EUR-Lex Access to European Union law

Back to EUR-Lex homepage

This document is an excerpt from the EUR-Lex website

Document 32015D1554

Kommissionens gennemførelsesafgørelse (EU) 2015/1554 af 11. september 2015 om fastlæggelse af regler for anvendelsen af direktiv 2006/88/EF for så vidt angår krav til overvågning og diagnosemetoder (meddelt under nummer C(2015) 6188) (EØS-relevant tekst)

OJ L 247, 23.9.2015, p. 1–62 (BG, ES, CS, DA, DE, ET, EL, EN, FR, HR, IT, LV, LT, HU, MT, NL, PL, PT, RO, SK, SL, FI, SV)

In force

ELI: http://data.europa.eu/eli/dec_impl/2015/1554/oj

23.9.2015   

DA

Den Europæiske Unions Tidende

L 247/1


KOMMISSIONENS GENNEMFØRELSESAFGØRELSE (EU) 2015/1554

af 11. september 2015

om fastlæggelse af regler for anvendelsen af direktiv 2006/88/EF for så vidt angår krav til overvågning og diagnosemetoder

(meddelt under nummer C(2015) 6188)

(EØS-relevant tekst)

EUROPA-KOMMISSIONEN HAR —

under henvisning til traktaten om Den Europæiske Unions funktionsmåde,

under henvisning til Rådets direktiv 2006/88/EF af 24. oktober 2006 om dyresundhedsbestemmelser for akvakulturdyr og produkter deraf og om forebyggelse og bekæmpelse af visse sygdomme hos vanddyr (1), særlig artikel 49, stk. 3, artikel 50, stk. 4, artikel 57, litra b), og artikel 61, stk. 3, og

ud fra følgende betragtninger:

(1)

Ved direktiv 2006/88/EF er der fastsat forebyggende minimumsforanstaltninger til overvågning og tidlig påvisning hos akvatiske dyr af de listeopførte sygdomme i bilag IV til samme direktiv (i det følgende benævnt »listeopførte sygdomme«) samt bekæmpelsesforanstaltninger, der skal anvendes ved mistanke om eller udbrud af de listeopførte sygdomme. I direktivet fastsættes der tillige krav, som skal være opfyldt, for at medlemsstater eller zoner eller segmenter deri kan opnå status som sygdomsfri.

(2)

Udryddelse af de listeopførte sygdomme og opnåelse af status som sygdomsfri for en medlemsstat, en zone eller et segment bør være baseret på de samme principper og følge den samme videnskabelige fremgangsmåde i hele Unionen. Det er derfor nødvendigt, at der på EU-plan fastsættes særlige krav vedrørende udryddelses- og overvågningsordninger samt de prøveudtagnings- og diagnosemetoder, medlemsstaterne skal anvende med henblik på at opnå status som sygdomsfri for hele medlemsstaten eller for en zone eller et segment deri.

(3)

De laboratorieundersøgelser, der skal udføres i tilfælde af mistanke om eller bekræftet forekomst af de listeopførte sygdomme, bør være de samme i hele Unionen og bør følge de samme videnskabelige standarder og protokoller. Det er nødvendigt, i overensstemmelse med direktiv 2006/88/EF, at fastlægge særlige diagnosemetoder og -procedurer, som skal anvendes af de laboratorier, der er udpeget til formålet af den kompetente myndighed i medlemsstaterne.

(4)

Ved akvatiske dyrs sundhedskodeks som vedtaget af Verdensorganisationen for Dyresundhed (OIE) (i det følgende benævnt »den akvatiske kodeks«) er der fastsat standarder for forbedring af akvatiske dyrs sundhed og opdrættede fisks velfærd på verdensplan, herunder standarder for sikker international handel med akvatiske dyr og produkter deraf. Flere af kapitlerne i den akvatiske kodeks indeholder anbefalinger vedrørende anvendelse af visse diagnostiske test. Sådanne test, som fastsat af OIE, er indeholdt i OIE's Manual of Diagnostic Tests for Aquatic Animals (i det følgende benævnt »den akvatiske manual«). For at sikre, at Unionens krav med hensyn til diagnosticering af sygdomme hos akvatiske dyr er i overensstemmelse med de internationale standarder, bør der med reglerne i denne afgørelse tages hensyn til standarderne og anbefalingerne i den akvatiske kodeks.

(5)

I denne forbindelse indeholder den akvatiske manual, for mange af de listeopførte sygdomme, flere forskellige test og procedurer, der skal anvendes til laboratorieundersøgelser. Med henblik på at ensarte det videnskabelige grundlag for det diagnostiske arbejde for de listeopførte sygdomme på EU-plan er det nødvendigt at vælge blandt de diagnostiske test og procedurer, der anbefales af OIE, og præcisere, hvilke test der skal være obligatoriske til laboratorieundersøgelser i forbindelse med gennemførelsen af overvågningsprogrammer og til udelukkelse af mistanke om eller bekræftelse af forekomst af de listeopførte sygdomme. Mens der også vil være behov for i visse tilfælde at kunne anvende alternative metoder og procedurer, bør det beskrives og i et vist omfang videnskabeligt forklares, hvornår og hvordan de alternative metoder vil kunne anvendes. Dette er især nødvendigt for de mere detaljerede diagnostiske procedurer.

(6)

Med henblik på at sikre nøjagtige og reproducerbare diagnostiske resultater er det vigtigt, at de nærmere beskrevne procedurer og protokoller, der skal anvendes, er valideret i overensstemmelse med de relevante kvalitetsstandarder som omhandlet i del I i bilag VI til direktiv 2006/88/EF. For mange af de diagnosemetoder, der er omhandlet i denne afgørelse, er anvendelse af kommercielle testkit en nødvendig del af de diagnostiske protokoller, og disse testkit er blevet valideret i akkrediterede prøvninger af EU-referencelaboratorierne for de respektive sygdomme. Af hensyn til retssikkerheden bør der i denne afgørelse henvises til de kommercielle navne på disse validerede kommercielle testkit.

(7)

Det kan være vanskeligt for visse medlemsstater at opnå status som sygdomsfri for hele medlemsstaten eller for en zone eller et segment deri for så vidt angår en eller flere af de listeopførte sygdomme. Medlemsstaten vil i sådanne situationer kunne foretrække ikke at opnå eller generhverve status som sygdomsfri for de pågældende listeopførte sygdomme. De minimumsbekæmpelsesforanstaltninger, der skal gennemføres, i tilfælde af at den pågældende medlemsstat ikke ønsker at opnå eller generhverve status som sygdomsfri, bør være de samme i hele EU og bør opfylde de samme kriterier. Det er derfor nødvendigt i overensstemmelse med direktiv 2006/88/EF at fastlægge nærmere regler vedrørende hindring af spredning af de pågældende listeopførte sygdomme og minimumsbetingelser for ophævelse af de pågældende foranstaltninger mod spredning af sygdom.

(8)

Ved Kommissionens beslutning 2001/183/EF (2) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning og bekræftelse af de listeopførte sygdomme infektiøs hæmatopoietisk nekrose og viral hæmoragisk septikæmi. Ved Kommissionens beslutning 2003/466/EF (3) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning af infektiøs lakseanæmi samt kriterier for etablering af zoner og officielt tilsyn ved mistanke om og bekræftet forekomst af denne sygdom. Ved Kommissionens beslutning 2002/878/EF (4) er der fastsat krav vedrørende prøveudtagningsplaner og diagnosemetoder til påvisning og bekræftelse af bløddyrsygdommene bonamiose og marteiliose. Med henblik på at få opdateret kravene bør disse tre beslutninger ophæves og afløses af denne afgørelse. Beslutning 2001/183/EF, 2002/878/EF og 2003/466/EF bør således ophæves.

