß Nummer I.2.2 durchgeführt worden sein.

I.2.2.   Tilgungsprogramme

I.2.2.1.   Allgemeine Anforderungen

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf die ISA kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, einem Tilgungsprogramm gemäß den folgenden Buchstaben a bis e unterzogen wurden:

a)

Die Mindestbekämpfungsmaßnahmen gemäß Kapitel V Abschnitt 3 der Richtlinie 2006/88/EG sind wirksam angewandt worden und es ist insbesondere in unmittelbarer Nähe des Betriebs/der Betriebe, der/die offiziell für mit dem HPR-deletierten ISAV verseucht erklärt worden ist/sind, ein Sperrgebiet gemäß Artikel 32 Buchstabe b der genannten Richtlinie eingerichtet worden, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt worden sein; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung von ISA auf Zucht- oder Wildfische beeinflussen, z. B.: Zahl, Prozentsatz und Verteilung der verendeten Fische in dem mit dem HPR-deletierten ISAV verseuchten Betrieb bzw. dem Betrieb, in dem das Auftreten der ISA bestätigt wurde; Entfernung zu benachbarten Betrieben und Besatzdichte in diesen Betrieben; Nähe zu Schlachthöfen; Kontaktbetriebe; in den Betrieben gehaltene Arten; Bewirtschaftungspraxis im betroffenen Betrieb und in den benachbarten Betrieben; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- und Überwachungszonen gelten folgende Mindestanforderungen hinsichtlich der geografischen Abgrenzung der Zonen:

i)

In unmittelbarer Nähe eines Betriebs, der offiziell für mit ISA verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die Folgendes umfasst:

(1)

in Küstengebieten: ein Gebiet im Umkreis von mindestens einer Gezeitenzonenbreite oder von mindestens 5 km um den offiziell für mit ISA verseucht erklärten Betrieb (je nachdem, welches dieser Gebiete das größere ist) oder ein entsprechendes Gebiet, das unter Berücksichtigung der betreffenden hydrodynamischen oder epidemiologischen Daten bestimmt wird;

(2)

in Binnenwassergebieten: das gesamte Wassereinzugsgebiet des offiziell für mit ISA verseucht erklärten Betriebs; die zuständige Behörde kann die Zone auf Teile des Einzugsgebiets begrenzen, sofern die Prävention der Verschleppung der ISA dadurch nicht beeinträchtigt wird;

ii)

außerhalb der Schutzzone wird eine Überwachungszone eingerichtet, die Folgendes umfasst:

(1)

in Küstengebieten: ein Gebiet sich überschneidender Gezeitenzonen um die Schutzzone herum oder ein Gebiet um die Schutzzone herum, das einen Umkreis von 10 km um den Mittelpunkt der Schutzzone erfasst oder ein gleichwertiges Gebiet, das unter Berücksichtigung der geeigneten hydrodynamischen oder epidemiologischen Daten bestimmt wird oder

(2)

in Binnenwassergebieten: ein erweitertes Gebiet außerhalb der ausgewiesenen Schutzzone;

b)

alle Betriebe in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit ISA verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens folgende Elemente umfasst:

i)

die Entnahme von Proben für die Untersuchung von mindestens zehn moribunden Fischen, wenn klinische oder postmortale Anzeichen der ISA beobachtet werden, oder von mindestens 30 Fischen, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden;

ii)

eine Gesundheitsuntersuchung: in den Betrieben, in denen die Tests gemäß Ziffer i Negativbefunde ergeben haben, werden weiterhin einmal pro Monat Gesundheitsuntersuchungen durchgeführt, bis die Schutzzone gemäß Nummer I.2.2.1 Buchstabe c aufgehoben wird;

c)

alle Betriebe, die offiziell für mit dem HPR-deletierten ISAV verseucht erklärt wurden oder in denen das Auftreten der ISA bestätigt wurde, müssen geleert, gereinigt, desinfiziert und für mindestens drei Monate stillgelegt werden. Die Schutz- und Überwachungszonen können aufgehoben werden, wenn alle Betriebe in der Schutzzone von Fischen geleert, gereinigt und desinfiziert wurden und für mindestens sechs Wochen gleichzeitig stillgelegt waren.

Während der Stilllegung der offiziell für verseucht erklärten Betriebe werden die Schutzzonen in Überwachungszonen umgewandelt.

Die zuständige Behörde kann beschließen, die Leerung, Reinigung, Desinfektion und Stilllegung von anderen Betrieben in den ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer der Stilllegung dieser Betriebe entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle Betriebe, die offiziell für mit dem HPR-deletierten ISAV verseucht erklärt wurden oder in denen das Auftreten der ISA bestätigt wurde sowie alle anderen Betriebe innerhalb der Schutz- und Überwachungszonen, die stillgelegt wurden, müssen mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf ISA wiederaufgestockt werden.

Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Nummer I.2.2.1 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, und, sofern eine Überwachung der Wildpopulationen durchzuführen ist, alle gemäß Nummer I.1 ausgewählten Probenahmestellen werden in der Folge dem in Nummer I.2.1 festgelegten Überwachungssystem unterworfen.

I.2.2.2.   Anforderungen an die Wiedererlangung des Seuchenfreiheitsstatus für Binnenkompartimente, die einen einzigen Betrieb umfassen und zuvor den Gesundheitsstatus der Kategorie I innehatten

Ein einen einzigen Betrieb umfassendes Binnenkompartiment mit einem Gesundheitsstatus der Kategorie I in Bezug auf ISA, dessen Gesundheitsstatus gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von den angrenzenden natürlichen Gewässern ist und dem der Gesundheitsstatus der Kategorie I gemäß Artikel 53 Absatz 3 der genannten Richtlinie entzogen worden ist, kann diesen Gesundheitsstatus sofort wiedererlangen, wenn die zuständige Behörde bestätigt hat, dass folgende Bedingungen erfüllt sind:

a)

Der Betrieb ist geleert, gereinigt, desinfiziert und stillgelegt worden, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

b)

er wurde mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf ISA wiederaufgestockt.

I.3.   Mindestbekämpfungsmaßnahmen für die Erhaltung des Status der Kategorie I in Bezug auf ISA

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, Gesundheitsuntersuchungen unterzogen werden und gemäß der Tabelle 3.B (11) in Abschnitt II beprobt werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb in Bezug auf die Einschleppung der ISA besteht.

Bei der Bestimmung der Häufigkeit der Gesundheitsuntersuchungen in Binnenkompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf ISA, deren Gesundheitsstatus in Bezug auf ISA von dem Gesundheitsstatus in den angrenzenden natürlichen Gewässern abhängt, in denen Atlantischer Lachs (Salmon salar) lebt, gilt das Risiko der Einschleppung der ISA als hoch.

Der Seuchenfreiheitsstatus in Bezug auf ISA bleibt nur erhalten, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für den HPR-deletierten ISAV ergeben und jeglicher Verdacht auf Vorliegen der ISA gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen ist.

I.4.   Besondere Anforderungen bezüglich der Erlangung des Gesundheitsstatus der Kategorie III in Bezug auf den HPR-deletierten ISAV in Mitgliedstaaten, Zonen oder Kompartimenten, die zuvor den Gesundheitsstatus der Kategorie V innehatten

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf ISA kann den Gesundheitsstatus der Kategorie III erlangen, sofern:

a)

die in Nummer I.2.2.1 Buchstaben a, b und c niedergelegten Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung des ISAV im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für verseucht erklärten Betriebe sowie alle anderen Betriebe, die stillgelegt wurden oder Gegenstand alternativer Maßnahmen nach Buchstabe a waren, die innerhalb der Schutz- und Überwachungszonen liegen, mit Fischen aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf ISA wiederaufgestockt wurden;

c)

diese Wiederaufstockung erst erfolgt ist, nachdem alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind;

d)

während eines Zeitraums von zwei Jahren nach Abschluss der Maßnahmen gemäß den Buchstaben a, b und c kein Auftreten des HPR-deletierten ISAV bestätigt wurde und Verdachtsfälle während dieses Zeitraums nach den Verfahren gemäß Nummer II.3 ausgeräumt wurden.

II.   Diagnosemethoden und amtliche Untersuchungen

II.1.   Proben

Untersucht werden müssen

a)

Histologie: Kopfniere, Leber, Herz, Pankreas, Darm, Milz und Kieme;

b)

Immunohistochemie: Rumpfniere, Herz einschließlich Herzklappen und Bulbus arteriosus;

c)

RT-qPCR-Analyse: Rumpfniere und Herz;

d)

Viruskultur: Rumpfniere, Herz, Leber und Milz.

Organteile von höchstens fünf Fischen können gepoolt werden.

II.2.   Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf die ISA

Die Diagnosemethode für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf die ISA gemäß den Nummern I.2 und I.3 ist die RT-qPCR, gefolgt von der Sequenzierung positiver Proben gemäß den in Anhang II Teil 3 ausgeführten detaillierten Methoden und Verfahren.

Ergibt die RT-qPCR einen Positivbefund, so sind weitere Proben zu untersuchen, bevor erste Bekämpfungsmaßnahmen gemäß Artikel 28 der Richtlinie 2006/88/EG durchgeführt werden.

Diese Proben sind im Einklang mit den detaillierten Methoden und Verfahren in Anhang II Teil 3 wie folgt zu untersuchen:

a)

Screening der Proben mittels RT-qPCR, einschließlich Sequenzierung des HE-Gens zum Nachweis der HPR-Deletierung

und

b)

Untersuchung von Gewebepräparaten mittels spezifischer Antikörper gegen ISAV (IHC an fixierten Gewebeschnitten oder IFAT an Gewebeabdrücken) oder

c)

Isolierung und Nachweis des ISAV in einer Zellkultur von mindestens einer Probe von einem beliebigen Fisch im Betrieb.

II.3.   Amtliche Untersuchung und Diagnosemethoden für den Ausschluss bzw. die Bestätigung des Vorliegens der ISA

Muss ein Verdacht auf ISA gemäß Artikel 28 der Richtlinie 2006/88/EG bestätigt bzw. ausgeräumt werden, so ist folgendes Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

a)

amtliche Untersuchung, die mindestens eine Gesundheitsuntersuchung und eine Beprobung von zehn moribunden Fischen umfasst, wenn klinische oder postmortale Anzeichen der ISA beobachtet werden. Werden keine klinischen oder postmortalen Anzeichen der ISA festgestellt, so wird nach der Gesundheitsuntersuchung eine gezielte Beprobung von mindestens 30 moribunden Fischen oder soeben verendeten Fischen normaler Verfassung gemäß Nummer I.1 durchgeführt. Die Proben werden gemäß den in Buchstabe b aufgeführten Diagnosemethoden untersucht;

b)

ergibt die RT-qPCR einen Positivbefund für den HPR-deletierten ISAV, so sind weitere Proben zu untersuchen, bevor erste Bekämpfungsmaßnahmen gemäß Artikel 28 der Richtlinie 2006/88/EG durchgeführt werden. Ein Verdacht auf ISA-Infektion wird unter Verwendung der detaillierten Methoden und Verfahren in Anhang II Teil 3 nach folgenden Kriterien bestätigt:

i)

Nachweis des ISAV mittels RT-qPCR, einschließlich Sequenzierung des HE-Gens zum Nachweis der HPR-Deletierung, und Nachweis des ISAV in Gewebepräparaten mittels spezifischer Antikörper gegen ISAV (IHC an fixierten Gewebeschnitten oder IFAT an Gewebeabdrücken)

oder

ii)

Nachweis des ISAV mittels RT-qPCR, einschließlich Sequenzierung des HE-Gens zum Nachweis der HPR-Deletierung und

Isolierung und Nachweis des ISAV in einer Zellkultur von mindestens einer Probe von einem beliebigen Fisch im Betrieb;

c)

werden klinische, makroskopisch-pathologische Veränderungen oder histopathologische Ergebnisse beobachtet, die auf ISA hindeuten, so muss diese Feststellung gemäß Anhang II Teil 3 durch einen Nachweis des Virus mittels zwei Diagnosemethoden mit unterschiedlichen Nachweisgrundsätzen, wie beispielsweise RT-qPCR und IHC, erhärtet werden.

Der Verdacht auf ISA kann ausgeschlossen werden, wenn Tests und Untersuchungen über einen Zeitraum von zwölf Monaten ab dem Zeitpunkt der Verdachtsmeldung keine weiteren Hinweise auf ISA ergeben.

Tabelle 3.A

Überwachungssystem für Zonen und Kompartimente während des zweijährigen Kontrollzeitraums gemäß Nummer I.2.1 vor der Erlangung des Seuchenfreiheitsstatus in Bezug auf die ISA

Jahr der Überwachung

Zahl der Gesundheitsuntersuchungen pro Jahr (zwei Jahre)

Zahl der Laboruntersuchungen pro Jahr (zwei Jahre)

Zahl der pro Jahr zu beprobenden Fische

Jahr 1

6

2 (12)

2 * 75 (13)

Jahr 2

6

2 (12)

2 * 75 (13)


Tabelle 3.B

Überwachungssysteme für Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf ISA gemäß Nummer I.3  (15)

Risikoniveau

Zahl der Gesundheitsuntersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der pro Jahr zu beprobenden Fische

hoch

2

2 (14)

2 * 30

mittel

1

1 (14)

30

gering

einmal alle zwei Jahre

einmal alle zwei Jahre

30 alle zwei Jahre

TEIL 4

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG VON MARTEILIA-REFRINGENS-INFEKTIONEN

I.   Anforderungen an Überwachungs- und Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf Marteilia-refringens-Infektionen

I.1.   Allgemeine Anforderungen

Gesundheitsuntersuchungen und gegebenenfalls Probenahmen für Laboruntersuchungen werden in der Jahreszeit durchgeführt, in der die Prävalenz des Parasiten in dem Mitgliedstaat, der Zone oder dem Kompartiment bekanntermaßen auf ihrem Höhepunkt ist. Liegen keine Daten dazu vor, so wird die Probenahme unmittelbar nach dem Zeitpunkt durchgeführt, zu dem die Wassertemperatur 17 °C überschritten hat.

Sind gemäß den Anforderungen von Teil 4 Weichtiere zu beproben, gelten folgende Kriterien:

a)

Werden in den Produktionseinheiten oder im Produktionsgebiet Ostrea spp. und Mytilus spp. gehalten, so sind beide Gattungen in gleichem Maße zu beproben. Ist nur eine dieser Gattungen vorhanden, so ist diese Gattung zu beproben. Ist weder die Gattung Ostrea noch die Gattung Mytilus vorhanden, so muss die Probe repräsentativ für alle anderen vorhandenen empfänglichen Arten sein;

b)

sind geschwächte, geöffnete oder soeben verendete Weichtiere (jedoch ohne Anzeichen der Zersetzung) in den Produktionseinheiten vorhanden, so sind in erster Linie solche Weichtiere auszuwählen. Sind keine solchen Weichtiere vorhanden, so müssen zu den ausgewählten Weichtieren die ältesten gesunden Weichtiere gehören;

c)

bei Probenahmen in Weichtierbetrieben, in denen mehr als eine Wasserquelle zur Weichtierproduktion verwendet wird, müssen Proben von Weichtieren aus allen Wasserquellen genommen werden, sodass alle Teile des Betriebs anteilig vertreten sind;

d)

bei Probenahmen in Weichtierzuchtgebieten müssen Weichtiere von einer ausreichenden Anzahl von Probenahmestellen so ausgewählt werden, dass alle Teile des Weichtierzuchtgebietes anteilig vertreten sind. Die wichtigsten Faktoren bei der Auswahl dieser Probenahmestellen sind Probenahmestellen, an denen in der Vergangenheit Marteilia refringens festgestellt wurde, Bestandsdichte, Wasserströmung, Anwesenheit empfänglicher Arten, Vorhandensein von Überträgerarten, Bathymetrie und Bewirtschaftungspraxis. Auch natürliche Bänke sind in die Beprobung einzubeziehen.

I.2.   Besondere Anforderungen bezüglich der Erlangung des Gesundheitsstatus der Kategorie I in Bezug auf Marteilia refringens

I.2.1.   Überwachungsprogramme

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie III in Bezug auf Marteilia refringens kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe oder Weichtierzuchtgebiete in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Überwachungsprogramm, einschließlich Gesundheitsinspektionen und Probenahme zur Untersuchung, unterzogen wurden:

Zweijähriges Überwachungsprogramm

a)

Die Betriebe oder Weichtierzuchtgebiete sind mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt II Tabelle 4.A unterzogen worden;

b)

während dieses Zweijahreszeitraums haben die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für Marteilia refringens ergeben, und jeglicher Verdacht auf Vorliegen von Marteilia refringens wurde gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen;

c)

sollen bei der Probenahme Ostrea edulis, Mytilus edulis oder Mytilus galloprovincialis einbezogen werden, die aus einem Mitgliedstaat, einer Zone oder einem Kompartiment mit einem Gesundheitsstatus der Kategorie I stammen, so müssen diese spätestens im dem dem Zeitraum des Überwachungsprogramms vorangehenden Frühjahr in den Betrieb oder das Weichtierzuchtgebiet eingeführt worden sein.

I.2.2.   Tilgungsprogramme

Die Tilgung von Marteilia refringens gilt in den meisten Fällen als unmöglich; hält ein Mitgliedstaat eine Tilgung für möglich, so ist für das Tilgungsprogramm folgendes Muster zu verwenden:

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf Marteilia refringens kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe oder Weichtierzuchtgebiete in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Tilgungsprogramm unterzogen wurden:

a)

Die Maßnahmen gemäß Kapitel V Abschnitt 3 der Richtlinie 2006/88/EG sind wirksam angewandt worden; insbesondere wurde in unmittelbarer Nähe des Betriebs/der Betriebe oder des Weichtierzuchtgebiets/der Weichtierzuchtgebiete, der/die/das offiziell für mit Marteilia refringens verseucht erklärt worden war/waren, ein Sperrgebiet gemäß Artikel 32 Buchstabe b der Richtlinie 2006/88/EG eingerichtet, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt werden; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung von Marteilia refringens beeinflussen, z. B.: Zahl, Alter, Prozentsatz und Verteilung der verendeten Weichtiere in dem mit Marteilia refringens verseuchten Betrieb oder Weichtierzuchtgebiet, einschließlich bei wild lebenden Weichtieren; Entfernung zu benachbarten Betrieben/Weichtierzuchtgebieten und Besatzdichte in diesen Betrieben, einschließlich bei wild lebenden Weichtieren; Nähe zu Verarbeitungsbetrieben, Kontaktbetrieben oder Weichtierzuchtgebieten; in den Betrieben oder Weichtierzuchtgebieten vorhandene Arten, insbesondere empfängliche Arten und Überträgerarten; Bewirtschaftungsmethoden in den betroffenen Betrieben und Weichtierzuchtgebieten und in den benachbarten Betrieben und Weichtierzuchtgebieten; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- und Überwachungszonen gelten folgende Mindestanforderungen:

i)

In unmittelbarer Nähe eines Betriebs oder Weichtierzuchtgebietes, der/das offiziell für mit Marteilia refringens verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die einem anhand geeigneter hydrodynamischer oder epidemiologischer Daten bestimmten Gebiet entspricht;

ii)

außerhalb der Schutzzone wird eine Überwachungszone eingerichtet, die ein Gebiet um die Schutzzone herum umfasst, das anhand geeigneter hydrodynamischer oder epidemiologischer Daten bestimmt wird;

b)

alle Betriebe oder Weichtierzuchtgebiete in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit Marteilia refringens verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens eine Probename von 150 Weichtieren zu Untersuchungszwecken nach Beginn des Übertragungszeitraums für Marteilia refringens umfasst. Ist der Übertragungszeitraum nicht bekannt, so beginnt die Probenahme ab dem Zeitpunkt, zu dem die Wassertemperatur 17 °C übersteigt;

c)

alle offiziell für mit Marteilia refringens verseucht erklärten Betriebe und Weichtierzuchtgebiete müssen geleert, stillgelegt und, wenn möglich, gereinigt und desinfiziert werden.

Die Dauer der Stilllegung beträgt mindestens

i)

zwei Monate bei Betrieben und Weichtierzuchtgebieten mit begrenztem Kontakt zu umliegenden Gewässern wie Brutanlagen und Aufzuchtanlagen,

ii)

zwei Monate bei Betrieben und Weichtierzuchtgebieten mit unbegrenztem Kontakt zu den umliegenden Gewässern, sofern die infizierten Weichtiere empfänglicher Arten und Weichtiere empfänglicher Arten mit epidemiologischer Verbindung mit dem befallenen Betrieb oder Weichtierzuchtgebiet vor der Jahreszeit, in der die Prävalenz von Marteilia refringens bekanntermaßen ihren Höhepunkt erreicht, oder, wenn dieser Zeitraum nicht bekannt ist, vor dem Zeitraum, in dem die Wassertemperatur 17 °C übersteigt, geerntet oder entfernt worden sind,

iii)

14 Monate bei Betrieben und Weichtierzuchtgebieten mit unbegrenztem Kontakt zu den umliegenden Gewässern, sofern die infizierten Weichtiere empfänglicher Arten und Weichtiere empfänglicher Arten mit epidemiologischer Verbindung mit dem befallenen Betrieb oder Weichtierzuchtgebiet nicht vor der Jahreszeit, in der die Prävalenz von Marteilia refringens bekanntermaßen ihren Höhepunkt erreicht, geerntet oder entfernt worden sind oder, wenn die betreffenden Daten nicht bekannt sind, Weichtiere der empfänglichen Arten nicht vor dem Zeitraum, in dem die Wassertemperatur 17 °C übersteigt, geerntet oder entfernt worden sind.

Nach Leerung und Desinfizierung aller offiziell für verseucht erklärten Betriebe und Weichtierzuchtgebiete ist eine mindestens vierwöchige gleichzeitige Stilllegung erforderlich.

Die zuständige Behörde kann beschließen, erforderlichenfalls die Leerung, Reinigung, Desinfektion und Stilllegung von anderen Betrieben oder Weichtierzuchtgebieten innerhalb der ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer der Stilllegung entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle offiziell für verseucht erklärten Betriebe oder Weichtierzuchtgebiete und alle anderen Betriebe oder Weichtierzuchtgebiete in der Schutz- und der Überwachungszone, die stillgelegt wurden, müssen mit Weichtieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf Marteilia refringens-Infektionen wiederaufgestockt werden.

Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Nummer I.2.2 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe und Weichtierzuchtgebiete in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, werden in der Folge dem in Nummer I.2.1 festgelegten Überwachungssystem unterworfen.