(9)

Eftersom visse medlemsstater har brug for tid til at opdatere deres nationale referencelaboratorier for at kunne opfylde de krav, der fastsættes ved denne afgørelse, bør denne finde anvendelse fra den 1. april 2016.

(10)

Foranstaltningerne i denne afgørelse er i overensstemmelse med udtalelse fra Den Stående Komité for Planter, Dyr, Fødevarer og Foder —

VEDTAGET DENNE AFGØRELSE:

Artikel 1

Formål

Ved denne afgørelse fastsættes der regler for følgende:

a)

den overvågning, de stødpudezoner, den prøveudtagning og de diagnosemetoder, der skal anvendes af medlemsstaterne i forbindelse med sygdomsstatussen for medlemsstater eller zoner eller segmenter deri for de ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (i det følgende benævnt »listeopførte sygdomme«)

b)

de diagnosemetoder, der skal anvendes til laboratorieundersøgelser i tilfælde af mistanke om eller bekræftet forekomst af listeopførte sygdomme

c)

de minimumsbekæmpelsesforanstaltninger, der skal gennemføres, i tilfælde af mistanke om eller bekræftelse af en listeopført sygdom i en medlemsstat, en zone eller et segment, der ikke er erklæret fri(t) for den pågældende listeopførte sygdom.

Artikel 2

Definitioner

I denne afgørelse forstås ved:

a)   »viral hæmoragisk septikæmi« (»VHS«): en sygdom forårsaget af viral hæmoragisk septikæmi-virus (VHSV), også kendt som Egtved-virus, som er et virus tilhørende slægten Novirhabdovirus i familien Rhabdoviridae

b)   »infektiøs hæmatopoietisk nekrose« (»IHN«): en sygdom forårsaget af infektiøs hæmatopoietisk nekrose-virus (IHNV), som er et virus tilhørende slægten Novirhabdovirus i familien Rhabdoviridae

c)   »koi-herpesvirus-sygdom« (»KHVD«): en sygdom forårsaget af koi-herpesvirus (KHV), som tilhører familien Alloherpesviridae. Det videnskabelige navn er cyprinid herpesvirus 3 (CyHV-3)

d)   »infektiøs lakseanæmi« (»ISA«): en sygdom forårsaget af infektion med highly polymorphic region-deleteret (HPR-deleteret) lakseanæmivirus (ISAV), som er et virus tilhørende slægten Isavirus i familien Orthomyxoviridae

e)   »infektion med Marteilia refringens«: en sygdom forårsaget af infektion med Marteilia refringens, som er et protozo tilhørende Paramyxea

f)   »infektion med Bonamia ostreae«: en sygdom forårsaget af infektion med Bonamia ostreae, som er et protozo tilhørende Haplosporidia

g)   »white spot disease« (»WSD«): en sygdom forårsaget af white spot syndrome-virus (WSSV), som er et dobbeltstrenget DNA-virus, der tilhører slægten Whispovirus i familien Nimaviridae.

Artikel 3

Minimumskrav for udryddelses- og overvågningsprogrammer

Medlemsstaterne sikrer, at de regler vedrørende overvågnings- og udryddelsesprogrammer, stødpudezoner, prøveudtagning og diagnosemetoder, der er fastsat i bilag I, og de specifikke metoder og detaljerede procedurer, der er fastsat i bilag II, overholdes, når status som sygdomsfri skal indrømmes, trækkes tilbage eller generhverves for en medlemsstat eller en zone eller et segment deri for så vidt angår en eller flere af de listeopførte sygdomme.

Artikel 4

Minimumskrav for diagnosemetoder og specifikke procedurer

Medlemsstaterne sikrer, at bekæmpelsesmetoderne i bilag I og de særlige diagnosemetoder og detaljerede procedurer i bilag II følges, når der udføres laboratorieundersøgelser for at bekræfte eller udelukke forekomst af en listeopført sygdom.

Artikel 5

Minimumsbekæmpelsesforanstaltninger for hindring af spredning af listeopførte sygdomme og minimumskrav vedrørende ophævelse af foranstaltninger mod spredning af sygdom i medlemsstater, zoner eller segmenter, som ikke er erklæret frie for listeopførte sygdomme

Medlemsstaterne sikrer, at minimumsbekæmpelsesforanstaltningerne og minimumskravene vedrørende ophævelse af foranstaltninger mod spredning af sygdom i bilag I overholdes, når bekæmpelsesforanstaltninger gennemføres og foranstaltninger mod spredning af sygdom ophæves for en eller flere af de listeopførte sygdomme i en medlemsstat eller en zone eller et segment deri, som ikke er erklæret fri(t) for de pågældende listeopførte sygdomme.

Artikel 6

Ophævelse

Beslutning 2001/183/EF, 2002/878/EF og 2003/466/EF ophæves.

Artikel 7

Anvendelsesdato

Denne afgørelse anvendes fra den 1. april 2016.

Artikel 8

Adressater

Denne afgørelse er rettet til medlemsstaterne.

Udfærdiget i Bruxelles, den 11. september 2015.

På Kommissionens vegne

Vytenis ANDRIUKAITIS

Medlem af Kommissionen


(1)  EUT L 328 af 24.11.2006, s. 14.

(2)  Kommissionens beslutning 2001/183/EF af 22. februar 2001 om fastlæggelse af prøveudtagningsplaner for og diagnosticeringsmetoder til påvisning og bekræftelse af visse fiskesygdomme og om ophævelse af beslutning 92/532/EØF (EFT L 67 af 9.3.2001, s. 65).

(3)  Kommissionens beslutning 2003/466/EF af 13. juni 2003 om kriterier for etablering af zoner og officielt tilsyn ved mistanke om eller bekræftet forekomst af infektiøs lakseanæmi (ISA) (EUT L 156 af 25.6.2003, s. 61).

(4)  Kommissionens beslutning 2002/878/EF af 6. november 2002 om prøveudtagningsplaner og diagnosticeringsmetoder til påvisning og bekræftelse af bløddyrsygdommene bonamiose (Bonamia ostreae) og marteiliose (Marteilia refringens) (EFT L 305 af 7.11.2002, s. 57).


BILAG I

OVERVÅGNING OG BEKÆMPELSESMETODER

I.   Indledning

I dette bilag fastsættes:

a)

krav vedrørende udryddelses- og overvågningsprogrammer, jf. artikel 44 i direktiv 2006/88/EF, samt de prøveudtagnings- og diagnosemetoder, der skal anvendes med henblik på at indrømme medlemsstater eller zoner eller segmenter deri status som sygdomsfri, jf. kapitel VII i samme direktiv

b)

de prøveudtagnings- og diagnosemetoder, der skal anvendes til laboratorieundersøgelser, som skal udføres i tilfælde af mistanke om eller med henblik på at bekræfte forekomst af de ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (»listeopførte sygdomme«), jf. artikel 28, litra a), og artikel 57, litra b), i samme direktiv

c)

de foranstaltninger mod spredning af sygdom, der skal træffes i tilfælde af bekræftet forekomst af en listeopført sygdom, jf. artikel 39 i direktiv 2006/88/EF, og de foranstaltninger, der skal træffes, for at en medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V, opnår en sundhedsstatus i kategori III.