I.3.   Spezifische Anforderungen bezüglich der Erhaltung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf Marteilia-refringens-Infektionen

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe oder Weichtierzuchtbetriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, Gesundheitsuntersuchungen unterzogen und gemäß der Tabelle 4.B in Abschnitt II beprobt werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb bzw. Weichtierzuchtgebiet in Bezug auf die Einschleppung von Marteilia refringens besteht.

Der Seuchenfreiheitsstatus darf nur erhalten bleiben, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für Marteilia refringens ergeben und jeglicher Verdacht auf Vorliegen von Marteilia refringens gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen ist.

I.4.   Anforderungen bezüglich der Aufhebung der Sperrmaßnahmen gemäß Artikel 39 der Richtlinie 2006/88/EG (Wechsel von einem Gesundheitsstatus der Kategorie V zu einem Gesundheitsstatus der Kategorie III) in Bezug auf Marteilia-refringens-Infektionen

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf Marteilia refringens kann den Gesundheitsstatus der Kategorie III in Bezug auf diese aufgelistete Krankheit erlangen, sofern:

a)

die in Nummer I.2.2 Buchstaben a, b und c niedergelegten Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung von Marteilia refringens im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für verseucht erklärten Betriebe oder Weichtierzuchtgebiete und alle anderen Betriebe oder Weichtierzuchtgebiete in der Schutz- und der Überwachungszone, die stillgelegt/alternativen Maßnahmen unterzogen wurden, mit Weichtieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf Marteilia refringens wiederaufgestockt worden sind;

c)

die Wiederaufstockung erst erfolgt ist nachdem alle Betriebe oder Weichtierzuchtgebiete, die offiziell für verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind.

d)

während eines Zeitraums von zwei Jahren nach Abschluss der Maßnahmen gemäß den Buchstaben a, b und c kein Auftreten von Marteilia-refringens-Infektionen bestätigt wurde und Verdachtsfälle während dieses Zeitraums nach den Verfahren gemäß Nummer II.3 ausgeräumt wurden.

II.   Diagnosemethoden und amtliche Untersuchungen

II.1.   Proben

Zur Durchführung der Diagnosetests gemäß den Nummern II.2 und II.3 wird dem Labor das ganze Tier vorgelegt.

II.2.   Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf Marteilia-refringens-Infektionen

Die Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf Marteilia-refringens-Infektionen gemäß den in Anhang II Teil 4 ausgeführten detaillierten Diagnosemethoden und -verfahren sind Histopathologie, Gewebeabdrücke oder PCR.

II.3.   Amtliche Untersuchungs- und Diagnosemethoden zur Bestätigung des Vorliegens von Marteilia-refringens-Infektionen oder zur Ausräumung eines Verdachts darauf

Muss ein Verdacht auf Marteilia-refringens-Infektionen gemäß Artikel 28 der Richtlinie 2006/88/EG bestätigt bzw. ausgeräumt werden, so ist folgendes Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

a)

Die amtliche Untersuchung umfasst mindestens eine Beprobung von 30 Weichtieren empfänglicher Arten, sofern der Verdacht auf einem Mortalitätsbericht beruht, oder andernfalls von 150 Weichtieren empfänglicher Arten nach Beginn des Übertragungszeitraums von Marteilia refringens. Ist der Übertragungszeitraum nicht bekannt, so beginnt die Probenahme ab dem Zeitpunkt, zu dem die Wassertemperatur 17 °C übersteigt;

b)

Die Proben werden anhand der unter Ziffer i genannten Diagnosemethoden gemäß den in Anhang II Teil 4 Abschnitt I festgelegten detaillierten Diagnosemethoden und -verfahren untersucht:

i)

Das Auftreten von Marteilia refringens gilt als bestätigt, wenn ein positiver Befund aus Histopathologie, Gewebeabdrücken oder In-situ-Hybridisierung in Kombination mit einem durch Sequenzierung vervollständigten positiven PCR-Ergebnis vorliegt;

ii)

ein Verdacht auf Marteilia-refringens-Infektion kann ausgeschlossen werden, wenn die Tests gemäß Ziffer i keinen weiteren Nachweis für das Vorhandensein von Marteilia refringens ergeben.

Tabelle 4.A

Überwachungssystem für Mitgliedstaaten, Zonen und Kompartimente während des zweijährigen Kontrollzeitraums vor der Erlangung des Seuchenfreiheitsstatus in Bezug auf Marteilia refringens gemäß Nummer I.2.1

 

Zahl der Gesundheitsuntersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der Weichtiere in der Probe

Betriebe/Weichtierzuchtgebiete

1

1

150


Tabelle 4.B

Überwachungssystem für Mitgliedstaaten, Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf Marteilia refringens gemäß Nummer I.3

Risikoniveau

Zahl der Gesundheitsuntersuchungen

Zahl der Laboruntersuchungen

Zahl der Weichtiere in der Probe

hoch

einmal jährlich

eine alle zwei Jahre

150

mittel

eine alle zwei Jahre

eine alle zwei Jahre

150

gering

eine alle zwei Jahre

eine alle vier Jahre

150

TEIL 5

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG VON BONAMIA-OSTREAE-INFEKTIONEN

I.   Anforderungen an Überwachungs- bzw. Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf Bonamia-ostreae-Infektionen

I.1.   Allgemeine Anforderungen

Gesundheitsuntersuchungen und gegebenenfalls Beprobungen der Produktionseinheiten werden in der Jahreszeit durchgeführt, in der die Prävalenz von Bonamia ostreae in dem Mitgliedstaat, der Zone oder dem Kompartiment bekanntermaßen auf ihrem Höhepunkt ist. Liegen keine Daten dazu vor, so findet die Probenahme im Winter oder zu Beginn des Frühjahrs statt.

Sind gemäß den Anforderungen von Teil 5 Weichtiere zu beproben, gelten folgende Kriterien:

a)

Sind Ostrea edulis vorhanden, so sollten nur Austern dieser Art für die Beprobung gewählt werden. Sind keine Ostrea edulis vorhanden, so muss die Probe repräsentativ für alle anderen vorhandenen empfänglichen Arten sein;

b)

sind geschwächte, geöffnete oder soeben verendete Weichtiere (jedoch ohne Anzeichen der Zersetzung) vorhanden, so sind in erster Linie solche Weichtiere auszuwählen. Sind keine solchen Weichtiere vorhanden, so müssen zu den ausgewählten Weichtieren die ältesten gesunden Weichtiere gehören;

c)

bei Probenahmen in Betrieben, in denen mehr als eine Wasserquelle zur Weichtierproduktion verwendet wird, müssen Proben von Weichtieren aus allen Wasserquellen genommen werden, sodass alle Teile des Betriebs anteilig vertreten sind;

d)

bei Probenahmen in Weichtierzuchtgebieten müssen Weichtiere von einer ausreichenden Zahl von Probenahmestellen in die Probe aufgenommen werden. Die wichtigsten Faktoren bei der Auswahl dieser Probenahmestellen sind Stellen, an denen in der Vergangenheit Bonamia ostreae festgestellt wurde, Bestandsdichte, Wasserströmung, Anwesenheit empfänglicher Arten, Vorhandensein von Überträgerarten, Bathymetrie und Bewirtschaftungspraxis. Natürliche Bänke innerhalb oder in der Nähe der Zuchtgebiete müssen in die Beprobung einbezogen werden.

I.2.   Besondere Anforderungen bezüglich der Erlangung des Gesundheitsstatus der Kategorie I in Bezug auf Bonamia ostreae

I.2.1.   Überwachungsprogramme

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie III in Bezug auf Bonamia ostreae kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Überwachungsprogramm, einschließlich Gesundheitsinspektionen und Probenahme zur Untersuchung, unterzogen wurden:

Zweijähriges Überwachungsprogramm

a)

Die Betriebe und Weichtierzuchtgebiete, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, sind mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Tabelle 5.A. unterzogen worden;

b)

während dieses Zweijahreszeitraums haben die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für Bonamia ostreae ergeben, und jeglicher Verdacht auf Vorliegen von Bonamia ostreae wurde gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen;

c)

sollen bei der Probenahme Ostrea edulis einbezogen werden, die aus einem Mitgliedstaat, einer Zone oder einem Kompartiment mit einem Gesundheitsstatus der Kategorie I stammen, so müssen diese spätestens im dem dem Zeitraum des Überwachungsprogramms vorangehenden Herbst in den Betrieb oder das Weichtierzuchtgebiet eingeführt worden sein.

I.2.2.   Tilgungsprogramme

Die Tilgung von Bonamia ostreae gilt in den meisten Fällen als unmöglich; hält ein Mitgliedstaat eine Tilgung für möglich, so ist für das Tilgungsprogramm folgendes Muster zu verwenden:

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf Bonamia ostreae kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe oder Weichtierzuchtgebiete in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Tilgungsprogramm unterzogen wurden:

a)

Die Mindestbekämpfungsmaßnahmen gemäß Kapitel V Abschnitt 3 der Richtlinie 2006/88/EG sind wirksam angewandt worden; insbesondere wurde in unmittelbarer Nähe des Betriebs/der Betriebe oder des Weichtierzuchtgebiets/der Weichtierzuchtgebiete, der/die/das offiziell für mit Bonamia ostreae verseucht erklärt worden war/waren, ein Sperrgebiet gemäß Artikel 32 Buchstabe b der genannten Richtlinie eingerichtet, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt werden; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung der aufgelisteten Krankheit beeinflussen, z. B.: Zahl, Prozentsatz, Alter und Verteilung der verendeten Weichtiere in dem mit Bonamia ostreae verseuchten Betrieb oder Weichtierzuchtgebiet, einschließlich bei wild lebenden Weichtieren; Entfernung zu benachbarten Betrieben/Weichtierzuchtgebieten und Besatzdichte in diesen Betrieben, einschließlich bei wild lebenden Weichtieren; Nähe zu Verarbeitungsbetrieben, Kontaktbetrieben oder Weichtierzuchtgebieten; in den Betrieben oder Weichtierzuchtgebieten vorhandene Arten, insbesondere empfängliche Arten und Überträgerarten; Bewirtschaftungsmethoden in den betroffenen Betrieben oder Weichtierzuchtgebieten und in den benachbarten Betrieben und Weichtierzuchtgebieten; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- und Überwachungszonen gelten folgende Mindestanforderungen:

i)

in unmittelbarer Nähe eines Betriebs oder Weichtierzuchtgebietes, der/das offiziell für mit Bonamia ostreae verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die einem anhand geeigneter hydrodynamischer oder epidemiologischer Daten bestimmten Gebiet entspricht;

ii)

außerhalb der Schutzzone wird eine Überwachungszone eingerichtet, die ein Gebiet um die Schutzzone herum umfasst, das anhand geeigneter hydrodynamischer oder epidemiologischer Daten bestimmt wird;

b)

alle Betriebe oder Weichtierzuchtgebiete in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit Bonamia ostreae verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens eine Probename von 150 Weichtieren zu Untersuchungszwecken nach Beginn des Übertragungszeitraums für Bonamia ostreae umfasst. Ist der Übertragungszeitraum nicht bekannt, so beginnt die Probenahme im Winter oder zu Beginn des Frühjahrs;

c)

alle offiziell für mit Bonamia ostreae verseucht erklärten Betriebe und Weichtierzuchtgebiete müssen geleert, stillgelegt und, wenn möglich, gereinigt und desinfiziert werden, wobei die Dauer der Stilllegung mindestens sechs Monate betragen muss.

Nach Leerung und Desinfizierung aller offiziell für verseucht erklärten Betriebe bzw. Weichtierzuchtgebiete ist eine mindestens vierwöchige gleichzeitige Stilllegung erforderlich.

Die zuständige Behörde kann beschließen, erforderlichenfalls die Leerung, Reinigung, Desinfektion und Stilllegung von anderen Betrieben oder Weichtierzuchtgebieten innerhalb der ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer der Stilllegung entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle offiziell für verseucht erklärten Betriebe oder Weichtierzuchtgebiete und alle anderen Betriebe oder Weichtierzuchtgebiete in der Schutz- und der Überwachungszone, die stillgelegt wurden, müssen mit Weichtieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf Bonamia ostreae wiederaufgestockt werden. Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für verseucht erklärt worden waren, gemäß Nummer I.2.2 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe und Weichtierzuchtgebiete in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, müssen in der Folge dem in Nummer I.2 festgelegten Überwachungsprogramm unterzogen werden.

I.3.   Spezifische Anforderungen bezüglich der Erhaltung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf Bonamia ostreae-Infektionen

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe oder Weichtierzuchtbetriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, Gesundheitsuntersuchungen unterzogen und gemäß der Tabelle 5.B in Abschnitt II beprobt werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb bzw. Weichtierzuchtgebiet in Bezug auf die Einschleppung von Bonamia ostreae besteht.

Der Seuchenfreiheitsstatus in Bezug auf Bonamia ostreae-Infektionen bleibt nur erhalten, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für Bonamia ostreae ergeben und jeglicher Verdacht auf Vorliegen von Bonamia ostreae gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen wurde.

I.4.   Anforderungen bezüglich der Aufhebung der Sperrmaßnahmen gemäß Artikel 39 der Richtlinie 2006/88/EG (Wechsel von einem Gesundheitsstatus der Kategorie V zu einem Gesundheitsstatus der Kategorie III) in Bezug auf Bonamia ostreae.

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf Bonamia ostreae kann den Gesundheitsstatus der Kategorie III in Bezug auf diese aufgelistete Krankheit erlangen, sofern:

a)

die in Nummer I.2.2 Buchstaben a, b und c niedergelegten Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung von Bonamia ostreae im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für verseucht erklärten Betriebe oder Weichtierzuchtgebiete und alle anderen Betriebe oder Weichtierzuchtgebiete in der Schutz- und der Überwachungszone, die stillgelegt/alternativen Maßnahmen unterzogen wurden, mit Weichtieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf Bonamia ostreae wiederaufgestockt worden sind;

c)

die Wiederaufstockung erst erfolgt ist, nachdem alle Betriebe oder Weichtierzuchtgebiete, die offiziell für verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind;

d)

während eines Zeitraums von zwei Jahren nach Abschluss der Maßnahmen gemäß den Buchstaben a, b und c kein Auftreten von Bonamia ostreae bestätigt wurde und Verdachtsfälle während dieses Zeitraums nach den Verfahren gemäß Nummer II.3 ausgeräumt wurden.

II.   Diagnosemethoden und Diagnosekriterien

II.1.   Proben

Zur Durchführung der Diagnosetests gemäß den Nummern II.2 und II.3 wird dem Labor das ganze Tier vorgelegt.

II.2.   Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf Bonamia-ostreae-Infektion

Die Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf Bonamia-ostreae-Infektion sind Histopathologie, Gewebeabdrücke oder PCR. Bei der Anwendung dieser Diagnosemethoden ist den entsprechenden in Anhang II Teil 5 festgelegten detaillierten Methoden und Verfahren zu folgen.

II.3.   Diagnosekriterien für die Bestätigung des Vorliegens von Bonamia-ostreae-Infektion oder zur Ausräumung eines Verdachts darauf

Muss ein Verdacht auf Bonamia-ostreae-Infektion gemäß Artikel 28 der Richtlinie 2006/88/EG bestätigt oder ausgeräumt werden, so ist folgendes Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

Die amtliche Untersuchung umfasst mindestens eine Beprobung von 30 Weichtieren empfänglicher Arten, sofern der Verdacht auf einem Mortalitätsbericht beruht, oder andernfalls von 150 Weichtieren empfänglicher Arten nach Beginn des Übertragungszeitraums von Bonamia ostreae. Ist der Übertragungszeitraum nicht bekannt, so beginnt die Probenahme im Winter oder zu Beginn des Frühjahrs. Die Proben werden anhand der unter Ziffer i genannten Diagnosemethoden gemäß den in Anhang II Teil 5 Abschnitt I festgelegten detaillierten Diagnosemethoden und -verfahren untersucht.

i)

Das Auftreten von Bonamia ostreae gilt als bestätigt, wenn ein positiver Befund aus Histopathologie, Gewebeabdrücken oder In-situ-Hybridisierung in Kombination mit einem durch Sequenzierung gemäß den in Anhang II Teil 5 aufgeführten zugelassenen Methoden und Verfahren vervollständigtes positives PCR-Ergebnis vorliegt.

ii)

Der Verdacht auf das Auftreten der Bonamia-ostreae-Infektion gilt als ausgeräumt, wenn diese Tests keinen weiteren Nachweis für das Vorliegen von Bonamia ostreae ergeben.

Tabelle 5.A

Überwachungssystem für Mitgliedstaaten, Zonen und Kompartimente während des zweijährigen Kontrollzeitraums vor der Erlangung des Seuchenfreiheitsstatus in Bezug auf Bonamia ostreae gemäß Nummer I.2.1

 

Zahl der Gesundheitsuntersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der Weichtiere in der Probe

Betriebe/Weichtierzuchtgebiete

1

1

150


Tabelle 5.B

Überwachungssystem für Mitgliedstaaten, Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf Bonamia ostreae gemäß Nummer I.3

Risikoniveau

Zahl der Gesundheitsuntersuchungen

Zahl der Laboruntersuchungen

Zahl der Weichtiere in der Probe

hoch

einmal jährlich

eine alle zwei Jahre

150

mittel

eine alle zwei Jahre

eine alle zwei Jahre

150

gering

eine alle zwei Jahre

eine alle vier Jahre

150

TEIL 6

METHODEN FÜR DIE ÜBERWACHUNG UND BEKÄMPFUNG DER WEISSFLECKENKRANKHEIT (WSD)

I.   Anforderungen an Überwachungs- und Tilgungsprogramme für die Erlangung und Erhaltung des Seuchenfreiheitsstatus in Bezug auf WSD und zur Eindämmung von Infektionen mit WSSV

I.1.   Allgemeine Anforderungen an Untersuchungen und Probenahmen

Die Beprobung von Krebstieren für Laboruntersuchungen ist dann vorzunehmen, wenn die Wassertemperatur ihren wahrscheinlichen Jahreshöchststand erreicht. Dieses Erfordernis in Bezug auf die Wassertemperatur gilt auch für Gesundheitsuntersuchungen, sofern diese machbar und angezeigt sind.

Sind gemäß den Anforderungen dieses Teils Zuchtkrebstiere zu beproben, so gelten folgende Kriterien:

a)

sind geschwächte oder moribunde Krebstiere in den Produktionseinheiten vorhanden, so sind in erster Linie solche Krebstiere auszuwählen. Sind solche Krebstiere nicht vorhanden, so müssen die unterschiedliche Größenkohorten der ausgewählten empfänglichen Arten, d. h. Jungtiere und ausgewachsene Tiere, anteilig in der Probe vertreten sein;

b)

wird für die Krebsproduktion mehr als eine Wasserquelle verwendet, so müssen bei der Probenahme alle Wasserquellen berücksichtigt werden.

Ist gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG eine gezielte Überwachung der Wildpopulationen erforderlich, so sind Anzahl und geografische Verteilung der Probenahmestellen so zu bestimmen, dass eine angemessene Abdeckung des Mitgliedstaats, der Zone oder des Kompartiments gegeben ist. Die Probenahmestellen müssen auch für die verschiedenen Ökosysteme repräsentativ sein, in denen die empfänglichen Wildpopulationen leben, d. h. Meeressysteme, Mündungssysteme, Flusssysteme und Seen.

Ist gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG eine gezielte Überwachung der Wildpopulationen erforderlich, so sind die zu beprobenden Krebstiere wie folgt auszuwählen:

i)

In Meeres- und Mündungsgebieten sind eine oder mehrere der folgenden Arten auszuwählen: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus oder Geißelgarnelenarten, d. h. Penaeus. japonicus, Penaeus kerathurus, Penaeus semisulcatus. Sind diese Arten nicht vorhanden, so muss die Probe repräsentativ für die anderen vorhandenen empfänglichen Dekapoden-Arten sein; angesichts der breiten Palette empfänglicher Wirte können die Wirte aus Gattungen oder Familien der Dekapoden ausgewählt werden, deren Empfänglichkeit auf natürliche Weise oder experimentell nachgewiesen wurde;

ii)

in Fluss- und Seensystemen sind eine oder mehrere der folgenden Arten auszuwählen: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes oder Orconectes limosus. Sind diese Arten nicht vorhanden, so muss die Probe repräsentativ für die anderen vorhandenen empfänglichen Dekapoden-Arten sein; Angesichts der breiten Palette empfänglicher Wirte können die Wirte aus Gattungen oder Familien der Dekapoden ausgewählt werden, deren Empfänglichkeit auf natürliche Weise oder experimentell nachgewiesen wurde;

iii)

sind geschwächte oder moribunde Krebstiere vorhanden, so sind in erster Linie solche Krebstiere auszuwählen. Sind solche Krebstiere nicht vorhanden, so müssen die unterschiedlichen Größenkohorten der ausgewählten empfänglichen Arten, d. h. Jungtiere und ausgewachsene Tiere, anteilig in der Probe vertreten sein.

I.2.   Besondere Anforderungen bezüglich der Erlangung des Gesundheitsstatus der Kategorie I in Bezug auf WSD

I.2.1.   Überwachungsprogramme

a)

Ein Mitgliedstaat, eine Zone oder ein Kompartiment, der/die/das einen Gesundheitsstatus der Kategorie III gemäß Anhang III Teil B der Richtlinie 2006/88/EG in Bezug auf WSD innehat, kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, sofern alle Betriebe in diesem Mitgliedstaat, dieser Zone oder diesem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, den einschlägigen Anforderungen des Anhangs V der genannten Richtlinie entsprechen, und alle diese Betriebe und, soweit gemäß Anhang V Teil I Nummer 2 Absatz 2 der Richtlinie 2006/88/EG erforderlich, die nach der genannten Bestimmung ausgewählten Probenahmestellen in den Wildpopulationen folgendem zweijährigen Überwachungsprogramm, einschließlich Gesundheitsuntersuchungen und Probenahmen, unterzogen wurden:

Die Betriebe oder Probenahmestellen sind mindestens über einen Zeitraum von zwei aufeinanderfolgenden Jahren Gesundheitsuntersuchungen und Probenahmen gemäß Abschnitt II Tabelle 6.A unterzogen worden;

während dieses Zweijahreszeitraums haben die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnosemethoden Negativbefunde für WSD ergeben, und jeglicher Verdacht auf Vorliegen von WSD wurde gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen;

b)

wenn während der Durchführung des Überwachungsprogramms gemäß Buchstabe a in einem an dem Überwachungsprogramm teilnehmenden Betrieb eine Infektion mit WSSV bestätigt wird, und diesem daher der Gesundheitsstatus der Kategorie II entzogen wird, kann dem Betrieb sofort wieder der Gesundheitsstatus der Kategorie II zuerkannt werden und das Überwachungsprogramm zur Erlangung des Seuchenfreiheitsstatus kann weiter durchgeführt werden, ohne dass ein Tilgungsprogramm gemäß Nummer I.2.2 erforderlich wäre, sofern der Betrieb folgende Bedingungen erfüllt:

i)

es handelt sich um einen Binnenbetrieb, dessen Gesundheitsstatus in Bezug auf WSD gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von dem Gesundheitsstatus in den angrenzenden natürlichen Gewässern in Bezug auf diese aufgelistete Krankheit ist;

ii)

der Betrieb ist geleert, gereinigt, desinfiziert und stillgelegt worden, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

iii)

er wurde mit Krebstieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf WSD wiederaufgestockt.

I.2.2.   Tilgungsprogramme

I.2.2.1.   Allgemeine Anforderungen

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf WSD kann den Gesundheitsstatus der Kategorie I im Hinblick auf diese aufgelistete Krankheit erlangen, wenn alle Betriebe in dem Mitgliedstaat, der Zone oder dem Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, mindestens folgendem Tilgungsprogramm unterzogen wurden:

a)

Die Mindestbekämpfungsmaßnahmen gemäß Kapitel V Abschnitt 4 der Richtlinie 2006/88/EG sind wirksam angewandt worden und in unmittelbarer Nähe des Zuchtbetriebs/der Zuchtbetriebe, der/die offiziell für mit WSD verseucht erklärt worden ist/sind, ist ein Sperrgebiet gemäß Artikel 32 Buchstabe b der genannten Richtlinie eingerichtet worden, das eine Schutzzone und eine Überwachungszone umfasst.

Das Sperrgebiet muss auf Einzelfallbasis festgelegt worden sein; dabei müssen die Faktoren berücksichtigt worden sein, die die Risiken der Ausbreitung von WSD auf Zucht- und Wildkrebstiere beeinflussen, z. B.: Zahl, Prozentsatz und Verteilung der verendeten Krebstiere in dem mit WSD verseuchten Betrieb; Entfernung zu benachbarten Betrieben und Besatzdichte in diesen Betrieben; Kontaktbetriebe; in den Betrieben gehaltene Arten; Bewirtschaftungspraxis im betroffenen Betrieb und in den benachbarten Betrieben; hydrodynamische Bedingungen und andere epidemiologisch bedeutsame Faktoren.

Für die Einrichtung der Schutz- und Überwachungszonen gelten folgende Mindestanforderungen:

i)

in unmittelbarer Nähe eines Betriebs, der offiziell für mit WSD verseucht erklärt worden ist, wird eine Schutzzone eingerichtet, die Folgendes umfasst:

(1)

In Meeres- und Mündungsgebieten: das Gebiet im Umkreis von mindestens einer Gezeitenzonenbreite oder von mindestens 5 km um den offiziell für mit WSD verseucht erklärten Betrieb (je nachdem, welches dieser Gebiete das größere ist) oder ein entsprechendes Gebiet, das unter Berücksichtigung der betreffenden hydrodynamischen oder epidemiologischen Daten bestimmt wird; oder

(2)

in Süßwassergebieten: das gesamte Wassereinzugsgebiet des offiziell für mit WSD verseucht erklärten Betriebs; die zuständige Behörde kann die Schutzzone auf Teile des Einzugsgebiets begrenzen, sofern die Prävention der Verschleppung von WSD dadurch nicht beeinträchtigt wird;

ii)

außerhalb der Schutzzone wird eine Überwachungszone eingerichtet, die Folgendes umfasst:

(1)

in Meeresgebieten: ein Gebiet sich überschneidender Gezeitenzonen um die Schutzzone herum oder ein Gebiet um die Schutzzone herum, das einen Umkreis von 10 km um den Mittelpunkt der Schutzzone erfasst oder ein gleichwertiges Gebiet, das unter Berücksichtigung der geeigneten hydrodynamischen oder epidemiologischen Daten bestimmt wird oder

(2)

in Süßwassergebieten: ein erweitertes Gebiet außerhalb der ausgewiesenen Schutzzone;

b)

alle Betriebe in der Schutzzone, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden und die nicht offiziell für mit WSD verseucht erklärt worden sind, werden einer amtlichen Untersuchung unterzogen, die mindestens Folgendes umfasst:

i)

die Entnahme von Proben für die Untersuchung von zehn Krebstieren, wenn klinische oder postmortale Anzeichen von WSD beobachtet werden, oder von 150 Krebstieren, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden und

ii)

eine Gesundheitsuntersuchung; in den Betrieben, in denen die Tests gemäß Ziffer i Negativbefunde ergeben haben, werden während der Jahreszeit, zu der die Wassertemperatur wahrscheinlich ihre Jahreshöchststände erreicht, weiterhin einmal pro Monat Gesundheitsuntersuchungen durchgeführt, bis die Schutzzone gemäß Nummer I.2.2.1 Buchstabe c aufgehoben wird;

c)

alle Betriebe, die offiziell für mit WSD verseucht erklärt wurden, werden geleert, gereinigt, desinfiziert und stillgelegt, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen muss; nach Leerung und Desinfizierung aller offiziell für verseucht erklärten Betriebe ist eine mindestens dreiwöchige gleichzeitige Stilllegung erforderlich. Dieser Absatz gilt auch für neue Betriebe, die während der Durchführung des Tilgungsprogrammes offiziell für verseucht erklärt werden.

Während der Stilllegung der offiziell für verseucht erklärten Betriebe werden die Schutzzonen in Überwachungszonen umgewandelt.

Die zuständige Behörde kann beschließen, die Leerung, Reinigung, Desinfektion und Stilllegung von anderen Betrieben in den ausgewiesenen Schutz- und Überwachungszonen anzuordnen. Über die Dauer dieser Stilllegung entscheidet die zuständige Behörde auf der Grundlage einer Risikobewertung im Einzelfall;

d)

alle offiziell für verseucht erklärten Betriebe sowie alle anderen stillgelegten Betriebe in der Schutz- und Überwachungszone werden wiederaufgestockt

i)

mit Krebstieren, die aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf WSD stammen, oder

ii)

für einen Übergangszeitraum bis zum 31. Dezember 2020 mit Krebstieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem genehmigten WSD-Überwachungsprogramm.

Die Wiederaufstockung darf erst dann erfolgen, wenn alle Betriebe, die offiziell für mit WSD verseucht erklärt worden waren, gemäß Nummer I.2.2.1 Buchstabe c geleert, gereinigt, desinfiziert und stillgelegt worden sind;

e)

alle Betriebe in einem/einer von dem Tilgungsprogramm erfassten Mitgliedstaat, Zone oder Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der Richtlinie 2006/88/EG gehalten werden, und, sofern eine Überwachung der Wildpopulationen durchzuführen ist, alle gemäß Anhang V Teil I Nummer 2 der genannten Richtlinie ausgewählten Probenahmestellen müssen in der Folge mindestens dem in Nummer I.2.1 festgelegten Programm unterzogen werden.

I.2.2.2.   Anforderungen bezüglich der Wiedererlangung des Seuchenfreiheitsstatus in Bezug auf WSD für Binnenkompartimente, die einen einzigen Betrieb umfassen und zuvor als frei von WSD erklärt worden waren

Ein einen einzigen Betrieb umfassendes Binnenkompartiment mit einem Gesundheitsstatus der Kategorie I in Bezug auf WSD, dessen Gesundheitsstatus in Bezug auf diese aufgelistete Krankheit gemäß Anhang V Teil II Nummer 3 der Richtlinie 2006/88/EG unabhängig von den angrenzenden natürlichen Gewässern ist und dem der Gesundheitsstatus der Kategorie I gemäß Artikel 53 Absatz 3 der genannten Richtlinie entzogen worden ist, kann den Gesundheitsstatus der Kategorie I sofort wiedererlangen, wenn die zuständige Behörde bestätigt hat, dass folgende Bedingungen erfüllt sind:

a)

Der von WSD betroffene Betrieb ist geleert, gereinigt, desinfiziert und stillgelegt worden, wobei die Dauer der Stilllegung mindestens sechs Wochen betragen haben muss;

b)

der von WSD betroffene Betrieb wurde mit Krebstieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I in Bezug auf WSD wiederaufgestockt.

I.3.   Spezifische Anforderungen in Bezug auf die Erhaltung des Seuchenfreiheitsstatus (Gesundheitsstatus der Kategorie I) in Bezug auf WSD

Ist gemäß Artikel 52 der Richtlinie 2006/88/EG zur Erhaltung des Gesundheitsstatus der Kategorie I eine gezielte Überwachung erforderlich, so müssen alle Betriebe in dem betreffenden Mitgliedstaat, der betreffenden Zone oder dem betreffenden Kompartiment, in denen Tiere empfänglicher Arten im Sinne des Anhangs IV Teil II der genannten Richtlinie gehalten werden, einer Gesundheitsuntersuchung und Beprobung gemäß der Tabelle 6.B in Abschnitt II unterzogen werden; dabei ist dem Risikoniveau Rechnung zu tragen, das in dem Betrieb in Bezug auf die Einschleppung von WSD besteht.

In Mitgliedstaaten, Zonen oder Kompartimenten, in denen die Zahl der Betriebe begrenzt ist und in denen die gezielte Überwachung dieser Betriebe nicht genügend epidemiologische Daten ergibt, umfassen die Überwachungsprogramme für die Erhaltung des Seuchenfreiheitsstatus Probenahmestellen, die gemäß den Anforderungen in Nummer I.1 ausgewählt wurden.

Diese Probenahmestellen müssen nach dem Rotationsprinzip (50 % der Probenahmestellen pro Jahr) untersucht und beprobt werden. Die Beprobung erfolgt gemäß Tabelle 6.B in Abschnitt II. Die Proben sind gemäß den Diagnose- und Probenahmemethoden in Abschnitt II auszuwählen, aufzubereiten und zu untersuchen, und die Laboruntersuchungen müssen Negativbefunde in Bezug auf den WSD-Erreger ergeben haben.

Der Seuchenfreiheitsstatus bleibt nur erhalten, solange die Untersuchungen aller Proben mittels der in Nummer II.2 niedergelegten Diagnose- und Probenahmemethoden Negativbefunde für WSD ergeben und jeglicher Verdacht auf Vorliegen von WSD gemäß den in Nummer II.3 dargelegten Diagnosemethoden ausgeschlossen wird.

I.4.   Anforderungen bezüglich der Aufhebung der Sperrmaßnahmen gemäß Artikel 39 der Richtlinie 2006/88/EG (Wechsel von einem Gesundheitsstatus der Kategorie V zu einem Gesundheitsstatus der Kategorie III) in Bezug auf WSD

Ein Mitgliedstaat, eine Zone oder ein Kompartiment mit einem Gesundheitsstatus der Kategorie V in Bezug auf WSD kann den Gesundheitsstatus der Kategorie III in Bezug auf diese aufgelistete Krankheit erlangen, sofern:

a)

die in Nummer I.2.2.1 Buchstaben a, b und c niedergelegten Anforderungen erfüllt sind. Ist eine Stilllegung technisch nicht möglich, so müssen die Betriebe alternative Maßnahmen anwenden, die eine fast identische Garantie für die Ausrottung des WSSV im Betrieb und seiner Umgebung bieten;

b)

alle offiziell für mit WSD verseucht erklärten Betriebe sowie alle anderen Betriebe in den Schutz- und Überwachungszonen, die stillgelegt wurden oder Gegenstand alternativer Maßnahmen nach Buchstabe a waren, mit Krebstieren aus Mitgliedstaaten, Zonen oder Kompartimenten mit einem Gesundheitsstatus der Kategorie I, II oder III in Bezug auf WSD wiederaufgestockt worden sind;

c)

die Wiederaufstockung erst erfolgt ist, nachdem alle Betriebe, die offiziell für mit WSD verseucht erklärt worden waren, gemäß Buchstabe a geleert, gereinigt, desinfiziert und stillgelegt/alternativen Maßnahmen unterzogen worden sind;

d)

während eines Zeitraums von zwei Jahren nach Abschluss der Maßnahmen gemäß den Buchstaben a und b kein Auftreten von WSD festgestellt wurde und Verdachtsfälle während dieses Zeitraums nach den Verfahren gemäß Nummer II.3 ausgeräumt wurden.

II.   Diagnose- und Probenahmemethoden

II.1.   Proben

Proben von integumentaler Epidermis, seziert oder in Laufbeinen enthalten, Schwimmbeinen, Mundwerkzeugen oder Kiemen des zu untersuchenden Tieres werden vor der Vorbereitung von Proben für die PCR in 95 %igem Ethanol fixiert.

Zur Untermauerung der bei der PCR gewonnenen Daten können auch andere Proben, die für Histologie und Transmissionselektronenmikroskopie fixiert wurden, herangezogen werden.

II.2.   Diagnosemethoden für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf WSD

Die Diagnosemethode für die Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf WSD gemäß den in Anhang II Teil 6 ausgeführten detaillierten Diagnosemethoden und -verfahren ist die zweistufige PCR.

Ergibt die zweistufige PCR einen Positivbefund, so ist das Ergebnis durch eine Sequenzierug des Amplikons zu bekräftigen, bevor erste Bekämpfungsmaßnahmen gemäß Artikel 28 der Richtlinie 2006/88/EG durchgeführt werden, und zwar, sofern möglich, unter praktischen Bedingungen durch den Nachweis pathognomonischer Anzeichen von WSD in den ausgewählten Wirten mittels Histologie und Transmissionselektronenmikroskopie.

II.3.   Amtliche Untersuchung und Diagnosemethoden für die Bestätigung einer WSD-Infektion bzw. die Ausräumung eines Verdachts darauf

Muss gemäß Artikel 28 der Richtlinie 2006/88/EG eine WSD-Infektion ausgeschlossen bzw. ein Verdacht darauf ausgeräumt werden, so ist folgendes Untersuchungs-, Probenahme- und Testverfahren anzuwenden:

a)

die amtliche Untersuchung umfasst mindestens eine Gesundheitsuntersuchung und eine Beprobung von zehn Krebstieren, wenn klinische oder postmortale Anzeichen einer WSD-Infektion beobachtet werden, oder von 150 Krebstieren, wenn keinerlei klinische oder postmortale Anzeichen beobachtet werden. Die Proben werden gemäß den unter Nummer II.2 aufgeführten Diagnosemethoden untersucht (zweistufige PCR);

b)

Das Vorliegen von WSD gilt als bestätigt, wenn der Befund aus der zweistufigen PCR, gefolgt von einer Sequenzierung gemäß den in Anhang II Teil 6 aufgeführten detaillierten Diagnosemethoden und -verfahren positiv ist und die ausgewählten Wirte pathognomonische Anzeichen von WSD aufweisen.

Ein Verdacht auf WSD gilt als ausgeräumt, wenn diese Tests keine weiteren Nachweise für das Vorhandensein von WSD ergeben.

Tabelle 6.A

Überwachungssystem für Mitgliedstaaten, Zonen und Kompartimente während des zweijährigen Kontrollzeitraums vor der Erlangung des Seuchenfreiheitsstatus in Bezug auf WSD gemäß Nummer I.2.1

 

Zahl der klinischen Untersuchungen pro Jahr

Zahl der Laboruntersuchungen pro Jahr

Zahl der Krebstiere in der Probe

Betriebe/Probenahmestellen

1

1

150


Tabelle 6.B

Überwachungssystem für Mitgliedstaaten, Zonen oder Kompartimente zur Erhaltung des Seuchenfreiheitsstatus in Bezug auf WSD gemäß Nummer I.3

Risikoniveau

Zahl der Gesundheitsuntersuchungen

Zahl der Laboruntersuchungen

Zahl der Krebstiere in der Probe

hoch

einmal jährlich

eine alle zwei Jahre

150

mittel

eine alle zwei Jahre

eine alle zwei Jahre

150

gering

eine alle zwei Jahre

eine alle vier Jahre

150


(1)  Die Proben sind frühestens drei Wochen nach der Umsetzung der Fische von Süß- in Salzwasser zu entnehmen.

(2)  Ovarien- und Samenflüssigkeit von Laichfischen wird zum Zeitpunkt der Reife in Verbindung mit dem „Abstreifen“ entnommen.

(3)  Proben müssen von einer Zahl der Fische genommen werden, die die Erkennung von VHSV oder IHNV mit einer statistischen Zuverlässigkeit von 95 % sicherstellt, wenn die Design-Prävalenz 5 % beträgt.

(4)  Die Proben sind frühestens drei Wochen nach der Umsetzung der Fische von Süß- in Salzwasser zu entnehmen.

(5)  Ovarien- und Samenflüssigkeit von Laichfischen wird zum Zeitpunkt der Reife in Verbindung mit dem „Abstreifen“ entnommen.

(6)  Proben müssen von einer Zahl der Fische genommen werden, die die Erkennung von VHSV oder IHNV mit einer statistischen Zuverlässigkeit von 95 % sicherstellt, wenn die Design-Prävalenz 10 % beträgt.

(7)  Die Proben sind frühestens drei Wochen nach der Umsetzung der Fische von Süß- in Salzwasser zu entnehmen.

(8)  Proben müssen von einer Zahl der Fische genommen werden, die die Erkennung von VHSV oder IHNV mit einer statistischen Zuverlässigkeit von 95 % sicherstellt, wenn die Design-Prävalenz 10 % beträgt.

(9)  Es ist mindestens eine Probe pro Gesundheitsuntersuchung zu ziehen.

(10)  Proben müssen von einer Zahl der Fische genommen werden, die die Erkennung von KHV mit einer statistischen Zuverlässigkeit von 95 % sicherstellt, wenn die Design-Prävalenz 5 % beträgt.

(11)  Gilt nicht für Betriebe, in denen ausschließlich Regenbogenforellen (Oncorhynchus mykiss) und/oder Forellen (Salmo trutta) aufgezogen werden und deren Wasserversorgung ausschließlich aus Süßwasserquellen stammt, in denen kein Atlantischer Lachs (Salmo salar) lebt.

(12)  Die Proben müssen während zweier jährlicher Testzeiträume von jeweils einem Monat (nämlich im Frühjahr und im Herbst) entnommen, gelagert und untersucht werden, oder wenn es aufgrund praktischer Überlegungen angemessen erscheint.

(13)  Höchstzahl Fische pro gepoolte Probe: 5.

(14)  Die Proben müssen während zweier jährlicher Testzeiträume von jeweils einem Monat (nämlich im Frühjahr und im Herbst) entnommen und untersucht werden, oder wenn es aufgrund praktischer Überlegungen angemessen erscheint.

(15)  Gilt nicht für Betriebe, in denen ausschließlich Regenbogenforellen (Oncorhynchus mykiss) und/oder Forellen (Salmo trutta) aufgezogen werden und deren Wasserversorgung ausschließlich aus Süßwasserquellen stammt, in denen kein Atlantischer Lachs (Salmo salar) lebt.


ANHANG II

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN

I.   Einleitung

Dieser Anhang enthält die detaillierten Verfahren für die Diagnosemethoden für die Laboruntersuchung im Rahmen der Tilgungs- und Überwachungsprogramme gemäß Anhang I dieses Beschlusses sowie für die Bestätigung oder Ausräumung des Verdachts des Vorliegens nach Artikel 57 Buchstabe b der Richtlinie 2006/88/EG folgender nicht exotischer Krankheiten gemäß Anhang IV Teil II der genannten Richtlinie („aufgelistete Krankheiten“):

1.

Virale hämorrhagische Septikämie (VHS)

Teil 1

2.

Infektiöse hämatopoetische Nekrose (IHN)

Teil 1

3.

Koi-Herpesvirus-Infektion (KHV-I)

Teil 2

4.

Infektiöse Anämie der Lachse (ISA)

Teil 3

5.

Marteilia-refringens-Infektion

Teil 4

6.

Bonamia-ostreae-Infektion

Teil 5

7.

Weißpünktchenkrankheit der Krebstiere (WSD)

Teil 6

II.   Begriffsbestimmungen

Für die Zwecke dieses Anhangs bezeichnet der Ausdruck „Transportmedium“ ein Zellkulturmedium mit 10 % Kälberserum und mit entweder 200 IE Penicillin, 200 μg Streptomycin und 200 μg Kanamycin je ml oder anderen Antibiotika mit erwiesener Wirksamkeit.

TEIL 1

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG UND BESTÄTIGUNG VON IHN UND VHS

I.   Diagnosemethoden und -verfahren für die Überwachung auf VHS und IHN

Bei der Beprobung und Laboruntersuchung zum Zweck der Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf IHN oder VHS gemäß Anhang I Teil I Abschnitt I nach den in Teil 1 Nummern II.1 und II.2 des genannten Anhangs aufgeführten Diagnosemethoden sind die im Folgenden unter den Nummern I.1 bis I.6 aufgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden:

I.1.   Vorbereitung und Versand von Fischproben

I.1.1.   Gewebematerial für virologische Untersuchungen auf Zellkultur

Vor dem Versand oder der Überführung zum Labor müssen dem Fisch mit sterilen Sektionsinstrumenten die zu untersuchenden Organe entnommen und in sterile Kunststoffröhrchen gefüllt werden, die ein Transportmedium enthalten.

Die geeignete Menge an Fischmaterial für virologische Untersuchungen auf Zellkultur und mittels RT-qPCR hängt von der Größe der Fische ab. Daher sind bei Fischbrut ganze Tiere (Körperlänge < 4 cm), Innereien einschließlich der Nieren (4 cm < Körperlänge < 6 cm) oder bei größeren Fischen Nieren, Milz, Herz und/oder Gehirn und bei Laichfisch während des Laichens Ovarienflüssigkeit zu beproben.

Ovarienflüssigkeit, Samenflüssigkeit oder Organteile von höchstens zehn Fischen können als Sammelprobe in ein steriles Röhrchen gefüllt werden, das mindestens 4 ml Transportmedium enthält. Jede Gewebeprobe muss mindestens 0,5 g wiegen.

Mit der virologischen Untersuchung auf Zellkultur ist baldmöglichst zu beginnen, spätestens jedoch 48 Stunden nach der Probenahme. In Ausnahmefällen kann die virologische Untersuchung innerhalb von 72 Stunden nach der Materialentnahme begonnen werden, sofern das Untersuchungsmaterial durch das Transportmedium geschützt war und die Temperaturanforderungen während des Transports erfüllt werden können.