Kravene i bilaget omfatter følgende listeopførte sygdomme:

1.

Viral hæmoragisk septikæmi (VHS)

Del 1

2.

Infektiøs hæmatopoietisk nekrose (IHN)

Del 1

3.

Koi-herpesvirus-sygdom (KHV)

Del 2

4.

Infektiøs lakseanæmi (ISA)

Del 3

5.

Infektion med Marteilia refringens

Del 4

6.

Infektion med Bonamia ostreae

Del 5

7.

White spot disease (WSD)

Del 6

II.   Definitioner

I bilag I og II forstås ved:

a)   »indlandssegment«: et eller flere akvakulturbrug beliggende i indlandsområdet i en eller flere medlemsstater, tilhørende samme biosikkerhedssystem og med en population af akvatiske dyr med en bestemt sundhedsstatus med hensyn til en given sygdom

b)   »indlandsbrug«: et akvakulturbrug med hold af akvakulturdyr beliggende i en medlemsstats indlandsområde

c)   »indlandszone«: et klart defineret geografisk område beliggende i indlandsområdet i en eller flere medlemsstater med et homogent hydrologisk system, som omfatter dele af et afvandingsområde fra vandløbenes kilder til en naturlig eller kunstig forhindring, der standser akvatiske dyrs vandring opstrøms fra de lavereliggende dele af afvandingsområdet, et helt afvandingsområde fra vandløbenes kilder til udmundingen i havet eller flere afvandingsområder, inkl. deres udmunding i havet, idet afvandingsområderne er epidemiologisk forbundet via udmundingsområdet

d)   »akvakulturbrug, der officielt er erklæret inficeret«: et akvakulturbrug med hold af akvatiske dyr, hvor en eller flere af de listeopførte sygdomme er blevet bekræftet af den kompetente myndighed i overensstemmelse med artikel 28, litra a), artikel 29 og artikel 57, litra b), i direktiv 2006/88/EF

e)   »kontaktbrug«: et akvakulturbrug med hold af akvatiske dyr, på hvilket der på en eller anden måde er påvist eller er stærk mistanke om kontaminering med inficeret materiale fra et akvakulturbrug, der officielt er erklæret inficeret.

DEL 1

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR VIRAL HÆMORAGISK SEPTIKÆMI (VHS) OG INFEKTIØS HÆMATOPOIETISK NEKROSE (IHN)

I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår VHS og IHN og foranstaltninger mod spredning af disse listeopførte sygdomme

I.1.   Generelle krav til sundhedsinspektioner og prøveudtagning for så vidt angår VHS og IHN:

a)

Sundhedsinspektionerne og, hvis det er relevant, prøveudtagningen skal foretages på den tid af året, hvor vandtemperaturen er under 14 °C, eller hvor vandtemperaturen forventes at være lavest.

b)

Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende populationer af modtagelige arter.

c)

Hvis akvakulturbrug eller vildtlevende populationer skal være omfattet af sundhedsinspektioner eller prøveudtagninger mere end én gang om året, skal der være så lang tid som muligt og mindst fire måneder mellem sundhedsinspektionerne og mellem udtagningen af prøverne, idet der tages hensyn til temperaturkravene i litra a).

d)

Alle produktionsenheder som f.eks. damme, tanke og netbure skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd. Opmærksomheden skal navnlig rettes mod vandudledningsområdet, hvor de svage fisk har tendens til at samles på grund af vandstrømmen.

e)

Fisk af modtagelige arter, som skal indsamles som prøver, udvælges på følgende måde:

i)

Hvis der forekommer regnbueørred, må kun fisk af denne art udvælges til prøveudtagning, undtagen hvis der forekommer andre modtagelige arter med typiske tegn på VHS eller IHN; hvis der ikke forekommer regnbueørred, skal prøven være repræsentativ for alle andre modtagelige arter på stedet.

ii)

Hvis der forekommer svage fisk, fisk med unormal adfærd eller nyligt døde fisk (som ikke er gået i opløsning), skal disse udvælges; ved benyttelse af mere end én vandkilde til fiskeproduktion skal der medtages fisk fra alle vandkilder i prøven.

iii)

De udvalgte fisk skal omfatte fisk, der er indsamlet på en sådan måde, at alle dele af akvakulturbruget og alle årgange er proportionalt repræsenteret i prøven.

I.2.   Særlige krav vedrørende opnåelse af status som sygdomsfri (kategori I) for så vidt angår VHS og IHN

I.2.1.   Overvågningsprogrammer:

a)

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår VHS eller IHN eller begge, kan opnå en sundhedsstatus i kategori I for så vidt angår disse listeopførte sygdomme, forudsat at alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i denne medlemsstat, denne zone eller dette segment opfylder kravene i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktivet, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte del, har været omfattet af et af følgende overvågningsprogrammer:

i)

Model A — toårigt overvågningsprogram:

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 1.A i afsnit II.

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for enten VHS eller IHN eller begge, og enhver mistanke om enten VHS eller IHN eller begge skal være blevet udelukket i overensstemmelse med prøveudtagnings- og diagnosemetoderne i punkt II.3.

ii)

Model B — fireårigt overvågningsprogram med reduceret prøvestørrelse:

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst fire på hinanden følgende år som fastsat i tabel 1.B i afsnit II.

I løbet af denne fireårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for enten VHS eller IHN eller begge, og enhver mistanke om enten VHS eller IHN eller begge skal være blevet udelukket i overensstemmelse med prøveudtagnings- og diagnosemetoderne i punkt II.3.

b)

Hvis det i forbindelse med gennemførelsen af det overvågningsprogram, der er omhandlet i litra a), bekræftes, at der er infektion med enten VHS eller IHN eller begge på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som fastsat i punkt I.2.2, forudsat at bruget opfylder følgende betingelser:

i)

Det er et indlandsbrug, hvis sundhedsstatus vedrørende enten VHS eller IHN eller begge er uafhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder for så vidt angår disse listeopførte sygdomme i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF.

ii)

Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

iii)

Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge.

I.2.2.   Udryddelsesprogrammer

I.2.2.1.   Generelle krav

En medlemsstat, en zone eller et segment med en sundhedsstatus i kategori V for så vidt angår enten VHS eller IHN eller begge kan opnå en sundhedsstatus i kategori I for så vidt angår disse listeopførte sygdomme, forudsat at alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af et udryddelsesprogram, som opfylder litra a)-e):

a)

De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af den listeopførte sygdom til opdrættede og vildtlevende fisk som f.eks.: antallet, procentdelen og fordelingen af døde fisk på det akvakulturbrug, der er inficeret med enten VHS eller IHN eller begge, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på brugene, opdrætspraksis på de berørte akvakulturbrug og på de brug, der ligger nærmest de berørte brug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme, og den skal svare til:

1)

i kystområder: et område i en cirkel med en radius, der mindst svarer til en tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum i det akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data

2)

i områder inde i landet: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med VHS eller IHN eller begge; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet eller akvakulturbrugets område, forudsat at dette ikke forringer forebyggelsen af spredningen af enten VHS eller IHN eller begge.

ii)

Den kompetente myndighed skal oprette en overvågningszone uden om beskyttelseszonen, og den skal svare til:

1)

i kystområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data

2)

i områder inde i landet: et udvidet område uden om den oprettede beskyttelseszone.

b)

På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med enten VHS eller IHN eller begge, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer:

i)

indsamling af prøver med henblik på undersøgelse af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med enten VHS eller IHN eller begge, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund

ii)

én sundhedsinspektion: på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater; der skal fortsat foretages sundhedsinspektioner én gang om måneden på den tid af året, hvor vandtemperaturen er under 14 °C, undtagen når fiskedamme eller netbure er dækket med is, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).

c)

Alle akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Hvis alle akvakulturbrug, der officielt er erklæret inficeret, inden for samme beskyttelseszone tømmes, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet.

Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse akvakulturbrug skal være udtaget af drift.

d)

På alle akvakulturbrug, der officielt er erklæret inficeret med enten VHS eller IHN eller begge disse listeopførte sygdomme, og på alle andre akvakulturbrug, der er udtaget af drift, inden for de oprettede beskyttelses- og overvågningszoner, jf. litra c), skal nytilførslen af fisk ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus som sygdomsfri (kategori I) for så vidt angår enten VHS eller IHN eller begge.

Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).

e)

Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1.

I.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for enten IHN eller VHS eller begge

Et indlandssegment, der omfatter et enkelt akvakulturbrug, som tidligere har været erklæret frit for enten VHS eller IHN eller begge disse listeopførte sygdomme, og hvis sundhedsstatus for så vidt angår disse listeopførte sygdomme er uafhængig af de omkringliggende naturlige vandområder i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at følgende betingelser er opfyldt:

a)

Det akvakulturbrug, der officielt er bekræftet inficeret med enten VHS eller IHN eller begge, er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

b)

Nytilførslen af fisk på det akvakulturbrug, der officielt er bekræftet inficeret med enten VHS eller IHN eller begge, er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge.

I.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår enten VHS eller IHN eller begge

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning af fisk i overensstemmelse med tabel 1.C i afsnit II i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af enten VHS eller IHN eller begge disse listeopførte sygdomme.

Ved fastlæggelsen af hyppigheden af sundhedsinspektioner for segmenter med en sundhedsstatus i kategori I for så vidt angår enten VHS eller IHN eller begge, som er placeret i indlandsområder, og hvis sundhedsstatus for så vidt angår VHS eller IHN er afhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder i overensstemmelse med del II, punkt 2, i bilag V til direktiv 2006/88/EF, anses risikoen for indslæbning af enten VHS eller IHN eller begge for at være høj.

Statussen som sygdomsfri opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 giver negative resultater for enten VHS eller IHN eller begge disse listeopførte sygdomme, og enhver mistanke om enten VHS eller IHN eller begge er udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

I.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF, dvs. ændring af sundhedsstatus fra kategori V til kategori III

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår enten VHS eller IHN eller begge, kan opnå en sundhedsstatus i kategori III for så vidt angår disse listeopførte sygdomme, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal de berørte akvakulturbrug gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at enten IHNV eller VHSV eller begge er udryddet i brugets miljø

b)

nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre brug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår enten VHS eller IHN eller begge

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).

II.   Diagnose- og prøveudtagningsmetoder

II.1.   Organer, der skal udtages prøver fra

Det vævsmateriale, som skal undersøges, er milt, fornyre og enten hjerte eller hjerne. Hvis der udtages prøver fra gydebestande, kan tillige ovarievæsken eller sædvæsken undersøges.

Hvis der er tale om småfisk, kan hele fisk på under 4 cm findeles ved hjælp af en steril saks eller skalpel efter fjernelse af kroppen bag gatåbningen. Hvis prøven består af hele fisk på 4-6 cm, indsamles indvoldene, herunder nyre.

Organstykker fra højst 10 fisk kan udgøre en samleprøve.

II.2.   Diagnosemetoder med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår enten VHS eller IHN eller begge

Diagnosemetoden, i overensstemmelse med de godkendte diagnosemetoder og -procedurer, der er fastsat i bilag II, del 1, punkt I, med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår VHS eller IHN eller begge, skal enten være:

a)

virusisolation i cellekulturer efterfulgt af identifikation ved hjælp af enzymbundet immunosorbent assay (ELISA), indirekte fluorescerende antistoftest (IFAT), virusneutralisationstest eller realtids revers transkriptase-polymerasekædereaktion (RT-qPCR) eller

b)

RT-qPCR.

II.3.   Prøveudtagnings- og diagnosemetoder med henblik på at udelukke eller bekræfte forekomst af VHS eller IHN

Hvis mistanke om forekomst af enten VHS eller IHN eller begge skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:

a)

På det akvakulturbrug, der er under mistanke, skal der foretages mindst én sundhedsinspektion og én prøveudtagning af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med enten VHS eller IHN eller begge, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af en eller flere af diagnosemetoderne i nr. i) og ii) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 1, afsnit II:

i)

konventionel virusisolation i cellekulturer med efterfølgende immunokemisk eller molekylær virusidentifikation

ii)

viruspåvisning ved hjælp af RT-qPCR

iii)

andre diagnoseteknikker med dokumenteret tilsvarende effektivitet, f.eks. IFAT, ELISA, RT-PCR og immunhistokemi (IHC).

b)

Forekomst af VHS anses for bekræftet, hvis en eller flere af disse diagnosemetoder er positive for VHSV. Forekomst af IHN anses for bekræftet, hvis en eller flere af disse diagnosemetoder er positive for IHNV. Bekræftelse af det første tilfælde af VHS eller IHN i de medlemsstater, zoner eller segmenter, der ikke tidligere har været inficeret, baseres på konventionel virusisolation i cellekulturer eller RT-qPCR.

c)

Mistanke om enten VHSV eller IHNV eller begge kan udelukkes, hvis celledyrkning eller RT-qPCR-test ikke afslører yderligere tegn på forekomst af enten VHSV eller IHNV eller begge.

Tabel 1.A

Overvågningsordning for zoner og segmenter i den toårige kontrolperiode, jf. punkt I.2.1, litra a), nr. i), forud for opnåelse af status som sygdomsfri for så vidt angår VHS eller IHN

Type akvakulturbrug

Antal sundhedsinspektioner pr. år (i to år)

Antal prøveudtagninger pr. år (i to år)

Antal fisk i prøven (1)

Antal fisk i vækst

Antal gydebestandsfisk (2)

a)

Akvakulturbrug med gydebestand

2

2

50 (1. inspektion)

75 (2. inspektion)

30 (1. eller 2. inspektion)

0 (1. eller 2. inspektion)

b)

Akvakulturbrug udelukkende med gydebestand

2

1

0

75 (1. eller 2. inspektion)

c)

Akvakulturbrug uden gydebestand

2

2

75 (3) (1. og 2. inspektion)

0

Maksimalt antal fisk pr. samleprøve: 10


Tabel 1.B

Overvågningsordning med reduceret prøvestørrelse i den fireårige kontrolperiode, jf. punkt I.2.1, litra a), nr. ii), forud for opnåelse af status som sygdomsfri for så vidt angår VHS eller IHN

Type akvakulturbrug

Antal sundhedsinspektioner pr. år

Antal prøveudtagninger pr. år

Antal fisk i prøven (4)