I.1.2.   Proben für die Analyse mittels Reverser Transkriptase-Polymerase-Kettenreaktion (RT-PCR oder RT-qPCR)

Fischproben werden gemäß dem Verfahren in Nummer I.1.1 mithilfe eines sterilen Instruments entnommen und in sterile Kunststoffröhrchen überführt, die Transportmedium enthalten. In einem Röhrchen kann Gewebematerial von zehn Fischen als Sammelprobe zusammengeführt werden. Liegt jedoch nur eine geringe Menge an Inokulum vor, darf nur Gewebematerial von höchstens fünf Fischen verwendet werden. Alternativ können Proben in RNA-Stabilisierungsreagenzien wie 0,2 g Gewebe/ml Reagens gemäß der Empfehlung des Herstellers gepoolt werden; dennoch ist jeder Fisch einzeln zu verarbeiten und darf in den Proben aufgrund der geringen Menge an für die Entnahme genutztem Material nicht gepoolt werden.

Auch ganze Fische können an das Labor geschickt werden.

I.2.   Versand von Fischproben

Die Röhrchen, die Fischgewebe in Transportmedium für Zellkultur oder Analyse mittels RT-PCR/RT-qPCR enthalten, werden in Isolierbehälter, z. B. in dickwandige Styroporkisten, gepackt, die genügend Eis oder alternatives Kühlmedium enthalten, um zu gewährleisten, dass die Proben beim Transport zum Labor gekühlt gehalten werden. Das Einfrieren der Proben ist jedoch zu vermeiden. Während des Transports darf die Temperatur einer Probe zu keiner Zeit mehr als 10 °C betragen, und bei der Ankunft muss im Transportbehälter noch Eis vorhanden sein oder mindestens ein Kühlelement noch teilweise oder vollständig gefroren sein.

Ganze Fische können zum Labor geschickt werden, sofern die Temperaturanforderungen gemäß Absatz 1 während des Transports erfüllt werden können. Ganzer Fisch muss mit Saugpapier umhüllt und in einem Plastikbeutel versandt werden. Auch lebende Fische können transportiert werden.

I.3.   Entnahme von zusätzlichem Diagnosematerial

Mit Einverständnis des Diagnoselabors kann weiteres Fischgewebe entnommen und für Zusatzuntersuchungen aufbereitet werden.

I.4.   Aufbereitung der Proben zur Untersuchung in Zellkultur und mittels RT-qPCR

I.4.1.   Einfrieren in Ausnahmefällen

Sollten praktische Schwierigkeiten auftreten, die es unmöglich machen, die Proben innerhalb von 48 Stunden nach der Entnahme des Fischgewebes zu untersuchen, so kann ein Einfrieren der Gewebeproben in Transportmedium bei – 20 °C oder einer tieferen Temperatur und eine virologische Untersuchung innerhalb von 14 Tagen akzeptabel sein. Das Fischgewebe darf jedoch vor der Untersuchung nur einmal eingefroren und aufgetaut werden. Es sind Aufzeichnungen zu den genauen Gründen für jedes Einfrieren von Fischgewebeproben zu führen.

I.4.2.   Homogenisieren der Organe

Im Labor muss das Fischgewebe mit einem Stomacher, Mixer oder Mörser und Pistill mit sterilem Sand vollständig homogenisiert werden. Das Homogenat wird anschließend im ursprünglichen Transportmedium suspendiert.

Besteht die Probe aus einem ganzen Fisch von weniger als 4 cm Länge, so muss dieser mithilfe einer sterilen Schere oder eines sterilen Skalpells nach Entfernen des hinter der Darmöffnung liegenden Körperteils zerlegt werden. Besteht die Probe aus einem ganzen Fisch von 4 bis 6 cm Länge, so sind die Innereien einschließlich der Nieren zu entnehmen. Besteht die Probe aus einem ganzen Fisch von mehr als 6 cm Länge, so sind die Gewebeproben wie in Nummer I.1 beschrieben zu entnehmen. Die Gewebeproben müssen mithilfe einer sterilen Schere oder eines sterilen Skalpells zerlegt, wie in Absatz 1 beschrieben homogenisiert und im Transportmedium suspendiert werden.

Das Volumenverhältnis zwischen Gewebematerial und Transportmedium ist im Labor auf 1:10 einzustellen.

I.4.3.   Zentrifugieren des Homogenats

Das Homogenat wird in einer auf 2 bis 5 °C gekühlten Zentrifuge bei 2 000 bis 4 000 × g 15 Minuten lang abgeschleudert. Der Überstand wird aufgefangen und entweder vier Stunden bei 15 °C oder über Nacht bei 4-8 °C antibiotisch behandelt. Wurde die Probe in Transportmedium versandt, so ist eine antibiotische Behandlung des Überstands nicht nötig.

Sollten praktische Schwierigkeiten auftreten, z. B. Inkubatorausfall oder Probleme mit Zellkulturen, die eine Beimpfung der Zellen innerhalb von 48 Stunden nach der Entnahme der Fischgewebeproben verhindern, so können der Überstand bei – 80 °C eingefroren und die virologische Untersuchung innerhalb der nächsten 14 Tage vorgenommen werden.

Sofern der aufgefangene Überstand innerhalb von 48 Stunden nach der Probenentnahme bei – 80 °C gelagert wird, kann er noch ein einziges weiteres Mal zur virologischen Untersuchung verwendet werden.

Vor der Zellbeimpfung ist der Überstand zu gleichen Teilen mit einem angemessen verdünnten Pool von Antiseren, die Antikörper gegen die einheimischen Serotypen der Infektiösen Pankreasnekrose enthalten, zu mischen und mindestens eine Stunde bei 15 °C oder höchstens 18 Stunden bei 4 °C zu inkubieren. Bei einem 50 %igen Plaquetest muss der Antiserumtiter mindestens 1:2 000 betragen.

Die Behandlung aller Inokula mit IPNV-Antiserum dient der Vorbeugung gegen einen IPNV-induzierten zytopathischen Effekt (CPE) bei beimpften Zellkulturen. Dadurch werden die Dauer der virologischen Untersuchungen und die Zahl der Fälle reduziert, bei denen ein zytopathischer Effekt als Indiz für VHSV oder IHNV gewertet werden müsste.

Stammen die Proben aus Produktionseinheiten, die als IPN-frei gelten, so kann auf die Behandlung der Inokula mit IPNV-Antiserum verzichtet werden.

I.4.4.   Vorbereitung der Proben für RT-PCR- und RT-qPCR-basierte Überwachungsprogramme

Wurden die Proben in Transportmedium gesammelt, ist das Verfahren gemäß den Punkten I.4.2 und I.4.3 durchzuführen. Nach dem Zentrifugieren ist der Überstand aufzufangen und RNA zu extrahieren. Soll die weitere Untersuchung nicht unmittelbar nach dem Zentrifugieren durchgeführt werden, so werden die Proben sofort bei – 20 °C oder einer tieferen Temperatur eingefroren.

Für die Analyse von Fischgewebe in RNA-Stabilisierungsreagenzien, müssen die folgenden Arbeiten je nach Lagertemperatur der Proben innerhalb folgender Zeiträume vorgenommen werden:

 

bei 37 °C gelagerte Proben: innerhalb eines Tages;

 

bei 25 °C gelagerte Proben: innerhalb einer Woche;

 

bei 4 °C gelagerte Proben: innerhalb eines Monats;

 

bei – 20 °C gelagerte Proben: unbefristet.

Sammelproben in RNA-Stabilisierungsreagenzien sind wie Einzelproben in RNA-Stabilisierungsreagenzien zu behandeln. Für Sammelproben in RNA-Stabilisierungsreagenzien darf die Probenmenge die vom Hersteller für eine Extraktion mit RNA-Kits wie RNeasy-Mini-Kits (Qiagen) o. Ä. empfohlene Menge nicht überschreiten. Werden größere Proben gepoolt, müssen die Extraktionskits oder -methoden dies widerspiegeln.

In RNA-Stabilisierungsreagenzien zusammengefügte Proben sind nicht für Zellkultur zu verwenden.

I.4.5.   Poolen von Proben für RT-qPCR

Da die Protokolle für RT-qPCR eine ähnliche oder höhere Empfindlichkeit als Zellkulturmethoden aufweisen, ist es akzeptabel, den Überstand von homogenisiertem Fischgewebematerial aus gepoolten Organen von bis zu zehn Fischen in Zellkulturmedium zu verwenden. Da bei der PCR jedoch wesentlich weniger Inokulum verwendet wird als in der Zellkultur, müssen alle Fischgewebe sorgfältig homogenisiert werden, bevor das Material für die Extraktion zusammengestellt wird.

Der gleiche Grundsatz gilt auch für Proben in RNA-Stabilisierungsreagenzien. In diesem Fall ist es jedoch oft schwierig, repräsentatives Material von bis zu zehn Fischen in einem Röhrchen zu sammeln, und die Zahl der Fische pro Sammelprobe ist daher auf zwei bis fünf beschränkt.

I.5.   Virologische Untersuchungen auf Zellkultur

I.5.1.   Zellkulturen und Nährböden

BF-2-Zellen (Bluegill fry Zelllinie 2) oder RTG-2-Zellen (Rainbow trout gonad Zelllinie 2) und entweder EPC- oder FHM-Zellen (Epithelioma-papulosum-cyprini-Zellen bzw. Fathead-minnow-Zellen) werden bei 20 bis 30 °C in einem geeigneten Medium, d. h. Eagle's MEM (oder entsprechende Modifikationen), versetzt mit 10 % Rinderfötenserum und Antibiotika in Standardkonzentrationen, angezüchtet.

Werden die Zellen in verschlossenen Phiolen kultiviert, ist das Medium mit Bikarbonat zu puffern. Werden die Zellkulturen in offenen Phiolen angesetzt, so kann das Medium mit Tris(hydroxymethyl)aminomethan-HCl (Tris-HCl) (23 mM) und Natriumhydrogencarbonat (6 mM) gepuffert werden. Der pH-Wert muss 7,6 ± 0,2 betragen.

Für die Beimpfung mit Fischgewebematerial sind, soweit möglich, junge, in der Regel einen Tag alte, einschichtige Zellkulturen zu verwenden; eine Altersspanne von 4 bis 48 Stunden ist jedoch akzeptabel. Die Zellen müssen zum Zeitpunkt der Beimpfung aktiv wachsen.

I.5.2.   Beimpfen von Zellkulturen

Um homologe Interferenz zu vermeiden, sind die Zellkulturen in zwei Verdünnungsstufen mit der antibiotikabehandelten Organsuspension zu beimpfen, nämlich mit der Ausgangsverdünnung und mit einer 1:10-Verdünnung davon, wodurch Endverdünnungen des Gewebematerials im Zellkulturmedium von 1:100 bzw. 1:1 000 erreicht werden. Es sind mindestens zwei Zelllinien gemäß Nummer I.5.1 zu beimpfen. Das Volumenverhältnis zwischen Inokulum und Zellkulturmedium muss ungefähr 1:10 betragen.

Für jede Verdünnung und jede Zelllinie ist eine Zellkulturfläche von mindestens 2 cm2 zu verwenden; dies entspricht einem Well einer 24-Well-Kulturplatte. Soweit möglich, sind Kulturplatten zu verwenden.

I.5.3.   Inkubation der Zellkulturen

Die beimpften Zellkulturen müssen sieben bis zehn Tage bei 15 °C inkubiert werden. Bei einem Farbumschlag des Zellkulturnährmediums von Rot nach Gelb als Indiz für eine Übersäuerung ist der pH-Wert mit steriler Bikarbonatlösung oder anderen Stoffen mit gleichwertiger Wirkung so einzustellen, dass eine Virusinfektion der Zellen möglich ist.

Zur Überprüfung der Infektionsanfälligkeit der Zellkulturen ist tiefgefrorene VHSV- und IHNV-Vorratslösung mindestens alle sechs Monate oder bei Verdacht auf verringerte Anfälligkeit zu titrieren. Soweit möglich, ist das Verfahren gemäß Abschnitt III zu verwenden.

I.5.4.   Mikroskopische Untersuchung

Die beimpften Zellkulturen sind regelmäßig, mindestens dreimal wöchentlich, unter dem Mikroskop mit 40- bis 150facher Vergrößerung auf das Auftreten eines zytopathischen Effekts (CPE) zu überprüfen. Bei offenkundigem CPE ist sofort ein Virusnachweis gemäß Nummer I.6 durchzuführen.

I.5.5.   Subkultivierung

Tritt nach sieben- bis zehntägiger Erstinkubierung kein zytopathischer Effekt auf, so ist eine Subkultur mit frischen Zellkulturen anzulegen, wobei eine ähnliche Zellfläche zu verwenden ist wie bei der Stammkultur.

Aliquote Mengen Nährmedium (Überstand) von sämtlichen Kulturen oder Wells der Stammkultur sind je nach Zelllinie sieben bis zehn Tage nach der Beimpfung zu einer Sammelprobe zu vereinen. Die Sammelproben müssen dann, wie in Nummer I.5.2 beschrieben, unverdünnt und 1:10 verdünnt (wodurch Endverdünnungen des Überstands von 1:10 bzw. 1:100 erreicht werden) in homologe Zellkulturen verimpft werden. Alternativ können aliquote Mengen von 10 % des Nährmediums der Stammkultur direkt in einem Well mit einer frischen Zellkultur verimpft werden (durch Anlegen einer Subkultur von Well zu Well). Vor dem Beimpfen können die Lösungen mit dem IPNV-Antiserum in einer angemessenen Verdünnungsstufe gemäß Nummer I.4.3 inkubiert werden.

Die beimpften Kulturen sind dann sieben bis zehn Tage bei 15 °C zu inkubieren und gemäß Nummer I.5.4 zu überprüfen.

Tritt innerhalb der ersten drei Tage der Inkubierung ein toxischer CPE auf, so muss in dieser Phase eine Subkultur angelegt werden. Die Zellen müssen dann jedoch sieben Tage inkubiert werden; danach ist eine weitere Subkultur anzulegen, die nochmals sieben Tage zu inkubieren ist. Entwickelt sich der toxische CPE nach drei Tagen, so sind die Zellen nur einmal zu übertragen und zu inkubieren, um eine Gesamtzeit von 14 Tagen ab der Erstbeimpfung zu erreichen. In den letzten sieben Tagen der Inkubation darf keine Toxizität auftreten.

Kommt es trotz Antibiotikabehandlung zu Bakterienkontamination, so ist der Überstand vor dem Anlegen einer Subkultur bei 2 000 bis 4 000 × g und 2-5 °C 15-30 Minuten zu zentrifugieren und/oder durch ein 0,45-μm-Filter (Membran mit geringer Proteinbindung) zu filtrieren. Zusätzlich gilt für die Subkultivierung dasselbe Verfahren wie bei toxischem CPE gemäß Absatz 4.

Tritt kein CPE auf, kann der Test als negativ gelten.

I.6.   Virusnachweis

Bei offenkundigem Auftreten eines zytopathischen Effekts in einer Zellkultur muss das Nährmedium (Überstand) aufgefangen und nach einem oder mehreren der folgenden Verfahren untersucht werden: Enzym-Immunassay (ELISA), Immunfluoreszenztest (IF-Test), Neutralisationstest, RT-PCR oder RT-qPCR. Haben diese Tests innerhalb einer Woche keinen eindeutigen Virusnachweis erbracht, so ist der Überstand zum sofortigen Nachweis an das nationale Referenzlaboratorium oder an das EU-Referenzlaboratorium für Fischseuchen gemäß Anhang VI der Richtlinie 2006/88/EG weiterzuleiten.

I.6.1.   ELISA

Zur Bestimmung des Virusisolats ist ein Doppelter-Antikörper-Sandwich-ELISA durchzuführen. Mikrotiter-Platten sind mit 50 μl/Well (0,9 pg) erwiesenermaßen hochwertigem, A-Eiweiß gereinigtem Immunglobulin (Ig) aus Kaninchen-Antiseren gegen IHNV oder VSHV, verdünnt in Carbonat-Pufferlösung (pH 9,6) mit 15 mM Natriumazid zu beschichten und zwischen 18 Stunden und zwei Wochen bei 4 °C zu inkubieren.

Alle Proben enthalten 1 % Triton X-100; die Positivkontrollen sind auf einer Verdünnungsplatte mit Pufferlösung (nämlich mit phosphatgepufferter Kochsalzlösung (PBS)-T-BSA, 1 % BSA) vierfach zu verdünnen: unverdünnt, 1:4, 1:16, 1:64. Die ELISA-Platten sind mit PBS mit 0,05 % Tween 20 (PBS-T) zu waschen und 50 μl jeder Verdünnungsstufe sind von der Verdünnungsplatte auf die gewaschene und beschichtete ELISA-Platte zu übertragen.

Die ELISA-Platten werden anschließend für 30 Minuten bei 37 °C inkubiert. Danach sind die Platten zu waschen und für 30 Minuten bei 37 °C mit spezifischen monoklonalen Antikörpern zu inkubieren (insbesondere zum Nachweis von VHSV MAK IP5B11 bzw. IHNV Hyb 136-3). 50 μl Meerrettichperoxidase(HRP)-konjugierter Kaninchen anti-Maus-Antikörper, 1:1 000 in PBS-T-BSA verdünnt, sind auf die ELISA-Platte zu übertragen.

Nach erneuter Waschung werden die Reaktionen schließlich durch Hinzufügen von 50 μl ortho-Phenyldiamin (OPD)/Well entwickelt. Die ELISA-Platten sind 20 Minuten bei Raumtemperatur im Dunkeln zu inkubieren und die Reaktion ist durch Zugabe von 100 μl 0,5 M H2SO4/Well zu stoppen.

Die Extinktion ist bei einer Wellenlänge von 492 nm und 620 nm mit einem ELISA-Lesegerät zu überwachen. Nach Vergleich der Testergebnisse mit den Extinktionswerten der positiven und negativen Kontrollen werden die Proben als positiv oder negativ eingeordnet. Im Allgemeinen gelten Proben mit einer kombinierten Extinktion (A) < 0,5 für unverdünntes Material als negativ, Proben mit A-Werten zwischen 0,5 und 1,0 als verdächtig und Proben mit A-Werten > 1,0 als positiv.

Anstelle der in diesem Absatz genannten dürfen auch andere ELISA-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

I.6.2.   Immunfluoreszenz (IF)

Der Nachweis der aufgelisteten Krankheitserreger VHSV oder IHNV erfolgt durch die Infektion von Zellen auf „schwarzen“ 96-Well-Platten, herkömmlichen 24-Well-Platten oder auf Deckglas-Objektträgern in 24-Well-Platten. Werden IHNV und/oder VHSV durch die Infektion von Zellen auf Deckglas-Objektträgern nachgewiesen, ist folgendes Protokoll zu verwenden:

a)

Die Deckglas-Objektträger sind mit Zellen in einer Dichte zu beschichten, die nach 24-stündiger Kultivierung eine 60- und 90 %ige Konfluenz ergibt. Wegen ihres festen Anhaftens an Glasflächen sind zu diesem Zweck möglichst EPC-Zellen zu verwenden, aber es können auch andere Zelllinien wie z. B. BF-2, RTG-2 oder FHM verwendet werden. Einen Tag alte, einschichtige Zellkulturen sind mit 150 μl Zellkultur-Überstand in zwei verschiedenen Verdünnungen (1:10 und 1:1 000) doppelt zu beimpfen und bei 15 °C für 24 Stunden zu inkubieren;

b)

anschließend ist das Zellkulturmedium zu entfernen und die infizierten einschichtigen Zellkulturen sind mit 0,5 ml eiskalter, wässriger Acetonlösung (80 % vol:vol) zu fixieren. Die Fixierung erfolgt bei Raumtemperatur unter eine Absaughaube und dauert 15 Minuten; anschließend wird die Acetonlösung entfernt und die Deckglas-Objektträger werden mindestens 30 Minuten luftgetrocknet. Nach dieser Phase werden die Platten entweder unverzüglich verarbeitet oder bei – 20 °C zur weiteren Verwendung eingelagert;

c)

spezifische monoklonale Antikörper (insbesondere zum Nachweis von VHSV MAK IP5B11 bzw. IHNV Hyb 136-3) sind in 0,01 M PBST, pH-Wert 7,2, in dem vom Lieferanten der monoklonale Antikörper empfohlenen Verhältnis zu verdünnen; Pro Well werden 50 bis 100 μl der fixierten einschichtigen Zellkultur hinzugefügt, danach werden die Platten für eine Stunde bei 37 °C in feuchter Umgebung inkubiert;

d)

die Deckgläser sind dreimal behutsam mit Waschpuffer (PBS mit 0,05 % Tween-20 (PBS-T) zu waschen, und nach dem letzten Spülen ist der Puffer vollständig zu entfernen. Anschließend werden die Zellen eine Stunde bei 37 °C unter Verwendung von Fluorescein-Isothiocyanat- (FITC) — oder mit Tetramethylrhodamin- 5- (und 6-) Isothiocyanat (TRITC)-konjugiertem anti-Maus-Immunglobulin als wichtigstem Antikörper, verdünnt nach Anweisungen des Lieferanten, inkubiert, nochmals gewaschen und getrocknet. Angefärbte Kulturen werden mit Glycerin-Kochsalzlösung auf Glasträger aufgezogen und unter UV-Bestrahlung untersucht. Dazu sind Okulare mit 10- oder 12facher Vergrößerung und Objektivlinsen mit 25- bis 40facher Vergrößerung und numerischer Apertur von > 0,7 bzw. > 1,3 zu verwenden.

Alternativ können in Bezug auf Zellkultur, Fixierung und Bezugsantikörper andere IF-Techniken mit erwiesenermaßen ähnlicher Wirksamkeit angewandt werden.

I.6.3.   Neutralisation

Aus dem aufgefangenen Überstand sind durch Zentrifugierung (2 000-4 000 × g) oder Membranfiltrierung (0,45 μm) mittels einer Membran mit geringer Proteinbindung Zellen zu entnehmen, und der Überstand ist 1:100 und 1:10 000 im Zellkulturmedium zu verdünnen.

Aliquote Mengen von mindestens zwei Verdünnungen des Überstands sind jeweils mit gleichen Teilen der folgenden Reagenzien zu versetzen und einzeln 60 Minuten bei 15 °C zu inkubieren:

a)

Serum mit gruppenspezifischen VHSV-Antikörpern in einer Verdünnung von 1:50 (vol:vol);

b)

Serum mit gruppenspezifischen IHNV-Antikörpern in einer Verdünnung von 1:50 (vol:vol);

c)

Antiseren (gepoolt) gegen die einheimischen IPNV-Serotypen in einer Verdünnung von 1:50 (vol:vol);

d)

nur Nährmedium (Positivkontrolle).

Es werden mindestens zwei Zellkulturen aus jeder Virus-Überstands-Mischung mit jeweils 50 μl beimpft und dann bei 15 °C inkubiert. Die Entwicklung von CPE ist gemäß Nummer I.5.4 zu überprüfen.

VHSV-Stämme und -Isolate, die in Neutralisationstests nicht reagieren, müssen durch IF oder ELISA nachgewiesen werden.

Alternativ können andere Neutralisationstests mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

I.6.4.   RT-PCR/RT-qPCR

I.6.4.1.   Vorbereitung viraler RNA

Alle Arbeiten mit RNA werden auf Eis und unter Verwendung von Handschuhen durchgeführt.

Die RNA ist mithilfe der Phenol-Chloroform-Methode oder durch RNA-Affinitäts-Spinsäulen entsprechend den Anweisungen des Herstellers zu extrahieren. Es dürfen im Handel erhältliche RNA-Extraktionskits verwendet werden, die hochwertige RNA ergeben und zur Verwendung mit den im Folgenden aufgeführten RT-PCR-Protokollen geeignet sind.

Die RNA wird in destilliertem, RNAse-freiem Wasser (nämlich mit 0,1 % Diethylpyrocarbonat behandeltem Wasser) oder einem geeigneten Elutionspuffer erneut suspendiert.

I.6.4.2.   RT-PCR

Für den Nachweis von IHNV sind folgende Primer zu verwenden:

 

Vorwärtsprimer 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′;

 

Rückwärtsprimer 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.

Folgende Zyklen sind anzuwenden (einstufige RT-PCR): 1 Zyklus: 50 °C über eine Dauer von 30 Minuten; 1 Zyklus: 95 °C über eine Dauer von 2 Minuten; 30 Zyklen: 95 °C über eine Dauer von 30 Sekunden, 50 °C über eine Dauer von 30 Sekunden, 72 °C über eine Dauer von 60 Sekunden; 1 Zyklus: 72 °C über eine Dauer von 7 Minuten und Einweichen bei 4 °C.

Für den Nachweis von VHSV sind folgende Primer zu verwenden:

 

VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′;

 

VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.

Folgende Zyklen sind anzuwenden (einstufige RT-PCR): 50 °C über eine Dauer von 30 Minuten, 95 °C über eine Dauer von 15 Minuten, 35 Zyklen bei 94 °C über eine Dauer von 30 Sekunden, 55 °C über eine Dauer von 30 Sekunden und 68 °C über eine Dauer von 60 Sekunden. Anschließend muss die Reaktion für 7 Minuten bei 68 °C gehalten werden.

Menge und Spezifität der RT-PCR-Reaktionen sind mittels Gelelektrophorese in 1,5 % Agarosegel mit Ethidiumbromid zu bewerten und unter UV-Transillumination zu beobachten. Bei IHNV kann ein 693 bp PCR-Amplikon beobachtet werden. Bei VHSV muss die Größe 505 bp betragen.

Die Ergebnisse der PCR können je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen, insbesondere könnte in Bezug auf die Temperaturprotokolle je nach verwendetem Thermozycler eine Optimierung erforderlich sein. Außerdem können aufgrund von falschem Primer-Annealing oder einer Kontamination des Labors falsch-positive Ergebnisse auftreten. Um jegliche Zweifel auszuschließen, sind daher geeignete Positiv- und Negativkontrollen und Sequenz-Amplikons einzubeziehen. In Bezug auf die VHSV-Primer ist bei der Verwendung von BF-2-Zellen besondere Vorsicht geboten, da die Primer mit der DNA-/RNA-Zelllinie reagieren und so falsch-positive Ergebnisse ähnlicher Größe ergeben können. Bei der Untersuchung von Überstand aus BF-2-Zellen sind alle amplifizierten PCR-Fragmente zu sequenzieren.

I.6.4.3.   RT-qPCR für VHSV

Die Amplifikation von VHSV erfolgt mithilfe folgender Primer und Sonde:

 

Vorwärtsprimer: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′;

 

Rückwärtsprimer: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′;

 

Sonde: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

Einstufige RT-qPCR:

Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Zyklusbedingungen: 50 °C über eine Dauer von 30 Minuten, 95 °C über eine Dauer von 15 Minuten, 40 Zyklen bei 94 °C über eine Dauer von 15 Sekunden, 60 °C über eine Dauer von 40 Sekunden, 72 °C über eine Dauer von 20 Sekunden; erforderlichenfalls anzupassen. Alternativ können andere RT-PCR oder RT-qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

I.6.4.4.   RT-qPCR für IHNV

Die Amplifikation von IHNV erfolgt mithilfe folgender Primer und Sonde:

 

Vorwärtsprimer: 5′- AGA-GCC-AAG-GCA-CTG-TGC-G-3′;

 

Rückwärtsprimer: 5′- TTCTTTGCGGCTTGGTTGA — 3′;

 

Sonde: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.

Zweistufige RT-qPCR:

Da der folgende Assay auf einer zweistufigen Amplifikation beruht, ist bei der Handhabung der Röhrchen zwischen den beiden Reaktionen besondere Vorsicht geboten, damit eine Kontaminierung verhindert wird.

Zyklusbedingungen (nach RT): 50 °C über eine Dauer von 2 Minuten, 95 °C über eine Dauer von 10 Minuten gefolgt von 40 Zyklen bei 95 °C über eine Dauer von 15 Sekunden und bei 60 °C über eine Dauer von 1 Minute; erforderlichenfalls sind Anpassungen vorzunehmen.

Alternativ können andere RT-PCR oder RT-qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

II.   Detaillierte Diagnosemethoden und -verfahren zur Bestätigung des Vorliegens von VHS oder IHN oder Ausräumung eines Verdachts darauf bei mutmaßlichen Seuchenausbrüchen

Ist zur Bestätigung des Vorliegens von IHN und/oder VHS oder zur Ausräumung eines Verdachts darauf gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG eine Laboruntersuchung unter Anwendung der in Anhang I Teil 1 Nummer II.3 erforderlich, so sind folgende detaillierten Methoden und Verfahren anzuwenden:

a)

Herkömmliche Virusisolierung mit anschließender Serumneutralisation und immunchemischem oder serologischem Virusnachweis,

b)

Virusnachweis mittels RT-PCR oder RT-qPCR;

c)

sonstige Diagnosetechniken wie IFAT, ELISA, RT-PCR oder IHC.

II.1.   Herkömmliche Virusisolierung mit anschließendem Virusnachweis

II.1.1.   Auswahl der Proben

Zur Untersuchung sind mindestens zehn Fische mit typischen IHN- oder VHS-Symptomen zu wählen.

II.1.2.   Aufbereitung und Versand von Fischproben

Die Aufbereitung und Lieferung zum Zweck der herkömmlichen Virusisolierung erfolgt gemäß den in Nummer I.2 festgelegten Methoden und Verfahren.

II.1.3.   Entnahme von zusätzlichem Diagnosematerial

Die Entnahme von zusätzlichem Diagnosematerial zum Zweck der herkömmlichen Virusisolierung erfolgt gemäß den in Nummer I.3 festgelegten Methoden und Verfahren.

II.1.4.   Aufbereitung von Proben zur Untersuchung in Zellkultur

Die Aufbereitung von Proben zur Untersuchung in Zellkultur zum Zweck der herkömmlichen Virusisolierung erfolgt gemäß den in Nummer I.4 festgelegten Methoden und Verfahren.

II.1.5.   Virologische Untersuchungen auf Zellkultur

Die virologische Untersuchung zum Zweck der herkömmlichen Virusisolierung erfolgt gemäß den in Nummer I.5 festgelegten Methoden und Verfahren.

II.1.6.   Virusnachweis

Der Virusnachweis zum Zweck der herkömmlichen Virusisolierung erfolgt gemäß den in Nummer I.6 festgelegten Methoden und Verfahren.

II.2.   Virusnachweis mittels RT-qPCR

II.2.1.   Auswahl der Proben

Die Auswahl der Proben zum Zweck des Virusnachweises mittels RT-qPCR erfolgt gemäß den in Nummer I.1.2 festgelegten Methoden und Verfahren.

II.2.2.   Aufbereitung und Versand von Fischproben

Die Aufbereitung und der Versand zum Zweck des Virusnachweises mittels RT-qPCR erfolgt gemäß den in Nummer I.2 festgelegten Methoden und Verfahren.

II.2.3.   Entnahme von zusätzlichem Diagnosematerial

Die Entnahme von zusätzlichem Diagnosematerial zum Zweck des Virusnachweises mittels RT-qPCR erfolgt gemäß den in Nummer I.3 festgelegten Methoden und Verfahren.

II.2.4.   Aufbereitung von Proben für die RT-qPCR

Die Aufbereitung von Proben zum Zweck des Virusnachweises mittels RT-qPCR erfolgt gemäß den in Nummer I.6.4.1 festgelegten Methoden und Verfahren.

II.2.5.   RT-qPCR

Der Virusnachweis mittels RT-qPCR erfolgt gemäß den in den Nummern I.6.4.1, I.6.4.3 und I.6.4.4 festgelegten Methoden und Verfahren.

II.3.   Andere Diagnosetechniken

Ein gemäß Nummer I.4.3. aufbereiteter Überstand kann entweder einem ELISA-Test nach Nummer I.6.1, einem indirekten Immunofluoreszenztest (IFAT) nach Nummer I.6.2 oder einer RT-PCR nach Nummer I.6.4. unterzogen werden. Gewebematerial kann mit anderen Diagnosetechniken (z. B. IFAT an Gefrierschnitten oder immunhistochemischen Analysen von Formalin-fixiertem Material) untersucht werden. Diese Schnelltechniken müssen durch eine virologische Untersuchung gemäß Nummer II Buchstabe a oder b innerhalb von 48 Stunden nach der Probenahme ergänzt werden, wenn

a)

ein Negativbefund vorliegt oder

b)

bei Probematerial, das bei einem ersten Ausbruch von IHN oder VHS entnommen wurde, ein Positivbefund vorliegt.

III.   Titrationsverfahren zur Überprüfung der Infektionsanfälligkeit der Zellkulturen

Wird zur Überprüfung der Infektionsanfälligkeit der Zellkulturen eine Titration gemäß Nummer I.5.3 durchgeführt, so müssen die in den folgenden Absätzen ausgeführten Verfahren befolgt werden.

Es sind mindestens zwei VHSV-Isolate und ein IHNV-Isolat zu verwenden. Die Isolate müssen repräsentativ für die wichtigsten Virusgruppen in der Europäischen Union sein; insbesondere ist im Fall von VHSV ein pathogenes Isolat von Regenbogenforelle in Süßwasser und ein für Steinbutt pathogenes Salzwasserisolat zu wählen, im Fall von IHNV ist ein für Regenbogenforelle pathogener Stamm aus der Europäischen Union zu wählen. Es sind definierte Isolate aus den Mitgliedstaaten zu verwenden. Viruschargen werden im Fall von VHSV auf BF-2- oder RTG-2-Zellen und im Fall von IHNV auf EPC- oder FHM-Zellen in wenigen Zellkulturpassagen in Kulturkolben gewonnen. Es ist ein Zellkulturmedium mit mindestens 10 % Serum zu verwenden. Für die Beimpfung ist eine niedrige MOI (< 1) zu verwenden.

Bei vollständigem CPE wird das Virus durch 15-minütiges Zentrifugieren des Zellkulturüberstands bei 2 000 × g gewonnen, steril membranfiltriert (0,45 μm) und in etikettierte Kryoröhrchen verteilt. Das Virus muss bei – 80 °C aufbewahrt werden.

Eine Woche nach dem Einfrieren sind drei Röhrchen mit jedem Virus unter kaltem Wasser aufzutauen und auf ihren jeweiligen Zelllinien zu titrieren. Jedes Virusisolat ist mindestens alle sechs Monate oder bei Verdacht auf verringerte Anfälligkeit der Zelllinien aufzutauen und zu titrieren.

Die Titrationsverfahren sind ausführlich zu beschreiben und jedes Mal auf die gleiche Weise durchzuführen.

Titration mit Verdünnung bis zum Endpunkt muss mindestens sechs Wiederholungen jedes Verdünnungsschritts umfassen. Die Titer werden mit zuvor ermittelten Titern verglichen. Fällt der Titer einer der drei Virusisolate um einen Faktor von 2 log oder mehr unter den ursprünglichen Titer, so darf die Zelllinie nicht mehr für Untersuchungszwecke verwendet werden.

Wenn im Labor unterschiedliche Zelllinien vorhanden sind, so muss jede Zelllinie getrennt überprüft werden.

Aufzeichnungen sind mindestens zehn Jahre aufzubewahren.

TEIL 2

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG UND BESTÄTIGUNG DER KOI-HERPESVIRUS-INFEKTION (KHV-I)

I.   Detaillierte Diagnosemethoden und -verfahren für die Bestätigung des Vorliegens von KHV-I oder zur Ausräumung eines Verdachts darauf

Ist zur Bestätigung des Vorliegens von KHV-I oder zur Ausräumung eines Verdachts darauf gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG eine Laboruntersuchung unter Anwendung der in Anhang I Teil 2 Abschnitt III erforderlich, so sind die unter den Nummern I.1 bis I.2 ausgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden.

I.1.   Aufbereitung der Fischproben

Für Diagnosezwecke können zur Untersuchung mittels herkömmlicher PCR- oder qPCR-basierter Methoden Fisch (lebend oder tot und getrennt in versiegelten, sterilen Behältern versandt) oder alternativ gefrorene Organe oder Organteile verwendet werden, die in 80 %igem bis reinem Ethanol oder einem viralen Transportmedium konserviert wurden (diese müssen innerhalb von 48 Stunden nach der Probenahme verarbeitet werden).

Für den Nachweis von KHV sind Kiemen und Nieren zu entnehmen; außerdem können bei einer ergänzenden Probe Milz, Gehirn, Därme beprobt werden. In akuten Fällen kann Gewebematerial von bis zu fünf Fischen gepoolt werden.

Darüber hinaus können in bestimmten Fällen (insbesondere wenn bei sehr wertvollen Fischen Verdacht auf KHV besteht) Proben verwendet werden, die keine Tötung der Tiere erfordern, wie Blut, Kiemenabstriche, Kiemenbiopsie oder Schleimabstriche.

I.1.1.   DNA-Extraktion

DNA wird nach den Standardverfahren extrahiert.

Es dürfen im Handel erhältliche DNA-Extraktionskits verwendet werden, die hochwertige DNA ergeben und zur Verwendung mit den in Nummer I.2 aufgeführten PCR-Protokollen geeignet sind.

I.2.   Nachweis und Bestimmung von Erregern mittels PCR-basierter Methoden

I.2.1.   qPCR zum Nachweis von KHV

Für den Nachweis von KHV mittels qPCR ist folgender qPCR-Test zu verwenden:

 

Vorwärtsprimer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;

 

Rückwärtsprimer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;

 

und Sonde (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Zyklusbedingungen: Ein Zyklus bei 95 °C über eine Dauer von 15 Minuten gefolgt von 40 Zyklen bei 94 °C über eine Dauer von 15 Sekunden und bei 60 °C über eine Dauer von 60 Sekunden. Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Alternativ können andere qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

I.2.2.   Herkömmliche PCR zum Nachweis für KHV

Es ist der im Folgenden beschriebene Assay zu verwenden, der auf das Thymin-Kinase (TK)-Gen von KHV abstellt. Alternativ können andere PCR-Assays mit erwiesenermaßen ähnlicher Empfindlichkeit und erwiesenermaßen ähnlichen Spezifitäten verwendet werden.

 

Vorwärtsprimer (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′;

 

Rückwärtsprimer (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.

Zyklusbedingungen: Ein Zyklus von 95 °C über eine Dauer von 5 Minuten, gefolgt von 35 Zyklen bei 95 °C über eine Dauer von 30 Sekunden, 52 °C über eine Dauer von 30 Sekunden, 72 °C über eine Dauer von 1 Minute und einem Zyklus bei 72 °C über eine Dauer von 10 Minuten. Die Größe der Produkte sollte bei 409 bp liegen.

Die Ergebnisse der PCR können je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen, insbesondere könnte in Bezug auf die Temperaturprotokolle je nach verwendetem Thermozycler eine Optimierung erforderlich sein. Außerdem können aufgrund von falschem Primer-Annealing oder Kontamination falsch-positive Ergebnisse auftreten. Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Alternativ können andere PCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

Die ersten Nachweise in einem Gebiet sind mittels Sequenzierung zu bestätigen oder zum sofortigen Nachweis an das nationale Referenzlaboratorium oder das EU-Referenzlaboratorium für Fischseuchen gemäß Anhang VI der Richtlinie 2006/88/EG weiterzuleiten.

II.   Detaillierte Diagnosemethoden und -verfahren für die Überwachung auf KHV-I

Bei der Beprobung und Laboruntersuchung zum Zweck der Erlangung oder Erhaltung des Seuchenfreiheitsstatus in Bezug auf KHV-I gemäß Anhang I Teil 2 Abschnitt I nach den in Teil 2 Abschnitte II oder III des genannten Anhangs aufgeführten Diagnosemethoden sind die im Folgenden unter den Nummern II.1 und II.2 aufgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden:

II.1.   Aufbereitung der Fischproben

Nach Möglichkeit sind Fische zu beproben, die für einen längeren Zeitraum in dem für das Virus förderlichen Temperaturbereich gehalten wurden, d. h. zwei bis drei Wochen bei 15 bis 26 °C. Damit bessere Chancen für einen Nachweis von KHV bestehen, müssen die Proben möglichst innerhalb von 24 Stunden, keinesfalls jedoch später als 72 Stunden nach Bewirtschaftungsvorgängen entnommen werden, die das Virus in Fischen mit Trägerstatus reaktivieren könnten, wie Netzfang oder Transport.

Für die Zwecke der Überwachung auf KHV-I kann Fisch lebend oder tot und getrennt in versiegelten, sterilen Behältern versandt werden; alternativ können zur Untersuchung mittels herkömmlicher PCR-basierter Methoden gefrorene Organe oder Organteile verwendet werden, die in 80 % bis 100 %igem Alkohol oder einem viralen Transportmedium konserviert wurden (diese müssen innerhalb von 48 Stunden nach der Probenahme verarbeitet werden). Bei der Überwachung auf KHV sind Kiemen und Nierengewebe zu entnehmen.

Bei der Überwachung auf KHV-I ist das Poolen soweit wie möglich zu vermeiden. Ist ein Poolen erforderlich, darf Gewebe von höchstens zwei Fischen gepoolt werden. Größere Proben werden mit Mörser und Pistill oder einem Stomacher homogenisiert, wobei vor der Klärung Unterproben zur DNA-Extraktion zu entnehmen sind. Alternativ dazu können Teilproben von jedem Gewebe in der Probe entnommen werden und in „Lyseröhrchen“ gefüllt werden.

II.1.1.   DNA-Extraktion

DNA wird nach den Standardverfahren extrahiert. Es dürfen im Handel erhältliche DNA-Extraktionskits verwendet werden, die hochwertige DNA ergeben und zur Verwendung mit den in Nummer II.2 aufgeführten PCR-Protokollen geeignet sind.

Das akzeptable Volumenverhältnis zwischen Gewebematerial und Transportmedium beträgt 1:9 w/v. Bei den Tests sind 20 bis 25 mg Gewebematerial zu verwenden.

II.2.   Überwachung auf KHV-I mit PCR-basierten Methoden

Für die Überwachung auf KHV ist eine qPCR zu verwenden. Ergeben Proben in einem Gebiet, in dem die Krankheit zuvor nicht bestätigt wurde, einen Positivbefund, so sind die Testergebnisse zu bestätigen

a)

durch Sequenzierung eines aus den Proben gewonnenen Produkts einer PCR oder verschachtelten PCR;

die sich dadurch ergebende bereinigte Konsensussequenz muss diesen Referenzsequenzen (zu mindestens 98 %) entsprechen.

b)

Alternativ dazu können Proben zwecks Bestätigung an ein nationales Referenzlabor geschickt werden.

II.2.1.   qPCR zum Nachweis von KHV

Es ist die im Folgenden beschriebene qPCR zu verwenden:

 

Vorwärtsprimer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;

 

Rückwärtsprimer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;

 

und Sonde (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Zyklusbedingungen: Ein Zyklus bei 95 °C über eine Dauer von 15 Minuten gefolgt von 50 Zyklen bei 94 °C über eine Dauer von 15 Sekunden und bei 60 °C über eine Dauer von 60 Sekunden.

Die Ergebnisse der qPCR können je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen, insbesondere könnte in Bezug auf die Temperaturprotokolle je nach verwendetem Thermozycler eine Optimierung erforderlich sein. Außerdem können aufgrund von falschem Primer-Annealing oder einer Kontamination des Labors falsch-positive Ergebnisse auftreten. Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Alternativ können andere qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

II.2.2.   Herkömmliche PCR zur Bestätigung von KHV

Zur Bestätigung einer KHV-Infektion ist die in der folgenden Tabelle 2.1 beschriebene generische verschachtelte PCR zu verwenden, gefolgt von einer Sequenzierung des amplifizierten Produkts.

Tabelle 2.1

Primer und Bedingungen für den geschachtelten PCR-Assay abzielend auf alle Cypriniden-Herpesviren (CyHV-1, CyHV-2 und CyHV-3)

Bezeichnung des Primers

Sequenz

Zyklusbedingungen

Größe der Produkte

CyHVpol-forward

5′-CCAGCAACATGTGCGACGG-3′

Erste PCR-Runde

1 Zyklus:

95 °C über eine Dauer von 2 Minuten.

40 Zyklen:

 

95 °C über eine Dauer von 30 Sekunden

 

55 °C über eine Dauer von 30 Sekunden

 

72 °C über eine Dauer von 45 Sekunden

1 Zyklus:

72 °C über eine Dauer von 10 Minuten;

362 bp

CyHVpol-reverse

5′-CCGTARTGAGAGTTGGCGCA-3′

CyHVpol-internal forward

5′-CGACGGVGGYATCAGCCC-3′

Zweite PCR-Runde

1 Zyklus:

95 °C über eine Dauer von 2 Minuten.