Antal fisk i vækst

Antal gydebestandsfisk (5)

De første to år i overvågningsperioden

a)

Akvakulturbrug med gydebestand

2

1

0 (1. inspektion)

30 (2. inspektion)

0 (1. inspektion)

0 (2. inspektion)

b)

Akvakulturbrug udelukkende med gydebestand

2

1

0

30 (1. eller 2. inspektion)

c)

Akvakulturbrug uden gydebestand

2

1

30 (6) (1. eller 2. inspektion)

0

De sidste to år i overvågningsperioden

a)

Akvakulturbrug med gydebestand

2

2

30 (1. inspektion)

0 (2. inspektion)

0 (1. inspektion)

30 (2. inspektion)

b)

Akvakulturbrug udelukkende med gydebestand

2

2

 

30 (1. og 2. inspektion)

c)

Akvakulturbrug uden gydebestand

2

2

30 (6) (1. og 2. inspektion)

 

Maksimalt antal fisk pr. samleprøve: 10


Tabel 1.C

Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår VHS eller IHN, jf. punkt I.3

Risikoniveau

Antal sundhedsinspektioner

Antal fisk i prøven (9)

Højt

2 pr. år

30 (7)  (8)

Middel

1 pr. år

30 (7)

Lavt

1 hvert 2. år

30 (7)

Maksimalt antal fisk pr. samleprøve: 10

DEL 2

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR KOI-HERPESVIRUS-SYGDOM (KHVD)

I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår KHVD og foranstaltninger mod spredning af infektion med koi-herpesvirus (KHV)

I.1.   Generelle krav

Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal også være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende modtagelige populationer, dvs. flodsystemer og søer.

Den målrettede overvågning skal være baseret på regelmæssig overvågning af steder med modtagelige arter. Stederne skal overvåges, når vandtemperaturerne er tilstrækkelig høje til, at sygdommen kan udvikle sig (> 15 °C), og tidligst to uger fra den dato, hvor sådanne temperaturer er nået. Alle syge fisk eller fisk, der udviser unormal adfærd, som findes på stedet, skal underkastes prøveudtagning og testes.

Når det er muligt, skal der udtages prøver af fisk, der i en længere periode har været holdt ved temperaturer, ved hvilke virus udvikler sig, dvs. to til tre uger ved 15-26 °C. Følgende fremgangsmåde kan dog godtages:

a)

at indsamle en delpopulation ved overførslen fra vinterdamme til sommerdamme og holde fisken i samme vandmasse som sommerdammen, indtil den krævede minimumstemperatur er nået, eller

b)

at indsamle prøver ved høst eller i forbindelse med anden håndtering af fisk som led i almindelig driftspraksis. Om muligt indsamles prøverne mellem 24 og 72 timer efter sådan driftspraksis for at forbedre chancen for påvisning af KHV.

Hvis akvakulturbrug eller vildtlevende populationer skal være omfattet af sundhedsinspektioner eller prøveudtagninger mere end én gang om året, skal der være så lang tid som muligt mellem sundhedsinspektionerne eller prøveudtagningerne på den årstid, hvor vandtemperaturen forventes at være højest uden at overskride grænsen på 28 °C.

Alle produktionsenheder som f.eks. damme og tanke skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd.

Cyprinus carpio og hybrider heraf som f.eks. Cyprinus carpio × Carassius auratus skal indsamles, når de er til stede på bruget.

De fisk, der skal indsamles som prøver, udvælges på følgende måde:

i)

Hvis der forekommer svage fisk, fisk med unormal adfærd eller nyligt døde fisk (som ikke er gået i opløsning), skal disse udvælges.

ii)

Hvis der anvendes mere end én vandkilde til fiskeproduktion, skal der indgå fisk fra alle vandkilder i prøven.

iii)

De udvalgte fisk skal omfatte fisk, der er indsamlet på en sådan måde, at alle dele af akvakulturbruget og alle årgange er proportionalt repræsenteret i prøven.

I.2.   Særlige krav vedrørende opnåelse af status som sygdomsfri (kategori I) for så vidt angår KHVD

I.2.1.   Overvågningsprogrammer

a)

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori I, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment opfylder kravene vedrørende status som sygdomsfri i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til bilag V, del I, punkt 2, andet afsnit, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte del, har været omfattet af et af følgende overvågningsprogrammer:

i)

Model A — toårigt overvågningsprogram:

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 2.A i afsnit III.

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for KHV, og enhver mistanke om KHVD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2.

ii)

Model B — fireårigt overvågningsprogram med reduceret prøvestørrelse:

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst fire på hinanden følgende år som fastsat i tabel 2.B i afsnit III.

I løbet af denne fireårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for KHV, og enhver mistanke om KHVD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2.

b)

Hvis det i forbindelse med gennemførelsen af det fireårige overvågningsprogram, jf. litra a), bekræftes, at der er infektion med KHV på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som beskrevet i punkt I.2.2, forudsat at bruget opfylder følgende betingelser:

i)

Det er et indlandsbrug, hvis sundhedsstatus vedrørende KHVD er uafhængig af sundhedsstatussen for populationer af akvatiske dyr i de omkringliggende naturlige vandområder for så vidt angår denne listeopførte sygdom, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF.

ii)

Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

iii)

Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD.

I.2.2.   Udryddelsesprogrammer

I.2.2.1.   Generelle krav

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af mindst følgende udryddelsesprogram:

a)

De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med KHV.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af KHVD til opdrættede og vildtlevende fisk som f.eks.: antal, procentdel og fordeling af døde fisk på det akvakulturbrug, der er inficeret med KHV, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med KHV, og den skal svare til hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med KHV; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af KHVD.

ii)

Der skal oprettes en overvågningszone uden om beskyttelseszonen, og den skal svare til et udvidet område uden om den oprettede beskyttelseszone.

b)

På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med KHV, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer:

i)

indsamling af prøver med henblik på undersøgelse af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på KHVD, eller 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund

ii)

én sundhedsinspektion; på de akvakulturbrug, hvor de i punkt III.2 omhandlede test har givet negativt resultat; der skal fortsat foretages sundhedsinspektioner én gang om måneden på den årstid, hvor vandtemperaturen forventes at nå > 15 °C, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).

c)

Alle akvakulturbrug, der officielt er erklæret inficeret med KHV, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Når alle akvakulturbrug, der officielt er erklæret inficeret, inden for samme beskyttelseszone er blevet tømt, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet.

Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe brugene skal udtages af drift.

d)

På alle akvakulturbrug, der officielt er erklæret inficeret med KHV, og på alle andre akvakulturbrug, der er udtaget af drift, inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af fisk:

i)

ske med fisk fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD eller

ii)

i en overgangsperiode indtil 31. december 2020 ske med fisk fra medlemsstater, zoner eller segmenter med et godkendt KHVD-overvågningsprogram.

Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret med KHV, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).

e)

Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af mindst det overvågningsprogram, der er fastsat i punkt I.2.1.

I.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for KHVD

Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår KHVD, og hvis sundhedsstatus for så vidt angår KHVD er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I for så vidt angår KHVD, umiddelbart efter at den kompetente myndighed har bekræftet, at det opfylder følgende betingelser:

a)

Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

b)

Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I eller segmenter med et godkendt KHVD-overvågningsprogram (sundhedsstatus i kategori II).