40 Zyklen:

 

95 °C über eine Dauer von 30 Sekunden

 

55 °C über eine Dauer von 30 Sekunden

 

72 °C über eine Dauer von 45 Sekunden

1 Zyklus:

72 °C über eine Dauer von 10 Minuten;

339 bp

CyHVpol-internal reverse

5′-GAGTTGGCGCAYACYTTCATC-3′

Die Ergebnisse der PCR können je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen, insbesondere könnte in Bezug auf die Temperaturprotokolle je nach verwendetem Thermozycler eine Optimierung erforderlich sein. Außerdem können aufgrund von falschem Primer-Annealing oder einer Kontamination des Labors falsch-positive Ergebnisse auftreten. Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Alternativ können andere PCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

Die Sequenzierung kann von dem Labor oder von externen, spezialisierten Sequenzierungs-Unternehmen durchgeführt werden. Die Ergebnisse der Sequenzierung sind zu analysieren, indem die Sequenzen mit den bekannten Referenzsequenzen der KHV (GenBank-Zugangsnummern AP008984, DQ657948 und DQ177346) abgeglichen werden. Die gewonnene bereinigte Konsensussequenz muss diesen Referenzsequenzen zu mindestens 98 % entsprechen.

TEIL 3

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG AUF DIE INFEKTIÖSE ANÄMIE DER LACHSE (ISA) UND ZU DEREN BESTÄTIGUNG

I.   Probenahmeverfahren für die Überwachung und Bekämpfung der ISA

Bei der Beprobung und Laboruntersuchung für die Zwecke der Überwachung oder von Tilgungsprogrammen gemäß Anhang I Teil 3, oder zur Bestätigung des Vorliegens der ISA oder zur Ausräumung eines Verdachts darauf gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG sind die unter den Nummern I.1, I.2 und I.3 ausgeführten detaillierten Methoden und Verfahren anzuwenden.

I.1.   Aufbereitung der Fischproben

Fischproben für die Zwecke der Laboruntersuchungen auf ISA sind möglichst nicht zu poolen. Für die Zwecke der Überwachung auf ISA dürfen jedoch zwei bis fünf Fische gepoolt werden.

Von allen beprobten Fischen sind Proben für die Analyse mittels Reverser Transkriptase-Polymerase-Kettenreaktion (RT-PCR) zu entnehmen. Mithilfe eines sterilen Instruments ist ein Teil der Rumpfniere zu entnehmen und in ein Microfuge-Röhrchen mit 1 ml RNA-Konservierungslösung von erwiesener Wirksamkeit zu überführen. In einem Röhrchen mit Transportlösung kann Gewebematerial von bis zu fünf Fischen zusammengeführt werden, das dann eine gepoolte Probe darstellt. Das Gewicht des Gewebes in einer Probe muss 0,5 g betragen. Sind die Fische zu klein, um eine Probe mit dem erforderlichen Gewicht zu entnehmen, so sind Teile von Niere, Herz, Milz, Leber oder Pylorusblindsäcken — in dieser Reihenfolge — zu entnehmen, bis 0,5 g erreicht sind.

Gewebe für histologische Untersuchungen sind ausschließlich von frisch getöteten Fischen normaler Verfassung zu entnehmen, die auf ISA hindeutende klinische Symptome oder postmortale Befunde aufweisen. Äußere oder innere Läsionen sind zu beproben, und auf jeden Fall sind den einzelnen Fischen mithilfe eines Skalpells Proben von Rumpfniere, Herz, Leber, Pankreas, Darm, Kiemen und Milz zu entnehmen und in 8-10 % (vol:vol) gepufferte Formalin-Kochsalzlösung zu überführen. Das Verhältnis des Fixierungsmittels zum Gewebe muss mindestens 20:1 betragen, damit eine ausreichende Erhaltung der Gewebe gewährleistet ist. Für die immunhistochemischen Untersuchungen sind Proben von Rumpfniere und Herz zu entnehmen.

Von allen beprobten Fischen ist Gewebematerial für virologische Untersuchungen in Zellkultur zu entnehmen. Mithilfe eines sterilen Instruments werden Teile von Leber, Kopf- oder Rumpfniere, Herz und Milz entfernt und in Kunststoffröhrchen mit 9 ml Transportmedium überführt. In einem Röhrchen mit Transportlösung kann Gewebematerial von bis zu fünf Fischen zusammengeführt werden, das dann eine gepoolte Probe darstellt. Das Gewicht des Gewebes in einer Probe muss 1,0 ± 0,5 g betragen.

I.2.   Versand von Fischproben

Fische können unzerteilt (ganz) zum Labor gesandt werden, sofern die in Absatz 3 festgelegten Temperaturanforderungen während des Transports erfüllt werden können. Ganzer Fisch muss mit Saugpapier umhüllt und wie in dem betreffenden Absatz beschrieben gekühlt in einem Kunststoffbeutel versandt werden.

Fische können auch lebend transportiert werden, jedoch nur unter der Aufsicht des nationalen Referenzlaboratoriums für Fischkrankheiten und unter Berücksichtigung der zusätzlichen Probleme in Bezug auf Desinfektion und Biosicherheit bei der Beförderung von lebendem Fisch.

Die Blutproben und Röhrchen mit Fischgewebe für die virologische Untersuchung oder für die RT-PCR-Analyse sollten in Isolationsbehälter, z. B. dickwandige Styroporkästen, gepackt werden, die genügend Eis oder Kühlelemente enthalten, um zu gewährleisten, dass die Proben beim Transport zum Labor gekühlt gehalten werden. Ein Anfrieren ist zu vermeiden, und bei der Ankunft der Sendung muss im Transportbehälter noch Eis vorhanden oder muss mindestens ein Kühlelement noch teilweise oder vollständig gefroren sein. In Ausnahmefällen können RT-PCR-Proben und Proben für die virologische Untersuchung schockgefroren und bei – 20 °C oder darunter zum Labor verbracht werden.

Für die RT-PCR-Analyse von Gewebe in Ribonukleinsäure(RNS)later muss die RNA-Extraktion je nach Lagertemperatur der Proben innerhalb folgender Zeiträume vorgenommen werden:

 

bei 37 °C gelagerte Proben: innerhalb eines Tages;

 

bei 25 °C gelagerte Proben: innerhalb einer Woche;

 

bei 4 °C gelagerte Proben: innerhalb eines Monats;

 

bei – 20 °C gelagerte Proben: unbefristet.

Wird Fischgewebe in Fixierungsmittel für histologische Untersuchungen transportiert, so ist es in auslaufsicheren Röhrchen in stoßfesten Behältern zu versenden. Das Einfrieren der Proben ist zu vermeiden.

Mit der virologischen Untersuchung auf Zellkultur ist baldmöglichst zu beginnen, spätestens jedoch 48 Stunden nach der Probenahme. In Ausnahmefällen kann die virologische Untersuchung innerhalb von 72 Stunden nach der Materialentnahme begonnen werden, sofern das Untersuchungsmaterial durch das Transportmedium geschützt war und die Temperaturanforderungen während des Transports erfüllt wurden.

I.3.   Entnahme von zusätzlichem Diagnosematerial

Mit Einverständnis des Diagnoselabors können andere Fischgewebe als die in Nummer I.1 genannten entnommen und für Zusatzuntersuchungen aufbereitet werden.

II.   Detaillierte Diagnosemethoden und -verfahren für die Überwachung auf ISA und für die Bestätigung des Vorliegens der ISA bzw. zur Ausräumung eines Verdachts darauf

Werden Laboruntersuchungen nach den in Anhang I Teil 3 Abschnitt II aufgeführten Diagnosemethoden zum Zweck der Erlangung oder Erhaltung eines bestimmten Gesundheitsstatus in Bezug auf ISA gemäß Anhang I Teil 3 Abschnitt I oder zum Zweck der Bestätigung des Vorliegens von ISA oder zur Ausräumung eines Verdachts darauf gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG durchgeführt, so sind die im Folgenden unter den Nummern II.1 bis II.5 aufgeführten detaillierten Methoden und -verfahren anzuwenden:

II.1.   Untersuchung von Proben mittels RT-PCR

Die Diagnosemethode für das Screening auf ISA ist die RT-qPCR. Da die Ergebnisse der RT-qPCR je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen können, sind geeignete Positiv- und Negativkontrollen und Amplikons einzubeziehen, um jeglichen Zweifel zu vermeiden.

II.1.1.   Gesamt-RNA-Extraktion

Alle Arbeiten mit RNA werden auf Eis und unter Verwendung von Handschuhen durchgeführt.

Die Gesamt-RNA ist mithilfe der Phenol-Chloroform-Methode oder durch RNA-Affinitäts-Spinsäulen entsprechend den Anweisungen des Herstellers zu extrahieren.

Die gereinigte RNA wird in destilliertem, RNAse-freiem Wasser (nämlich mit 0,1 % Diethylpyrocarbonat behandeltem Wasser) erneut suspendiert.

Konzentration und Reinheit der extrahierten RNA sind mittels Messung der optischen Dichte bei 260 nm und bei 280 nm. Alternativ könnten interne Kontrollen gemäß Nummer II.1.3 einbezogen werden, die speziell auf das Virusgenom abzielen.

II.1.2.   Nachweis von ISAV mittels RT-PCR

Für die Amplifikation des ISAV-Genoms können mehrere RT-PCR-Methoden verwendet werden. Es kann eine zweistufige RT-PCR durchgeführt werden, bei der die RT- und die PCR-Reaktion in zwei getrennten Röhrchen durchgeführt werden. Es kann jedoch auch eine einstufige Reaktion verwendet werden, bei der die beiden Reaktionen in einem Röhrchen durchgeführt werden. Es ist möglichst das einstufige Verfahren anzuwenden, da der Assay in einem einzigen Röhrchen die Gefahr der Kreuzkontamination minimiert, weil der Inhalt nicht zu transferieren ist, und dieses Verfahren als ebenso sensitiv gilt wie die zweistufige Methode.

Es sind die in dieser Nummer beschriebenen Primer und Assays zu verwenden, nämlich das ILA1- bzw. ILA2-Primerpaar, die auf das Segment 8 abzielen und als für den Nachweis des ISAV bei Ausbrüchen und bei Trägerfischen geeignet befunden wurden. Der ILA-2-Rückwärtsprimer entspricht nicht den Isolaten aus Nordamerika; daher sollte in diesen Fällen ein alternativer Primersatz verwendet werden.

 

Vorwärtsprimer (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′;

 

Rückwärtsprimer (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.

Zyklusbedingungen: 1 Zyklus bei 50 °C über eine Dauer von 30 Minuten, 1 Zyklus bei 94 °C über eine Dauer von 15 Minuten, 40 Zyklen bei 94 °C über eine Dauer von 30 Sekunden, bei 55 °C über eine Dauer von 30 Sekunden, bei 72 °C über eine Dauer von 60 Sekunden; 1 Zyklus bei 72 °C über eine Dauer von 5 Minuten. Produktgröße 155 bp.

Die Ergebnisse der PCR können je nach den Bedingungen, unter denen sie durchgeführt wird, unterschiedlich ausfallen, insbesondere könnte in Bezug auf die Temperaturprotokolle je nach verwendetem Thermozycler eine Optimierung erforderlich sein. Außerdem können aufgrund von falschem Primer-Annealing oder einer Kontamination des Labors falsch-positive Ergebnisse auftreten. Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Alternativ können andere RT-PCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

II.1.3.   Nachweis von ISAV mittels qPCR

Durch die Verwendung von RT-qPCR könnten eine höhere Empfindlichkeit und Spezifität erreicht werden. Die Methode kann schneller durchgeführt werden, da keine Gelelektrophorese erforderlich ist, und sie verringert die Gefahr der Kreuzkontamination, da es möglich ist, die Menge der genomischen viralen RNA im Probenröhrchen zu schätzen. Ein Nachteil des RT-qPCR-Assays ist, dass es oftmals nicht möglich ist, amplifizierte Produkte zu sequenzieren. Bestehen jedoch Zweifel in Bezug auf die Spezifität des amplifizierten Produkts, ist ein weiterer ISAV-spezifischer Assay durchzuführen, um das Ergebnis zu überprüfen.

Es ist der im Folgenden beschriebene Assay zu verwenden, der auf das Segment 8 abzielt. Dieser Assay muss Isolate aus der Europäischen Union, der Europäischen Freihandelsassoziation und Nordamerika abdecken. Es ist möglichst das einstufige Verfahren anzuwenden, da der Assay in einem einzigen Röhrchen die Gefahr der Kreuzkontamination minimiert.

 

Vorwärtsprimer: 5′- CTACACAGCAGGATGCAGATGT -3′;

 

Rückwärtsprimer: 5′- CAGGATGCCGGAAGTCGAT -3′;

 

Sonde: 5′-FAM- CATCGTCGCTGCAGTTC — MGBNFQ-3′.

Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Zyklusbedingungen: 1 Zyklus bei 50 °C über eine Dauer von 30 Minuten, 1 Zyklus bei 95 °C über eine Dauer von 15 Minuten, 40 Zyklen bei 94 °C über eine Dauer von 15 Sekunden, bei 60 °C über eine Dauer von 60 Sekunden; erforderlichenfalls sind Anpassungen vorzunehmen. Alternativ können andere RT-PCR oder RT-qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

II.1.4.   Sequenzierung amplifizierter PCR-Produkte

 

Vorwärtsprimer (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA -3′;

 

Rückwärtsprimer (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA -3′.

Jeder Plattenlauf muss Negativkontrollen und Positivkontrollen beinhalten. Zyklusbedingungen (einstufige RT-PCR): 1 Zyklus bei 50 °C über eine Dauer von 30 Minuten, 1 Zyklus bei 94 °C über eine Dauer von 15 Minuten, 40 Zyklen bei 94 °C über eine Dauer von 30 Sekunden, bei 55 °C über eine Dauer von 30 Sekunden, bei 72 °C über eine Dauer von 60 Sekunden, 1 Zyklus bei 72 °C über eine Dauer von 5 Minuten; erforderlichenfalls sind Anpassungen vorzunehmen. Alternativ können andere RT-PCR oder RT-qPCR-Versionen mit erwiesenermaßen ähnlicher Wirksamkeit verwendet werden.

Alternativ kann folgende Methode zur HPR-Sequenzierung in Segment 6 verwendet werden:

 

Vorwärtsprimer: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′;

 

Rückwärtsprimer: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′;

 

Produktgröße: 304 nt wenn HPR0.

Es können auch andere RT-PCR-Assays verwendet werden, die eine ähnliche Sensitivität und ähnliche Spezifitäten wie die hier beschriebenen Assays aufweisen.

Vor der Sequenzierung muss die Reinheit des amplifizierten RT-PCR-Produkts mittels Gelelektrophorese überprüft werden. Wenn nur ein reines Fragment erscheint, so ist dies direkt aus der PCR-Reaktion zu reinigen. Sind mehrere amplifizierte Fragmente vorhanden, so ist das interessierende Fragment mittels Gelelektrophorese zu reinigen. Die Reinigung des PCR-Fragments aus Lösungen oder Agarose-Gelen erfolgt mittels PCR-Fragment-Affinitäts-Spinsäulen entsprechend den Anweisungen des Herstellers.

Die Sequenzierung ist unter Verwendung von Amplifizierungs-Primern von externen, spezialisierten Sequenzierungs-Unternehmen durchzuführen. Die Ergebnisse sind mit der Suchfunktion BLAST zu analysieren und die Sequenzen mit anderen bekannten Sequenzen in der Nukleotid-Datenbank des US National Centre for Biotechnical Information (NCBI) zu vergleichen.

Die Sequenzierung muss jeglichen Zweifel bezüglich der Spezifität eines amplifizierten RT-PCR-Produkts beseitigen.

II.2.   ISAV-Isolierung in Zellkulturen

II.2.1.   Vorbereitung der Proben

Das Gewebe kann bei – 80 °C aufbewahrt werden, darf jedoch vor der Untersuchung nur einmal eingefroren und aufgetaut werden. Untersuchungen für Überwachungs- und Bekämpfungszwecke sind so schnell wie möglich durchzuführen.

Jede Probe (Gewebepool in Transportlösung) wird mit einem validierten Homogenisator vollständig homogenisiert und 15 Minuten bei 2 000 bis 4 000 × g und 0-6 °C zentrifugiert. Der Überstand wird durch ein 0,45-μm-Filter filtriert und mit dem gleichen Volumen eines angemessen verdünnten Pools von Antiseren gegen die einheimischen IPNV-Serotypen inkubiert. Bei einem 50 %igen Plaquetest muss der Antiserumtiter mindestens 1:2 000 betragen. Die Mischung wird eine Stunde bei 15 °C inkubiert. Dies ist das Inokulum.

Die Behandlung aller Inokula mit IPNV-Antiserum (in einigen Teilen Europas sind 50 % der Fischproben mit dem IPN-Virus kontaminiert) dient der Vorbeugung gegen einen IPNV-induzierten zytopathischen Effekt (CPE) bei beimpften Zellkulturen. Eine solche Behandlung kann vorgenommen werden, um die Dauer der virologischen Untersuchungen und der Zahl der Fälle zu reduzieren, bei denen ein zytopathischer Effekt als Indiz für ISAV gewertet werden müsste. Stammen die Proben aus Produktionseinheiten, die als IPN-frei gelten, so kann auf die Behandlung der Inokula mit IPNV-Antiserum verzichtet werden.

II.2.2.   Beimpfen von Zellkulturen

Zur ISAV-Isolierung sind in erster Linie Nierenzellen vom Atlantischen Lachs zu verwenden. Es können auch andere Zelllinien von erwiesener Wirksamkeit und Empfindlichkeit für die Isolierung von ISAV verwendet werden, wobei Stammvariabilität und die Fähigkeit verschiedener Stämme, sich in unterschiedlichen Zelllinien zu vermehren, zu berücksichtigen sind. Die Nierenzellen von Atlantischem Lachs eignen sich offenbar für die Isolierung und das Wachstum bislang bekannter Virusisolate, sofern eine niedrige Passagenzahl verwendet wird. Bei Nierenzellen von Atlantischem Lachs kann ein deutlicherer zytopathischer Effekt (CPE) auftreten als bei anderen empfänglichen Zelllinien wie SHK-1 (Salmon head kidney-1).

Nierenzellen vom Atlantischen Lachs (Passage 65 oder niedriger) werden in L-15-Medium mit 10 % Rinderfötenserum, 2 % (vol:vol) 200 mM L-Glutamin und 0,08 % (vol:vol) 50 mM 2-Mercaptoethanol in Multiwellplatten kultiviert. Die antiserumbehandelte Organsuspension ist so auf junge, aktiv wachsende Zellkulturen zu impfen, dass sich eine Endverdünnung des Gewebematerials im Kulturmedium von 1:1 000 ergibt. Für jede Organsuspension werden 40 μl Inokulum in ein Well mit 2 ml Kulturmedium gegeben. Um einer Kreuzkontamination vorzubeugen, sind für Proben von unterschiedlichen Betrieben getrennte 12er- oder 24er-Mikrotiterplatten zu verwenden.

Eine Platte, die als negative Kontrolle dienen soll, wird nicht beimpft. Eine getrennte Platte wird wie nachstehend beschrieben als positive Kontrolle mit einem Referenzisolat von ISAV beimpft. 100 μl einer Stammzubereitung von ISAV (Mindesttiter 107 Gewebekultur Infektionsdosis 50 (TCID50 ml– 1) werden in das erste Well geimpft und vermischt. Ein Volumen dieses Materials wird vom ersten in das zweite Well überführt, sodass eine 1:10-Verdünnung entsteht, und vermischt. Dies wird über die gesamte Platte wiederholt, sodass sich sechs 10fache Verdünnungen ergeben. Stamm-ISAV kann bei – 80 °C mindestens zwei Jahre gelagert werden, muss aber nach dem Auftauen innerhalb von drei Tagen verwendet werden. Es ist darauf zu achten, dass es nicht zu Kreuzkontamination der Testplatten durch positives Kontrollmaterial kommt. Diesem Risiko ist vorzubeugen, indem positive Kontrollen getrennt von den Testplatten bearbeitet werden. Statt der Einbeziehung einer Positivkontrolle bei jeder Beimpfung kann auch alle sechs Monate ein Test auf Sensitivität von Nierenzellen von Atlantischem Lachs gegenüber ISAV-Isolaten durchgeführt werden.

Die Proben werden bis zu 15 Tage bei 15 ± 2 °C inkubiert. Die Zellkulturen werden zweimal (5-7 Tage und 12-14 Tage nach dem Beimpfen) unter dem Mikroskop auf das Auftreten eines CPE überprüft. Sollte ein Pool CPE aufweisen, so ist sofort ein Virusnachweisverfahren gemäß Nummer II.2.4 einzuleiten. Wird bis Tag 14 kein CPE festgestellt, so ist ein indirekter Immunofluoreszenztest (IFAT), ein Hämadsorptionstest oder eine RT-PCR durchzuführen.

II.2.3.   Subkultivierung

Subkulturen sind zwischen Tag 13 und Tag 15 anzulegen. Der Kulturüberstand wird in die Wells überführt, die frische, aktiv wachsende Zellen in geeigneter Verdünnung (1/10) in Multiwellplatten enthalten, und bis zu 18 Tage bei 14 ± 2 °C inkubiert. Die Zellkulturen werden zweimal (5-7 Tage und 14-18 Tage nach dem Beimpfen) mikroskopisch auf das Auftreten eines CPE überprüft. Sollte ein Pool CPE aufweisen, so ist sofort ein Virusnachweisverfahren gemäß Nummer II.2.4 einzuleiten. Wird bis Tag 14-18 kein CPE festgestellt, so ist ein Hämadsorptionstest oder eine RT-PCR durchzuführen.

Kommt es innerhalb der ersten sieben Tage der Inkubation zu Zytotoxizität, so ist in dieser Phase eine Subkultur anzulegen; die Zellen müssen 14-18 Tage inkubiert werden, und es ist eine weitere Subkultur anzulegen, die nochmals 14-18 Tage zu inkubieren ist. Tritt die Zytotoxizität nach sieben Tagen auf, so ist eine Subkultur anzulegen, und die Zellen sind so zu inkubieren, dass eine Gesamtinkubationszeit von 28-36 Tagen ab der Erstbeimpfung erzielt wird.

Kommt es in der Primärkultur zu Bakterienkontamination, so ist der Test unter Verwendung des bei – 80 °C gelagerten Gewebehomogenats neu anzusetzen. Vor der Beimpfung ist das Gewebehomogenat 15 bis 30 Minuten bei 4 000 × g und 0-6 °C zu zentrifugieren und der Überstand durch ein 0,22-μm-Filter zu filtrieren. Kommt es in der Phase der Subkultur zu Bakterienkontamination, so ist der Überstand durch ein 0,22-μm-Filter zu filtrieren, auf frische Zellen zu impfen und weitere 14-18 Tage zu inkubieren.