I.3.   Særlige krav vedrørende opretholdelse af en sundhedsstatus i kategori I for så vidt angår KHVD

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 2.B i afsnit III i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af KHV.

For segmenter med en sundhedsstatus i kategori I for så vidt angår KHVD, som er beliggende i indlandsområder og omfatter et eller flere akvakulturbrug, og hvis sundhedsstatus for så vidt angår KHVD er afhængig af sundhedsstatussen for denne listeopførte sygdom i de omkringliggende naturlige vandområder, jf. del II, punkt 2, i bilag V til direktiv 2006/88/EF, skal hyppigheden af sundhedsinspektioner svare til det antal, der er anført for risikoniveauet højt i tabel 2.C.

I medlemsstater, zoner eller segmenter, i hvilke der er et begrænset antal akvakulturbrug, og hvor målrettet overvågning på disse akvakulturbrug ikke giver tilstrækkelige epidemiologiske data, skal overvågningsordningerne med henblik på opretholdelse af status som sygdomsfri omfatte prøveudtagningssteder udvalgt i overensstemmelse med kravene i punkt I.1.

Disse prøveudtagningssteder skal underkastes inspektioner og prøveudtagninger efter en rotationsordning (50 % af prøveudtagningsstederne pr. år). Prøveudtagningen skal foretages i overensstemmelse med tabel 2.C. i afsnit III. Prøverne skal udvælges, præpareres og undersøges som beskrevet i afsnit II, og laboratorieundersøgelserne skal give negative resultater med hensyn til forekomst af KHVD-agens.

Statussen som sygdomsfri opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 giver negative resultater for KHVD, og enhver mistanke om KHVD er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt III.2.

I.4.   Særlige krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF, med henblik på at opnå en sundhedsstatus i kategori III for så vidt angår KHVD i medlemsstater, segmenter eller zoner, som har en sundhedsstatus i kategori V

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår KHVD, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal de berørte akvakulturbrug gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at KHV er udryddet i brugets miljø

b)

nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre akvakulturbrug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår KHVD

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).

II.   Diagnose- og prøveudtagningsmetoder i forbindelse med overvågning for at opnå og opretholde status som sygdomsfri for så vidt angår KHVD

II.1.   Prøver

Det vævsmateriale, der skal undersøges, skal bestå af dele af gæller og nyre. Organstykker fra højst to fisk kan udgøre en samleprøve.

II.2.   Diagnosemetoder i forbindelse med overvågning for at opnå og opretholde status som sygdomsfri for så vidt angår KHVD

Diagnosemetoden med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår KHVD skal være realtids-PCR (qPCR) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 2, punkt II.

III.   Diagnose- og prøveudtagningsmetoder i forbindelse med officielle undersøgelser med henblik på at bekræfte eller udelukke mistanke om KHVD

III.1.   Prøver

Det vævsmateriale, der skal undersøges, skal bestå af dele af gæller og nyre. Organstykker fra højst to fisk kan udgøre en samleprøve.

III.2.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke og bekræfte forekomst af infektion med KHV

Hvis mistanke om forekomst af KHVD skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:

a)

Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med KHV, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af diagnosemetoden i litra b) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 2, punkt II.

b)

Forekomst af infektion med KHV betragtes som bekræftet, hvis KHV påvises ved PCR;

mistanke om forekomst af KHVD kan udelukkes, hvis denne undersøgelse ikke afslører yderligere tegn på forekomst af KHV.

Tabel 2.A

Overvågningsordning for zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår KHVD, jf. punkt I.2.1

 

 

Antal kliniske inspektioner pr. år (i to år)

Antal laboratorieundersøgelser pr. år (i to år)

Antal fisk i prøven

Akvakulturbrug/prøveudtagningssteder

De første to år i overvågningsperioden

2

2

75 (10)

 

Maksimalt antal fisk pr. samleprøve: 2


Tabel 2.B

Overvågningsordning for zoner og segmenter i den fireårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår KHVD, jf. punkt I.2.1

 

 

Antal kliniske inspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal fisk i prøven

Akvakulturbrug/prøveudtagningssteder

De første to år i overvågningsperioden

1

1

30

Akvakulturbrug/prøveudtagningssteder

De sidste to år i overvågningsperioden

2

2

30

 

Maksimalt antal fisk pr. samleprøve: 2


Tabel 2.C

Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår KHVD, jf. punkt I.3

Risikoniveau

Antal sundhedsinspektioner

Antal fisk i prøven

Højt

2 pr. år

30

Middel

1 pr. år

30

Lavt

1 hvert 2. år

30

Maksimalt antal fisk pr. samleprøve: 2


Tabel 2.D

Overvågningsordning med henblik på at opretholde status som sygdomsfri for så vidt angår KHVD i medlemsstater, zoner eller segmenter, hvor der er et begrænset antal akvakulturbrug, og hvor målrettet overvågning på disse brug ikke giver tilstrækkelige epidemiologiske data, jf. punkt I.3

 

Antal kliniske inspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal fisk i prøven

Prøveudtagningssteder

1 hvert 2. år

1 hvert 2. år

30

Maksimalt antal fisk pr. samleprøve: 2

DEL 3

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTIØS LAKSEANÆMI (ISA)

I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår ISA og foranstaltninger mod spredning af infektion med HPR-deleteret ISAV

I.1.   Generelle krav

Hvis der i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF skal foretages sundhedsinspektioner og prøveudtagninger på akvakulturbrug mere end én gang om året, skal der være så lang tid som muligt mellem sundhedsinspektionerne eller prøveudtagningerne.

Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningsstederne fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal ligeledes være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende modtagelige populationer.

Alle produktionsenheder som f.eks. damme og tanke skal underkastes sundhedsinspektioner for forekomst af døde og svage fisk eller fisk med unormal adfærd. Opmærksomheden skal navnlig rettes mod vandudledningsområdet, hvor de svage fisk har tendens til at samles på grund af vandstrømmen.

De fisk, der skal indsamles som prøver, udvælges på følgende måde:

a)

Kun døende eller nyligt døde fisk (som ikke er gået i opløsning) udvælges; navnlig fisk med tegn på anæmi, blødninger eller med andre kliniske tegn, der tyder på kredsløbsforstyrrelser, skal prioriteres i forbindelse med udvælgelsen.

b)

Hvis atlantisk laks er blandt de modtagelige arter på stedet, skal prøver fra atlantisk laks prioriteres. Hvis der ikke er atlantisk laks på akvakulturbruget, udtages prøver af andre modtagelige arter.

c)

Ved benyttelse af mere end én vandkilde til fiskeproduktion skal der medtages fisk fra alle vandkilder i prøven.

d)

De udvalgte fisk skal omfatte fisk, der indsamles på en sådan måde, at alle produktionsenheder som f.eks. netbure, tanke og damme og alle årgange er proportionalt repræsenteret i prøven.

I.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår ISA

I.2.1.   Overvågningsprogrammer

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår ISA, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i medlemsstaten, zonen eller segmentet opfylder de relevante krav i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktivet, prøveudtagningssteder i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte punkt, har været omfattet af følgende overvågningsprogram:

a)

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 3.A i afsnit II.

b)

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for HPR-deleteret ISAV, og enhver mistanke om ISA skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

c)

Hvis det i forbindelse med gennemførelsen af overvågningsprogrammet bekræftes, at der er ISA på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og dets sundhedsstatus i kategori II derfor er blevet trukket tilbage, skal der være blevet gennemført et udryddelsesprogram i overensstemmelse med punkt I.2.2.

I.2.2.   Udryddelsesprogrammer

I.2.2.1.   Generelle krav

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår ISA, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af et udryddelsesprogram, der opfylder følgende litra a)-e):

a)

De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af ISA til opdrættede eller vildtlevende fisk som f.eks.: antal, procentdel og fordeling af døde fisk på det akvakulturbrug, der er inficeret med HPR-deleteret ISAV eller bekræftet ISA, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, nærhed til slagterier, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav for så vidt angår disse zoners geografiske afgrænsning:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med ISA, og den skal svare til:

1)

i kystområder: et område i en cirkel med en radius, der mindst svarer til én tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum på det akvakulturbrug, der officielt er erklæret inficeret med ISA, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data

2)

i områder inde i landet: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med ISA; den kompetente myndighed kan begrænse zonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af ISA.

ii)

Der skal oprettes en overvågningszone uden om beskyttelseszonen, og den skal svare til:

1)

i kystområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller

2)

i områder inde i landet: et udvidet område uden om den oprettede beskyttelseszone.

b)

På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med ISA, skal der foretages en officiel undersøgelse, der mindst omfatter følgende elementer:

i)

indsamling af prøver med henblik på undersøgelse af mindst 10 døende fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på ISA, eller mindst 30 fisk, hvis der ikke konstateres kliniske tegn eller obduktionsfund.

ii)

én sundhedsinspektion; på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater, skal der fortsat foretages sundhedsinspektioner én gang om måneden, indtil beskyttelseszonen ophæves i overensstemmelse med punkt I.2.2.1, litra c).

c)

Alle akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA, skal tømmes, rengøres, desinficeres og udtages af drift i mindst tre måneder. Beskyttelses- og overvågningszonerne kan ophæves, når alle akvakulturbrug i beskyttelseszonen er tømt, rengjort og desinficeret og derpå samtidigt har været udtaget af drift i mindst seks uger.

Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse akvakulturbrug skal være udtaget af drift.

d)

På alle akvakulturbrug, der officielt er erklæret inficeret med HPR-deleteret ISAV eller bekræftet ISA, og på alle andre akvakulturbrug, der er udtaget af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af fisk ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår ISA.

Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).

e)

Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder i overensstemmelse med punkt I.1 skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1.

I.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for indlandssegmenter, der omfatter et enkelt akvakulturbrug, som tidligere har haft en sundhedsstatus i kategori I

Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår ISA, og hvis sundhedsstatus er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i overensstemmelse med artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at det opfylder følgende betingelser:

a)

Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

b)

Nytilførslen af fisk er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår ISA.

I.3.   Minimumsbekæmpelsesforanstaltninger for opretholdelse af en sundhedsstatus i kategori I for så vidt angår ISA

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 3.B (11) i afsnit II i denne del, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af ISA.

Ved fastlæggelsen af hyppigheden af sundhedsinspektioner for segmenter med en sundhedsstatus i kategori I for så vidt angår ISA, som er placeret i indlandsområder, og hvis sundhedsstatus for så vidt angår ISA er afhængig af sundhedsstatussen i de omkringliggende naturlige vandområder, der huser atlantisk laks (Salmo salar), anses risikoen for indslæbning af ISA for at være høj.

Statussen som sygdomsfri for så vidt angår ISA opretholdes kun, så længe alle prøver undersøgt ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for HPR-deleteret ISAV, og enhver mistanke om ISA er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

I.4.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori III for så vidt angår HPR-deleteret ISAV i medlemsstater, zoner eller segmenter, der hidtil har haft en sundhedsstatus i kategori V

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår ISA, kan opnå en sundhedsstatus i kategori III, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at ISAV er udryddet i brugets miljø

b)

nytilførslen af fisk på alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre brug, der er udtaget af drift eller har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår ISA

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a)

d)

der ikke har været bekræftet HPR-deleteret ISAV i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.

II.   Diagnosemetoder og officielle undersøgelser

II.1.   Prøver

Følgende vævsmateriale undersøges:

a)

histologi: hovednyre, lever, hjerte, bygspytkirtel, tarm, milt og gæller

b)

immunhistokemi: mellemnyre og hjerte inklusive hjerteklapper og bulbus arteriosus

c)

RT-qPCR-analyse: mellemnyre og hjerte

d)

viruskultur: mellemnyre, hjerte, lever og milt.

Organstykker fra højst fem fisk kan udgøre en samleprøve.

II.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår ISA

De diagnosemetoder, der skal anvendes for at opnå eller opretholde status som sygdomsfri for så vidt angår ISA i overensstemmelse med punkt I.2 og I.3, er RT-qPCR efterfulgt af sekventering af positive prøver i overensstemmelse med de detaljerede metoder og procedurer i bilag II, del 3.

I tilfælde af et positivt resultat af RT-qPCR skal yderligere prøver undersøges før gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF.

Disse prøver skal undersøges som følger i overensstemmelse med de detaljerede metoder og procedurer, der er fastsat i bilag II, del 3:

a)

screening af prøverne ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR

og

b)

undersøgelse i vævspræparater ved hjælp af specifikke antistoffer mod ISAV (dvs. IHC på fikserede snit eller IFAT på vævsaftryk) eller

c)

isolation og identifikation af ISAV i cellekultur fra mindst én prøve af en hvilken som helst fisk på bruget.

II.3.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke eller bekræfte forekomst af ISA

Når mistanke om forekomst af ISA skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:

a)

Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 døende fisk, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på ISA. Hvis der ikke konstateres kliniske tegn eller obduktionsfund, der tyder på ISA, skal sundhedsinspektionen følges af målrettet prøveudtagning af mindst 30 døende fisk eller nyligt døde fisk med normal konstitution i overensstemmelse med punkt I.1. Prøverne undersøges i overensstemmelse med diagnosemetoderne i litra b).

b)

I tilfælde af et positivt resultat af RT-qPCR for HPR-deleteret ISAV skal yderligere prøver undersøges før gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF. Mistanke om infektion med ISA skal bekræftes i overensstemmelse med følgende kriterier ved hjælp af de detaljerede metoder og procedurer, der er fastsat i bilag II, del 3:

i)

påvisning af ISAV ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR, og påvisning af ISAV i vævspræparater ved hjælp af specifikke antistoffer mod ISAV (dvs. IHC på fikserede snit eller IFAT på vævsaftryk)

eller

ii)

påvisning af ISAV ved hjælp af RT-qPCR, herunder sekventering af HE-genet for at fastslå deletioner i HPR, og

isolation og identifikation af ISAV i cellekultur fra mindst én prøve af en hvilken som helst fisk på bruget.

c)

Hvis der konstateres kliniske, tydelige patologiske forandringer eller histopatologiske fund, der tyder på ISA, skal fundene bekræftes ved viruspåvisning ved hjælp af to diagnosemetoder med selvstændige påvisningsprincipper, f.eks. RT-qPCR og IHC, i overensstemmelse med bilag II, del 3.

Mistanke om ISA kan udelukkes, hvis undersøgelser og inspektioner i en periode på 12 måneder fra datoen for mistanken ikke afslører yderligere tegn på forekomst af ISA.