II.2.4.   Virusnachweistests

Wird in einer beliebigen Phase ein CPE beobachtet oder ergibt der Hämadsorptionstest einen Positivbefund, so ist ein Virusnachweisverfahren vorzunehmen. Die Methoden der Wahl für den ISAV-Nachweis sind RT-PCR gemäß Nummer II.1. und Immunfluoreszenz (IF) gemäß Nummer II.2.6. Wird vermutet, dass andere Viren vorhanden sind, so sind zusätzliche Virusnachweistests durchzuführen. Haben diese Tests innerhalb einer Woche keinen eindeutigen Virusnachweis erbracht, so ist der Überstand zum sofortigen Nachweis weiterzuleiten an

a)

das Referenzlabor für ISA der Weltorganisation für Tiergesundheit (OIE) oder

b)

ein nationales Referenzlabor oder das EU-Referenzlaboratorium für Fischkrankheiten gemäß Anhang VI der Richtlinie 2006/88/EG.

II.2.5.   Hämadsorption

Da die Replikation von ISAV in Zellkulturen nicht immer zu einem CPE führt, ist jedes Well einem RT-PCR-Test oder einem Hämadsorptionstest gemäß diesem Absatz oder dem IF-Test gemäß Nummer II.2.6 zu unterziehen.

Aus jedem Well, auch denen mit den positiven und negativen Kontrollen, wird Zellkulturmedium entnommen, das in etikettierte sterile Röhrchen überführt wird. Jedem Well werden 500 μl einer 0,2 % (vol:vol) Suspension gewaschener Erythrozyten vom Kaninchen oder Pferd oder eine 0,05 % (vol:vol) Suspension gewaschener Erythrozyten von der Regenbogenforelle oder vom Atlantischen Lachs hinzugefügt, und es wird 45 Minuten bei Zimmertemperatur inkubiert. Die Erythrozyten werden entnommen, und jedes Well wird zweimal mit L-15-Medium gewaschen. Die einzelnen Wells werden unter dem Mikroskop untersucht.

An der Oberfläche von Nierenzellen von Atlantischem Lachs anhaftende Cluster von Erythrozyten sind ein Indiz für eine Infektion mit einem Orthomyxovirus. Bei einem positiven Hämadsorptionstest ist sofort ein Virusnachweistest gemäß Nummer II.2.4 vorzunehmen.

II.2.6.   Immunfluoreszenz (IF)

Nierenzellen von Atlantischem Lachs (Passage 65 oder niedriger) müssen in L-15-Medium mit 10 % Rinderfötenserum, 2 % (vol:vol) 200 mM L-Glutamin und 0,08 % (vol:vol) 50 mM 2-Mercaptoethanol in Multiwellplatten kultiviert und verwendet werden, wenn mehr als 50 % Konfluenz erreicht ist. Andere Zelllinien oder Medien mit erwiesener Wirksamkeit können ebenfalls verwendet werden. Je 225 μl des mutmaßlich virusinfizierten Kulturüberstands sind in zwei Wells zu überführen und zu mischen; 225 μl sind in zwei weitere Wells zu überführen (1:5-Verdünnung). Zwei zusätzliche Wells bleiben als Kontrollen unbeimpft. Proben von jedem Fischbetrieb werden auf getrennten Platten untersucht, ebenso die Viruskontrolle. Für die Viruskontrolle wird ein Referenzisolat von ISAV verwendet.

Die Platten werden bei 14 ± 2 °C inkubiert und bis zu sieben Tage mikroskopisch untersucht. Wenn ein früher CPE beobachtet wird oder wenn innerhalb von sieben Tagen kein CPE beobachtet wird, ist der nächste Schritt die Fixierung. Hierzu werden die Wells mit phosphatgepufferter Kochsalzlösung (PBS) gewaschen und durch 20-minütige Inkubation bei Zimmertemperatur mit 80 % Aceton fixiert. Die Platten werden luftgetrocknet und entweder unmittelbar angefärbt oder vor dem Anfärben höchstens 24 Stunden bei 0-6 °C gelagert.

Die Replikatwells werden mit der in PBS verdünnten Mischung aus den monoklonalen ISAV-Antikörpern (MAK) 3H6F8 und 1OC9F5 oder mit anderen MAK, deren Wirksamkeit und Spezifität nachgewiesen wurde, angefärbt und 30 Minuten bei 37 ± 4 °C inkubiert. Die MAK sind abzusaugen und die Platten dreimal mit 0,05 % Tween 20 in PBS zu waschen. Jedem Well wird in PBS verdünntes Anti-Maus-IgG-Fluorescein-Isothiocyanat (FITC)-Konjugat zugegeben und 30 Minuten bei 37 ± 4 °C inkubiert. Die Verdünnungen verschiedener Chargen von MAK und FITC-Konjugat sind in jedem Labor zu optimieren. Die Antikörper sind abzusaugen und die Platten dreimal mit 0,05 % Tween 20 in PBS zu waschen.

Die Wells sind unverzüglich mithilfe eines für Fluoreszenzmikroskopie eingerichteten Inversmikroskops mit einem geeigneten Filter für FITC-Anregung zu untersuchen. Ein Test gilt als positiv, wenn fluoreszierende Zellen beobachtet werden. Ein Test ist nur dann gültig, wenn die positiven Kontrollen einen Positivbefund und die negativen Kontrollen einen Negativbefund ergeben.

II.3.   Untersuchungen anderer Gewebe

Die Technik gemäß Nummer II.2.6 kann auf andere Fischgewebe wie Leber, Milz und Herz angewandt werden, vorausgesetzt, dass eine angemessene Zahl Endothelzellen, Leukozyten oder Lymphozyten auf den Objektträger aufgebracht werden kann. Das Anfärbeverfahren ist für jedes Gewebe gleich, doch bei einigen Geweben kann es ratsam sein, auf die Propidiumjodid-Färbung zu verzichten und sich bei der Identifizierung der Zelltypen in den Abdrücken stattdessen auf die Phasenkontrastbeleuchtung zu stützen.

II.4.   Histologie:

Die in Paraffin eingebetteten Schnitte werden in 5 μm dicke Stücke geschnitten und mit Hämatoxylin und Eosin angefärbt.

Histologische Veränderungen bei klinisch erkranktem Atlantischen Lachs sind variabel, können jedoch Folgendes umfassen:

a)

zahlreiche Erythrozyten im zentralen venösen Sinus und in den Lamellenkapillaren der Kiemen, wo sich auch Erythrozytenthromben bilden können;

b)

multifokale bis konfluente Petechien und/oder Hepatozytennekrose in einiger Entfernung der größeren Lebergefäße; multifokale Erythrozyten-Akkumulation in erweiterten hepatischen Sinusoiden;

c)

Erythrozyten-Akkumulation in Blutgefäßen der intestinalen Lamina propria und möglicherweise Blutungen in die Lamina propria.

d)

durch Erythrozyten-Akkumulation aufgeblähtes Milzstroma;

e)

leichte multifokale bis starke intestinale Blutungen mit Tubulopathie in den Blutungsbereichen und Erythrozyten-Akkumulation in den Nierenglomeruli;

f)

Erythrophagozytose in der Milz und sekundäre Blutungen in Leber und Niere.

II.5.   Immunhistochemie (IHC)

Polyklonale Antikörper gegen das ISAV-Nukleoprotein werden auf Paraffinschnitten von Formalin-fixiertem Gewebe verwendet. Die zu untersuchenden Organe sind die Rumpfniere und das Herz (Übergangsbereich einschließlich der drei Kammern und Klappen). Fälle, in denen aufgrund pathologischer Anzeichen ein Verdacht besteht, sind mit einem positiven IHC-Ergebnis zu bestätigen. Die histologischen Schnitte sind nach den Standardmethoden anzufertigen.

(1)

Vorbereitung der Gewebeschnitte

Die Gewebe sind gemäß den Standardprotokollen für mindestens einen Tag in 10 %igem neutral phosphatgepufferten Formalin zu fixieren, in einer aufsteigenden Ethanolreihe zu entwässern, mit Xylol zu klären und in Paraffin einzubetten. Ca. 5 μm dicke Schnitte (bei IHC auf Poly-L-Lysin-beschichteten Objektträgern) sind für 20 Minuten bei 56-58 °C (maximal 60 °C) zu erwärmen, in Xylol zu entwachsen, mit einer absteigenden Ethanolreihe zu rehydrieren und für die Zwecke der Pathomorphologie mit Hämatoxylin und Eosin und für die Zwecke der IHC gemäß Nummer 2 einzufärben.

(2)

Färbeverfahren für IHC

Die Inkubation findet, soweit in diesem Beschluss nicht anders verfügt, immer bei Raumtemperatur und auf Wippmischern statt.

a)

Die Antigendemaskierung erfolgt durch Kochen der Schnitte für 2 × 6 Minuten in 0,1 M Citratpufferlösung (pH-Wert 6,0) gefolgt von 20-minütiger Blockierung mit 5 % fettarmer Trockenmilch und 2 % Ziegenserum in 50 mM TBS (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH-Wert 7,6);

b)

die Schnitte werden dann über Nacht mit in TBS mit 1 % fettarmer Trockenmilch verdünntem Primärantikörper (monospezifischer Kaninchen-Antikörper gegen ISAV-Nukleoprotein) inkubiert und anschließend dreimal in TBS mit 0,1 % Tween 20 gewaschen;

c)

für den Nachweis gebundener Antikörper sind die Schnitte mit Alkaline-Phosphatase-konjugiertem Kaninchen-IgG-Antikörper für 60 Minuten zu inkubieren. Nach einer letzten Waschung sind Echtrot (1 mg ml– 1) und Naphtol-AS-MX Phosphat (0,2 mg ml– 1) mit 1 mM Levamisol 0,1 M TBS (pH-Wert 8,2) hinzuzufügen; danach 20 Minuten entwickeln lassen. Die Schnitte werden dann in Leitungswasser gewaschen; danach erfolgt eine Gegenfärbung mit Harris-Hämatoxylin und die Schnitte werden mit einem wässrigen Medium eingedeckelt. ISAV-positive und ISAV-negative Gewebeschnitte sind als Kontrollen in jeden Aufbau einzuschließen.

(3)

Interpretation des Ergebnisses der IHC

Die Interpretation des Ergebnisses des IHC-Tests erfolgt gemäß den Buchstaben a und b:

a)

Kontrollschnitte gelten als positiv, wenn beobachtet wird, dass die Endothelzellen in Blutgefäßen des Endokards in den Kontrollschnitten eine deutlich sichtbare rote Färbung von Cytoplasma und Nukleus aufweisen. Ein Testprobenschnitt gilt nur dann als positiv, wenn eine solche deutliche, intranukleäre Rotfärbung der Endothelzellen vorliegt.

b)

Kontrollschnitte gelten als negativ, wenn sie keine signifikante Farbreaktionen aufweisen.

Da die intranukleäre Lokalisation charakteristisch für das Orthomyxovirus-Nukleoprotein während der Phase der Virusreplikation, eine gleichzeitige cytoplasmatische Färbung jedoch oft dominant ist, gelten cytoplasmatische oder andere Färbungsmuster ohne intranukleäre Lokalisation als unspezifisch oder nicht schlüssig.

Die stärksten positiven Färbungsreaktionen werden normalerweise in den Endothelzellen von Herz und Niere erreicht. Bei sehr umfangreichen hämorrhagischen Läsionen können die Endothel-Färbungsreaktionen geringfügig oder nicht vorhanden sein, möglicherweise aufgrund der Lyse der Endothel-Zellen.

TEIL 4

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG UND BESTÄTIGUNG VON MARTEILIA-REFRINGENS-INFEKTIONEN

I.   Detaillierte Diagnosemethoden und -verfahren für die Diagnose von Marteilia-refringens-Infektionen

Werden Laboruntersuchungen nach den in Anhang I Teil 4 Abschnitt II aufgeführten Diagnosemethoden zum Zweck der Erlangung oder Erhaltung eines bestimmten Gesundheitsstatus in Bezug auf Marteilia-refringens-Infektionen gemäß Anhang I Teil 4 Abschnitt I oder zum Zweck der Bestätigung bzw. des Ausschlusses des Vorliegens dieser aufgelisteten Krankheit gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG durchgeführt, so sind die unter den Nummern I.1, I.2 und I.3 aufgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden.

I.1.   Probenahmeverfahren

Es sind in erster Linie geöffnete oder soeben verendete einzelne Weichtiere zu beproben, da dies die Chancen auf die Entdeckung infizierter Tiere erhöht.

Nach der Beprobung dürfen Austern oder Muscheln in einem Kunststoffbeutel, der ein Etikett mit den Einzelheiten zu Art und Ursprung der Austern oder Muscheln trägt, bei 4 °C oder auf gekühltem Eis für höchstens 24 Stunden aufbewahrt werden, wenn die Probe geöffnete Weichtiere enthält, und für höchstens 72 Stunden, wenn dies nicht der Fall ist. Geöffnete oder soeben verendete Weichtiere sind getrennt von anderen Weichtieren aufzubewahren.

Für die Diagnose von Marteilia refringens mittels Histologie ist ein 3 bis 5 mm dicker Gewebeschnitt (einschließlich Kiemen und Herzgewebe) zu verwenden. Für einige Tests, wie Abdrücke und Polymerase-Kettenreaktion (PCR), ist ein Teil der Verdauungsdrüse zu verwenden.

I.2.   Mikroskopische Techniken

I.2.1.   Zytologie (Abdruck-Zytologie)

Nach der Trocknung der Verdauungsdrüse auf Saugpapier sind mehrere Abdrücke auf einem Glasobjektträger anzufertigen. Die Objektträger werden luftgetrocknet, in Methanol oder reinem Ethanol fixiert und mithilfe eines im Handel erhältlichen Blutfärbekits, wie Diff-Quik®/hemacolor®, entsprechend den Anweisungen des Herstellers eingefärbt. Nach dem Abspülen mit Leitungswasser und der Trocknung werden die Objektträger mit einem Deckglas eingedeckt; dabei ist ein geeignetes Kunstharz zu verwenden. Die Objektträger werden zunächst bei 200facher Vergrößerung und dann unter Ölimmersion bei 1 000facher Vergrößerung betrachtet.

Die Beobachtung von Zellen mit einer Größe von 30-40 μm gilt als positives Ergebnis. Das Cytoplasma färbt sich basophil, während der Nukleus sich eosinophil färbt. Es sind blasse Höfe um große, stark gefärbte (lichtbrechende) Granula und — bei größeren Zellen — Zellen innerhalb von Zellanordnungen zu beobachten.

Diese Technik ist nicht spezifisch für einzelne Parasitenarten.

I.2.2.   Histologie:

Schnitte von Gewebe, darunter Kiemen, Verdauungsdrüse, Mantel, und Gonade, sind für mindestens 24 Stunden in Davidson-Lösung zu fixieren und anschließend normal für die Paraffinhistologie und Färbung, beispielsweise mit Hämatoxylin und Eosin, weiterzuverarbeiten. Beobachtungen werden bei bis zu 1 000fachen Vergrößerungen vorgenommen.

Die Beobachtung von Zellen mit einer Größe von 4-40 μm gilt als positives Ergebnis. Im Anfangsstadium sind mehrkernige, kugelförmige bis längliche Zellen zu beobachten. Sie sind hauptsächlich im Epithel des Oesophagus und des Magens sowie mitunter in den Labialpalpen zu finden. Bei der Sporulation kommt es in den Kanälen und Gängen der Verdauungsdrüse zur Teilung von Zellen innerhalb von Zellen. Im Laufe der Sporulation entstehen lichtbrechende Granula, diese sind aber in den Anfangsstadien nicht zu beobachten. In späten Stadien der Infektion sind im Lumen des Verdauungstrakts freie Sporangien zu beobachten. Das Cytoplasma färbt sich basophil, während der Nukleus sich eosinophil färbt. Die Färbung der Granula kann von tieforange bis tiefrot reichen.

Diese Technik ist nicht spezifisch für einzelne Parasitenarten.

I.3.   Molekulare Techniken

I.3.1.   DNA-Extraktion

DNA wird nach den Standardverfahren extrahiert.

Es dürfen im Handel erhältliche DNA-Extraktionskits verwendet werden, die üblicherweise hochwertige DNA ergeben und zur Verwendung mit den in Nummer I.3.2 aufgeführten PCR-Protokollen geeignet sind.

I.3.2.   Polymerase-Kettenreaktion(PCR)

Es wurden mehrere PCR-Protokolle entwickelt und veröffentlicht.

Es sind PCR-Primer zu verwenden, die auf das interne transkribierte Zwischenstück (ITS1-Region) abzielen, da diese in der Lage sind, nur M. refringens zu amplifizieren.

Die PCR ist an einer Menge von 50 μl durchzuführen. PCR-Mischungen müssen einen Puffer (500 mM KCl, 100 mM Tris/HCl [pH-Wert 9,0 bei 25 °C] und 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP-Mischung, 1 μM Vorwärts- und Rückwärtsprimer, 0,02 Einheiten μl– 1 Taq DNA-Polymerase und 10-100 ng extrahierte DNA enthalten. Nach der Denaturierung der DNA bei 94 °C über einen Zeitraum von fünf Minuten werden 30 Zyklen wie folgt durchgeführt: Denaturierung bei 94 °C über einen Zeitraum von einer Minute, Annealing bei 55 °C über einen Zeitraum von einer Minute und Verlängerung bei 72 °C über einen Zeitraum von einer Minute pro Kilo-Basenpaar. Es muss ein abschließender Verlängerungsschritt bei 72 °C über einen Zeitraum von 10 Minuten erfolgen. Der Nachweis von M. refringens erfolgt mittels PCR mit Primern, die auf die ITS1-Region (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ und 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′) abzielen.

Positivkontrollen müssen aus genomischer DNA eines hochinfizierten Wirtes oder aus Plasmid-DNA einschließlich der Zielregion bestehen.

Negativkontrollen müssen aus genomischer DNA von nicht infizierten Wirten und PCR-Reaktiven ohne Ziel-DNA bestehen.

Als positives Ergebnis gilt eine positive PCR-Amplifikation bei der erwarteten Größe (412 bp), wobei alle Negativkontrollen negativ und alle Positivkontrollen positiv sein müssen.

I.3.3.   In-situ Hybridisierung (ISH)

Es wurden mehrere PCR-Protokolle entwickelt und veröffentlicht.

Es ist eine Sonde zu verwenden, die auf die SSU des rRNA-Genkomplexes abzielt, weil diese auf Übereinstimmung mit der Histologie überprüft wurde.

Schnitte von Gewebe, darunter Kiemen und Verdauungsdrüse, sind für mindestens 24 Stunden in Davidson-Lösung zu fixieren und anschließend normal für die Paraffinhistologie weiterzuverarbeiten. Es sind Schnitte von 5 μm herzustellen und auf Aminoalkylsilan-beschichtete Objektträger aufzuziehen, die dann über Nacht im Ofen bei 40 °C zu backen sind. Die Schnitte werden durch ein 10-minütiges Eintauchen in Xylol entwachst. Dieser Schritt ist zu wiederholen; das Lösungsmittel wird durch Eintauchen in zwei aufeinanderfolgende Bäder mit reinem Ethanol für jeweils 10 Minuten entfernt. Die Schnitte sind dann durch Eintauchen in eine aufsteigende Ethanolreihe zu entwässern. Die Schnitte werden bei 37 °C über einen Zeitraum von 30 Minuten mit Proteinase K (100 μg ml– 1) in TE-Puffer (Tris [50 mM], EDTA [10 mM]) behandelt. Die Objektträger werden durch Eintauchen in eine aufsteigende Ethanolreihe entwässert und anschließend luftgetrocknet. Die Schnitte werden mit 100 μl Hybridisierungspuffer (4 × SSC [Standard-Salz-Citrat], 50 % Formamid, 1 × Denhardt-Lösung, 250 μg ml– 1 Hefe-tRNA, 10 % Dextransulfat) inkubiert, der 10 ng (1 μl des gemäß Nummer I.3.2 unter Verwendung der Primer CCG-GTG-CCA-GGT-ATA-TCT-CG und TTC-GGG-TGG-TCT-TGA-AAG-GC zubereiteten PCR-Reaktants) der Digoxigenin-markierten Sonde enthält. Die Schnitte werden mit In-situ-Kunststoffdeckgläsern abgedeckt und bei 95 °C für fünf Minuten auf einem Thermoblock gekocht. Die Objektträger werden auf Eis abgekühlt und dann über Nacht bei 42 °C in einer feuchten Kammer hybridisiert. Die Schnitte werden zweimal jeweils fünf Minuten lang bei Raumtemperatur in 2 × SSC und einmal zehn Minuten lang bei 42 °C in 0,4 × SSC gewaschen. Die Nachweisschritte sind entsprechend den Anweisungen des Herstellers durchzuführen. Die Objektträger werden dann in sterilem destilliertem Wasser (dH2O) gespült. Die Schnitte werden mit Bismarckbraun Y gegengefärbt, in dH2O gespült und unter Verwendung eines wässrigen Mediums mit Deckgläsern abgedeckt.

Positiv- und Negativkontrollen sind Schnitte von bekanntermaßen infizierten bzw. nicht infizierten Wirten.

Ein positives Ergebnis wird durch die lila-schwarze Kennzeichnung von M. refringens-Zellen in bekannten Zielgeweben nachgewiesen, wobei alle Negativkontrollen negativ und alle Positivkontrollen positiv sein müssen.

I.3.4.   Sequenzierung

Die Sequenzierung wird als einer der letzten Schritte bei der Diagnosebestätigung durchgeführt. Zielregionen sind SSU rDNA und ITS1.

II.   Detaillierte Diagnosemethoden und -verfahren für die Überwachung und Bestätigung von Marteilia-refringens-Infektionen

Die für die Zwecke von Überwachungsprogrammen und zur Bestätigung des Vorliegens von Marteilia-refringens-Infektionen oder zur Ausräumung eines Verdachts auf diese aufgelistete Krankheit gemäß den Anforderungen in Anhang I Teil 4 Abschnitt II zu verwendenden Diagnosemethoden und entsprechenden Verfahren müssen den in der folgenden Tabelle 4.1 festgelegten Leitlinien entsprechen:

Tabelle 4.1

Leitlinien für die Verwendung von Diagnosemethoden für Überwachungsprogramme und zur Bestätigung oder zum Ausschluss des Vorliegens von Marteilia-refringens-Infektionen

Methode

Gezielte Überwachung

Vorläufige Diagnose

Bestätigende Diagnose

Abdrücke Verdauungsdrüse

X

X

X oder

Histopathologie

X

 

X oder

In-situ-Hybridisierung

 

 

X und

PCR

X

X

X und

Sequenzierung

 

 

X

TEIL 5

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG UND BESTÄTIGUNG VON BONAMIA-OSTREAE-INFEKTIONEN

I.   Verfahren für die Diagnose von Bonamia-ostreae-Infektionen

Werden Laboruntersuchungen nach den in Anhang I Teil 5 Abschnitt II aufgeführten Diagnosemethoden zum Zweck der Erlangung oder Erhaltung eines bestimmten Gesundheitsstatus in Bezug auf Bonamia-ostreae-Infektionen gemäß Anhang I Teil 5 Abschnitt I oder zum Zweck der Bestätigung bzw. des Ausschlusses des Vorliegens dieser aufgelisteten Krankheit gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG durchgeführt, so sind die in den folgenden Nummern I.1, I.2 und I.3 aufgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden.

I.1.   Prozess der Probenahme

Es sind in erster Linie geöffnete oder soeben verendete einzelne Weichtiere zu beproben, da dies die Chancen auf die Entdeckung infizierter Tiere erhöht.

Nach der Beprobung dürfen Austern in einem Kunststoffbeutel, der ein Etikett mit den Einzelheiten zu Art und Ursprung der Austern trägt, bei 4 °C oder auf gekühltem Eis für höchstens 24 Stunden aufbewahrt werden, wenn die Probe geöffnete Weichtiere enthält, und für höchstens 72 Stunden, wenn dies nicht der Fall ist. Geöffnete oder soeben verendete Weichtiere sind getrennt von anderen Weichtieren aufzubewahren.

Für die Diagnose von Bonamia ostreae mittels Histologie ist ein 3 bis 5 mm dicker Gewebeschnitt (einschließlich Kiemen und Herzgewebe) zu verwenden. Für einige Tests, wie Abdrücke und Polymerase-Kettenreaktion (PCR), ist ein Teil der Verdauungsdrüse zu verwenden.

I.2.   Mikroskopische Techniken

I.2.1.   Zytologie (Abdruck-Zytologie)

Nach der Trocknung der Kiemen- oder Herzgewebe auf Saugpapier sind mehrere Abdrücke auf einem Glasobjektträger anzufertigen. Die Objektträger werden luftgetrocknet, in Methanol oder reinem Ethanol fixiert und mithilfe eines im Handel erhältlichen Blutfärbekits (wie insbesondere Diff-Quik®/hemacolor®) entsprechend den Anweisungen des Herstellers eingefärbt. Nach dem Abspülen mit Leitungswasser und der Trocknung werden die Objektträger mit einem Deckglas eingedeckt; dabei ist ein geeignetes Kunstharz zu verwenden. Die Objektträger werden zunächst bei 200facher Vergrößerung und dann unter Ölimmersion bei 1 000facher Vergrößerung betrachtet.

Als positives Ergebnis gilt das Vorhandensein kleiner kugel- oder eiförmiger Organismen (2-5 μm breit) in den Hämozyten. Der Parasit könnte jedoch auch außerhalb der Zelle auftreten. Diese Organismen weisen ein basophiles Zytoplasma und einen eosinophilen Nukleus auf (Farben können je nach verwendeter Färbung variieren) und können, da sie sich auf dem Objektträger ausbreiten, auf Abdruckpräparaten breiter erscheinen als bei einer histologischen Untersuchung. Es kann sein, dass mehrkernige Zellen zu beobachten sind. Diese Technik ist nicht spezifisch für einzelne Parasitenarten.

I.2.2.   Histologie:

Schnitte von Gewebe, darunter Kiemen und Verdauungsdrüse, sind für mindestens 24 Stunden in Davidson-Lösung zu fixieren und anschließend normal für die Paraffinhistologie und Färbung, beispielsweise mit Hämatoxylin und Eosin, weiterzuverarbeiten. Beobachtungen werden bei bis zu 1 000fachen Vergrößerungen vorgenommen.

Als positives Ergebnis gilt das Vorhandensein von Parasiten als sehr kleine Zellen (2-5 μm breit) innerhalb der Hämozyten oder frei im Bindegewebe oder in den Sinussen von Kiemen, Darm und Mantelepithel, häufig in Verbindung mit einer heftigen Entzündungsreaktion. Um jeden Zweifel zu vermeiden, muss der Parasit für eine positive Diagnose innerhalb der Hämozyten beobachtet werden. Diese Technik ist nicht spezifisch für einzelne Parasitenarten.

I.3.   Molekulare Techniken

I.3.1.   DNA-Extraktion

DNA wird nach den Standardverfahren extrahiert.

Es dürfen im Handel erhältliche DNA-Extraktionskits verwendet werden, die üblicherweise hochwertige DNA ergeben und zur Verwendung mit den im Folgenden aufgeführten PCR-Protokollen geeignet sind.

I.3.2.   Polymerase-Kettenreaktion (PCR)

Es wurden mehrere PCR-Protokolle entwickelt und veröffentlicht.

Es dürfen zwei PCR-Protokolle verwendet werden, die auf die kleine Untereinheit (SSU) der rDNA abzielen:

a)

bei dem ersten handelt es sich um eine herkömmliche PCR, bei der verschiedene Mitglieder der Haplosporidia einschließlich Bonamiaspp. amplifiziert werden. Die als Bo bzw. Boas bezeichneten Primer sind 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ bzw. 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′; amplifiziert wird ein 300 bp großes Produkt. PCR-Mischungen enthalten einen Puffer (500 mM KCl, 100 mM Tris/HCl [pH-Wert 9,0 bei 25 °C] und 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP-Mischung, 1 μM Vorwärts- und Rückwärtsprimer, 0,02 Einheiten μl– 1 Taq DNA-Polymerase und 0,02 ng μl– 1 Taq der Muster-DNA in einem Gesamtvolumen von 50 μl. Die Proben werden in einen Thermozycler bei 94 °C fünf Minuten lang denaturiert, danach werden sie 30 Zyklen (bei 94 °C über eine Dauer von einer Minute, bei 55 °C über eine Dauer von einer Minute, bei 72 °C über eine Dauer von einer Minute) und anschließend ein abschließender Verlängerung bei 72 °C über einen Zeitraum von 10 Minuten unterzogen.

Positivkontrollen müssen aus genomischer DNA eines hochinfizierten Wirtes oder aus Plasmid-DNA einschließlich der Zielregion bestehen.

Negativkontrollen müssen aus genomischer DNA von nicht infizierten Wirten und PCR-Reaktiven ohne Ziel-DNA bestehen.

Als positives Ergebnis gilt eine positive PCR-Amplifikation bei der erwarteten Größe (d. h. 300 bp), wobei alle Negativkontrollen negativ und alle Positivkontrollen positiv sein müssen;

b)

das zweite PCR-Protokoll ist ein SYBR® Green Echtzeit-PCR-Assay. Dieses ermöglicht den spezifischen Nachweis von B. ostreae (unten beschrieben) und kann mit einem SYBR® Green Echtzeit-PCR-Assay kombiniert werden, der den spezifischen Nachweis von B. exitiosa ermöglicht (Ramilo et al. 2013).

Die Primer BOSTRE-F (5′- TTACGTCCCTGCCCTTTGTA-3′) und BOSTRE-R (5′- TCGCGGTTGAATTTTATCGT-3′) amplifizieren ein 208 bp großes Produkt. PCR-Mischungen enthalten SYBR® Green Master Mix (1X), 0,3 μM Vorwärts- und Rückwärtsprimer sowie 200 ng extrahierte DNA. Die Proben werden in einem Echtzeitnachweissystem zehn Minuten lang bei 95 °C denaturiert und danach 35 Zyklen (bei 95 °C über eine Dauer von 30 Sekunden, 55 °C über eine Dauer von 45 Sekunden und 72 °C über eine Dauer von einer Minute) unterzogen. Es ist eine Schmelzkurvenanalyse mit Temperaturschritten von 0,5 °C durchzuführen, beginnend bei 55 °C und bis zu einer Temperatur von 95 °C, und bei jedem Temperaturwechsel die Fluoreszenz aufzuzeichnen.

Positivkontrollen müssen aus genomischer DNA eines hochinfizierten Wirtes oder aus Plasmid-DNA einschließlich der Zielregion bestehen.

Negativkontrollen müssen aus genomischer DNA von nicht infizierten Wirten und PCR-Reaktiven ohne Ziel-DNA bestehen.

Als positives Ergebnis gilt eine positive PCR-Amplifikation mit einem einzigartigen Schmelzkurven-Peak (78,25 ± 0,25 °C unter den von Ramilo et al. 2013 veröffentlichten Bedingungen), wobei alle Negativkontrollen negativ und alle Positivkontrollen positiv sein müssen.

I.3.3.   In-situ-Hybridisierung (ISH)

Es wurden mehrere ISH-Protokolle entwickelt und veröffentlicht.

Es ist eine auf die SSU des rDNA-Genkomplexes abzielende Sonde zu verwenden, auch wenn sich gezeigt hat, dass diese Kreuzreaktionen mit anderen Mitgliedern der Familie Haplosporidia hervorruft.

Schnitte von Gewebe, darunter Kiemen und Verdauungsdrüse, sind für mindestens 24 Stunden in Davidson-Lösung zu fixieren und anschließend normal für die Paraffinhistologie weiterzuverarbeiten. Es sind Schnitte von 5 μm herzustellen und auf Aminoalkylsilan-beschichtete Objektträger aufzuziehen, die dann über Nacht im Ofen bei 40 °C zu backen sind. Die Schnitte werden durch ein 10-minütiges Eintauchen in Xylol entwachst. Dieser Schritt ist zu wiederholen; das Lösungsmittel wird durch Eintauchen in zwei aufeinanderfolgende Bäder mit reinem Ethanol für jeweils 10 Minuten entfernt. Die Schnitte sind dann durch Eintauchen in eine aufsteigende Ethanolreihe zu entwässern. Die Schnitte werden bei 37 °C über einen Zeitraum von 30 Minuten mit Proteinase K (100 μg ml– 1) in TE-Puffer (Tris [50 mM], EDTA [10 mM]) behandelt. Die Objektträger werden durch Eintauchen in eine aufsteigende Ethanolreihe entwässert und anschließend luftgetrocknet. Die Schnitte werden mit 100 μl Hybridisierungspuffer (4 × SSC [Standard-Salz-Citrat], 50 % Formamid, 1 × Denhardt-Lösung, 250 μg ml– 1 Hefe-tRNA, 10 % Dextransulfat) inkubiert, der 20 ng (2 μl der gemäß Nummer I.3.2 unter Verwendung der Primer Bo und Boas zubereiteten PCR-Reaktion) der Digoxigenin-markierten Sonde enthält. Die Schnitte werden mit In-situ-Kunststoffdeckgläsern abgedeckt und bei 95 °C für fünf Minuten auf einem Thermoblock gekocht. Die Objektträger werden auf Eis abgekühlt und dann über Nacht bei 42 °C in einer feuchten Kammer hybridisiert. Die Schnitte werden zweimal jeweils fünf Minuten lang bei Raumtemperatur in 2 × SSC und einmal zehn Minuten lang bei 42 °C in 0,4 × SSC gewaschen. Die Nachweisschritte sind entsprechend den Anweisungen des Herstellers durchzuführen. Die Objektträger werden dann in sterilem destilliertem Wasser (dH2O) gespült. Die Schnitte werden mit Bismarckbraun Y gegengefärbt, in dH2O gespült und unter Verwendung eines wässrigen Mediums mit Deckgläsern abgedeckt.

Positiv- und Negativkontrollen sind Schnitte von bekanntermaßen infizierten bzw. nicht infizierten Wirten.

Ein positives Ergebnis entspricht gekennzeichneten Parasiten innerhalb der Hämozyten, wobei alle Negativkontrollen negativ und alle Positivkontrollen positiv sein müssen.

I.3.4.   Sequenzierung

Die Sequenzierung wird als einer der letzten Schritte bei der Diagnosebestätigung durchgeführt. Zielregionen sind SSU rDNA und ITS1.

II.   Verfahren für die Überwachung und Bestätigung von Bonamia-ostreae-Infektionen

Die für die Zwecke der Überwachung und zur Bestätigung des Vorliegens einer Bonamia-ostreae-Infektion oder zur Ausräumung eines Verdachts darauf gemäß den Anforderungen in Anhang I Teil 5 Abschnitt II zu verwendenden Diagnosemethoden und entsprechenden Verfahren müssen den in der folgenden Tabelle 5.1 festgelegten Leitlinien entsprechen:

Tabelle 5.1

Leitlinien für die Verwendung von Diagnosemethoden für Überwachungsprogramme und zur Bestätigung oder zum Ausschluss des Vorliegens von Bonamia-ostreae-Infektionen

Methode

Gezielte Überwachung

Vorläufige Diagnose

Bestätigende Diagnose

Herz- oder Kiemen-Abdrücke

X

X

X oder

Histopathologie

X

 

X oder

In-situ-Hybridisierung

 

 

X und

PCR

X

X

X und

Sequenzierung

 

 

X

TEIL 6

DETAILLIERTE DIAGNOSEMETHODEN UND -VERFAHREN FÜR DIE ÜBERWACHUNG UND BESTÄTIGUNG DER WEISSPÜNKTCHENKRANKHEIT DER KREBSTIERE (WSD)

1.   Diagnoseverfahren für den Nachweis des WSSV

Werden Laboruntersuchungen und Probenahmen nach den in Anhang I Teil 6 Abschnitt II aufgeführten Diagnosemethoden für die Zwecke der Überwachungs- und Tilgungsprogramme gemäß Anhang I Teil 6 Abschnitt I, zur Bestätigung einer WSSV-Infektion oder zur Ausräumung eines Verdachts darauf gemäß Artikel 57 Buchstabe b der Richtlinie 2006/88/EG durchgeführt, so sind die im Folgenden unter den Nummern 2 bis 7 aufgeführten detaillierten Diagnosemethoden und -verfahren anzuwenden:

Die hier beschriebenen Methoden und Verfahren orientieren sich (mit Anpassungen) an dem nach ISO-17025 akkreditierten Test, den das Referenzlaboratorium der Europäischen Union für Krebstierkrankheiten anwendet. Es dürfen alternative Ansätze angewandt werden, bei denen gleichwertige Bedingungen oder Kits zum Einsatz kommen, die von unterschiedlichen Herstellern produziert werden, aber eine gleichwertige Empfindlichkeit und Spezifität wie die in diesem Teil beschriebenen aufweisen. In allen Fällen ist ein PCR-Amplifikatprodukt zu sequenzieren, um zu bestätigen, dass es sich tatsächlich um das Weißpünktchensyndromvirus (WSSV) handelt.

2.   Prozess der Probenahme

WSSV-enthaltende Gewebe (Schwimmbeine und Kiemen) von Krebstieren können in Ethanol, RNAlater oder schockgefroren bei – 80 °C aufbewahrt werden. Beim Nachweis von WSSV anhand von Gewebeproben sind folgende Schritte erforderlich: Homogenisierung des Gewebes, Extraktion der DNA, spezifische Amplifikation der WSSV-DNA mittels PCR, Visualisierung des amplifizierten Produkts auf einem Gel, Reinigung der DNA und Sequenzierung zur Bestätigung der Identität des Erregers.

3.   Gewebehomogenisierung

Der Aufschluss des Gewebes und die Zubereitung eines Homogenats in einem geeigneten Puffer ist unter Verwendung des Fast-Prep-Gewebedisruptors und von Lysing-Matrix-A-Röhrchen (MP Biomedicals) vorzunehmen. Das Gewebe wird gewogen und in Lysing-Matrix-A-Röhrchen gefüllt, im Verhältnis 1:10 w/v oder nach Anweisungen des Herstellers in einem geeigneten Puffer (G2 und 10 μl Proteinase K bei Verwendung des DNA-Gewebe-Kits (Qiagen)) verdünnt und mithilfe des Fast-Prep-24-Homogenisators zwei Minuten lang homogenisiert. Homogenisierte Proben sind bei 56 °C für eine Dauer von vier Stunden oder über Nacht zu inkubieren. Proben werden gevortext und bei 9 000 U/min für zwei Minuten zentrifugiert; 50 μl Überstand oder ein Volumen, das 5 mg Gewebe entspricht (optimales Gewebegewicht für ein Extraktionskit), wird einem Proberöhrchen zur DNA-Extraktion hinzugefügt und mit G2-Puffer auf ein Gesamtvolumen von 200 μl aufgefüllt.

4.   DNA-Extraktion

Die Gesamt-DNA wir unter Verwendung eines Kits zur Extraktion von DNA aus Gewebe und des Kits „EZ1 Advanced XL Biorobot“ (Qiagen) nach den Anweisungen des Herstellers extrahiert. Bei jeder Probencharge ist eine Extraktionskontrolle (Kalbsthymus-DNA) und eine Negativkontrolle (G2-Puffer) einzuschließen. Die DNA wird auf eine Menge von 50 μl eluiert. Um sicherzustellen, dass die Extraktion erfolgreich war, ist die DNA-Konzentration aller Proben und Kontrollen mithilfe eines NanoDrop-Geräts zu bestimmen. Die extrahierte DNA ist bei – 20 °C einzufrieren, wenn sie nicht sofort benötigt wird.

5.   WSSV-Polymerase-Kettenreaktion (PCR)

Die Methode zum Nachweis von WSSV ist das Protokoll für den Nachweis von WSSV mittels geschachtelter PCR gemäß dem folgenden Absatz, bei dem in der ersten und zweiten Runde der PCR ein 1 447 bp und ein 848 bp großes Amplikon des 18S-rRNA-Gens amplifiziert wird.

Die erste PCR-Reaktions-Runde wird in einem Volumen von 50 μl angesetzt, das Endkonzentrationen von 1 × GoTaq-Puffer (Promega), 5 mM MgCl2, 1 pmol/μl WSSV 146 F1 Primer, 1 pmol/μl WSSV 146 R1 Primer (Tabelle 1), 0,25 mM dNTP, 1,25 U Taq Polymerase und 2,5 μl DNA enthält. Jede Probe muss das Verfahren in doppelter Ausführung zusammen mit einer negativen Extraktionskontrolle, einer negativen PCR-Kontrolle (2,5 μl H2O anstelle von DNA) und einer Positivkontrolle durchlaufen. Bei der Positivkontrolle muss es sich um verdünnte WSSV-Plasmide handeln, die für die In-house-Verwendung hergestellt und validiert wurden (kann vom EURL bezogen werden).

Die zweite PCR-Reaktions-Runde ist ebenso anzusetzen wie die erste Runde, jedoch unter Verwendung des WSSV-146-F2/R2 Primersatzes und mit einer zweiten Positivkontrolle, mit der überprüft wird, dass diese Phase der PCR funktioniert hat.

Primer

Sequenz

WSSV 146 F1

ACTACTAACTTCAGCCTATCTAG

WSSV 146 R1

TAATGCGGGTGTAATGTTCTTACGA

WSSV 146 F2

GTAACTGCCCCTTCCATCTCCA

WSSV 146 R2

TACGGCAGCTGCTGCACCTTGT

Sowohl die erste als auch die zweite PCR-Runde werden unter folgenden Zyklusbedingungen in einem DNA-Engine-Tetrad-2-Peltier-Thermozykler (oder einem gleichwertigen Gerät) durchgeführt. Erster Denaturierungsschritt bei 94 °C über einen Zeitraum von zwei Minuten, gefolgt von 94 °C über einen Zeitraum von 30 Sekunden, 62 °C über einen Zeitraum von 30 Sekunden, 72 °C über einen Zeitraum von 30 Sekunden, wiederholt über 30 Zyklen, Verlängerungsschritt bei 72 °C über einen Zeitraum von zwei Minuten und Halten bei 4 °C.

6.   Gelelektrophorese

Amplifizierte PCR-Produkte aus der ersten und aus der zweiten PCR-Runde sind auf 2 %igen Agarose-Gelen unter Verwendung von TAE-Puffern zu visualisieren. 15 μl von jeder Probe werden bei 120 Volt für etwa 20 Minuten behandelt und unter UV-Licht betrachtet. Positive Proben ergeben in der ersten PCR-Runde ein Fragment von 1 447 bp oder in der zweiten PCR-Runde ein Fragment von 848 bp. Proben dieser Größe sind auszuschneiden und in ein 1,5-ml-Microfuge-Röhrchen zu geben. Die in den Gelschnitten enthaltene DNA wird mithilfe von Promega-Wizard®-SV-Gel und des PCR-clean-up-Systems nach Anweisungen der Hersteller gereinigt. Die Konzentration der DNA wird mit einem NanoDrop-Gerät geschätzt. Die gereinigte DNA wird bei – 20 °C eingefroren, wenn sie nicht sofort benötigt wird.

7.   Sequenzierung von PCR-Produkten

Die DNA wird mithilfe des Big-Dye-Terminator-Kits v3,1 (Applied Biosystems) sequenziert. Die Gesamtmenge jeder Reaktion beträgt 20 μl, mit folgenden Endkonzentrationen: 1 × Big-Dye-Terminator, 1 × Sequenzierungspuffer, 10 pmol/μl Vorwärts- oder Rückwärtsprimer und 10 μl gereinigte DNA (auf etwa 10 ng/μl verdünnt); durchgeführt wird sie auf einem DNA-Engine-Tetrad-2-Peltier-Thermzykler (oder einem gleichwertigen Gerät) unter folgenden Zyklusbedingungen: 94 °C über einen Zeitraum von 30 Sekunden, danach 96 °C über einen Zeitraum von 10 Sekunden, 50 °C über einen Zeitraum von 10 Sekunden und 60 °C über einen Zeitraum von vier Minuten, wobei die letzten drei Schritte 30 Mal zu wiederholen sind.

Die PCR-Produkte aus der Sequenzierung werden mithilfe einer Natriumacetat-Methode ausgefällt, bei der 20 μl DNA zu 10 μl NaAc, 70 μl H2O und 250 μl Ethanol gegeben, gevortext und 20 Minuten lang bei 13 000 U/min zentrifugiert werden; der Überstand wird entfernt und das Pellet mit 200 μl reinem Ethanol gewaschen, wobei es fünf Minuten lang bei 13 000 U/min zentrifugiert wird. Das Pellet wird bei 37 °C fünf Minuten lang getrocknet. Den Pellets werden 25 μl Hi-Di-Formamide zugesetzt, sie werden zwei Minuten lang auf 95 °C erwärmt und dann gründlich gevortext. Die Proben werden mithilfe des ABI3130xl-Avant-Genetic-Analysators nach Anweisung der Hersteller sequenziert. Die Ergebnisse der Sequenzierung werden mit der Sequencher-Software analysiert und die Sequenzen werden per BLAST-Funktion mit den in der NCBI-Datenbank enthaltenen Sequenzen abgeglichen.


Top