Tabel 3.A

Overvågningsordning for zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår ISA, jf. punkt I.2.1

Overvågningsår

Antal sundhedsinspektioner pr. år (i to år)

Antal laboratorieundersøgelser pr. år (i to år)

Antal fisk til prøveudtagning pr. år

År 1

6

2 (12)

2 * 75 (13)

År 2

6

2 (12)

2 * 75 (13)


Tabel 3.B

Overvågningsordning for zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår ISA, jf. punkt I.3  (15)

Risikoniveau

Antal sundhedsinspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal fisk til prøveudtagning pr. år

Højt

2

2 (14)

2 * 30

Middel

1

1 (14)

30

Lavt

1 hvert 2. år

1 hvert 2. år

30 hvert 2. år

DEL 4

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTION MED MARTEILIA REFRINGENS

I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringens

I.1.   Generelle krav

Sundhedsinspektioner og, hvis det er relevant, prøveudtagning til laboratorieundersøgelse skal foretages på den tid af året, hvor forekomsten af parasitten i medlemsstaten, zonen eller segmentet vides at være størst. Foreligger der ingen sådanne data, skal prøveudtagningen foretages, lige efter at vandtemperaturen har oversteget 17 °C.

Hvis der skal udtages prøver af bløddyr i overensstemmelse med del 4, finder følgende kriterier anvendelse:

a)

Hvis Ostrea spp. og Mytilus spp. forekommer i produktionsenhederne eller produktionsområdet, skal de to slægter være ligeligt repræsenteret i prøverne. Hvis der kun forekommer en af disse slægter, udtages der prøver af denne slægt. Hvis hverken Ostrea- eller Mytilus-slægten forekommer, skal prøven være repræsentativ for alle andre modtagelige arter på stedet.

b)

Hvis der forekommer svage bløddyr, bløddyr med åbne skaller eller nyligt døde bløddyr (som ikke er gået i opløsning) i produktionsenhederne, udvælges først og fremmest disse bløddyr. Forekommer der ikke sådanne bløddyr, udvælges de ældste sunde bløddyr.

c)

Ved udtagning af prøver i akvakulturbrug med opdræt af bløddyr, hvor der anvendes mere end én vandkilde til produktion af bløddyr, skal der indgå bløddyr fra alle vandkilder i prøven, således at alle dele af bruget er proportionalt repræsenteret i prøven.

d)

Ved udtagning af prøver fra områder med opdræt af bløddyr skal prøven omfatte bløddyr fra et tilstrækkeligt antal prøveudtagningssteder, således at alle dele af området med opdræt af bløddyr er proportionalt repræsenteret i prøven. De vigtigste faktorer, der skal tages i betragtning ved udvælgelsen af disse prøveudtagningssteder, er prøveudtagningssteder, hvor der tidligere er blevet påvist Marteilia refringens, populationstæthed, vandstrømme, forekomst af modtagelige arter, forekomst af vektorarter, vanddybde og driftspraksis. Naturlige voksesteder skal indgå i prøveudtagningen.

I.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår Marteilia refringens

I.2.1.   Overvågningsprogrammer

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende overvågningsprogram, der inkluderer sundhedsinspektioner og indsamling af prøver til analyse.

Toårigt overvågningsprogram:

a)

Akvakulturbrugene eller områderne med opdræt af bløddyr skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 4.A i afsnit II.

b)

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for Marteilia refringens, og enhver mistanke om Marteilia refringens skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

c)

Hvis Ostrea edulis, Mytilus edulis eller Mytilus galloprovincialis fra en medlemsstat, en zone eller et segment med en sundhedsstatus i kategori I skal medtages i prøven, skal de være blevet tilført til akvakulturbruget eller området med opdræt af bløddyr senest det forår, der går lige forud for den periode, hvor overvågningsprogrammet gennemføres.

I.2.2.   Udryddelsesprogrammer

I de fleste tilfælde anses det for umuligt at udrydde Marteilia refringens, men hvis medlemsstaten vurderer, at det kan lade sig gøre, skal følgende model for et udryddelsesprogram anvendes.

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i denne medlemsstat, denne zone eller dette segment har været omfattet af mindst følgende udryddelsesprogram:

a)

De foranstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug eller det eller de områder med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af Marteilia refringens, som f.eks.: antal, alder, procentdel og fordeling af døde bløddyr på det akvakulturbrug eller i det område med opdræt af bløddyr, der er inficeret med Marteilia refringens, herunder vildtlevende bløddyr, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, herunder vildtlevende bløddyr, nærhed til forarbejdningsvirksomheder, kontaktbrug eller kontaktområder med opdræt af bløddyr, de arter, navnlig modtagelige arter og vektorarter, der findes på akvakulturbrugene eller i områderne med opdræt af bløddyr, opdrætspraksis på/i de berørte og nærmestliggende akvakulturbrug og områder med opdræt af bløddyr, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug eller et område med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens, og denne beskyttelseszone skal svare til et område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.

ii)

Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til et område omkring beskyttelseszonen fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.

b)

På alle akvakulturbrug og i alle områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF i beskyttelseszonen, og som ikke officielt er erklæret inficeret med Marteilia refringens, skal der foretages en officiel undersøgelse, der mindst omfatter indsamling af prøver med henblik på undersøgelse af 150 bløddyr efter begyndelsen af overførselsperioden for Marteilia refringens. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes i perioden, efter at vandtemperaturen overstiger 17 °C.

c)

Alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret med Marteilia refringens, skal tømmes, udtages af drift og, hvis muligt, rengøres og desinficeres.

De skal være udtaget af drift i mindst:

i)

to måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med begrænset kontakt til de omkringliggende vandområder, f.eks. klæknings- og yngelanlæg

ii)

to måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med ubegrænset kontakt til de omkringliggende vandområder, forudsat at de inficerede bløddyr af modtagelige arter og bløddyrene af modtagelige arter med epidemiologiske forbindelser til det inficerede akvakulturbrug eller område med opdræt af bløddyr er høstet eller fjernet inden den periode af året, hvor forekomsten af Marteilia refringens vides at være størst, eller, hvis denne ikke kendes, inden den periode, hvor vandtemperaturen overstiger 17 °C

iii)

fjorten måneder i tilfælde af akvakulturbrug og områder med opdræt af bløddyr med ubegrænset kontakt til de omkringliggende vandområder, forudsat at de inficerede bløddyr af modtagelige arter og bløddyrene af modtagelige arter med epidemiologiske forbindelser til det inficerede akvakulturbrug eller område med opdræt af bløddyr ikke er høstet eller fjernet inden den periode af året, hvor forekomsten af Marteilia refringens vides at være størst, eller, hvis sådanne data ikke kendes, hvis bløddyr af modtagelige arter ikke er blevet høstet eller fjernet inden den periode, hvor vandtemperaturen overstiger 17 °C.

Når alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst fire uger.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug eller områder med opdræt af bløddyr, alt efter hvad der er relevant, inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug eller områder skal være udtaget af drift.

d)

På alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er taget ud af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af bløddyr ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår infektion med Marteilia refringens.

Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, har været tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2, litra c).

e)

Alle akvakulturbrug og områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, skal efterfølgende være omfattet af den overvågningsordning, der er fastsat i punkt I.2.1 i denne del.

I.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår infektion med Marteilia refringens

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med tabel 4.B i afsnit II, idet der tages hensyn til risikoniveauet for akvakulturbruget eller området med opdræt af bløddyr med hensyn til indslæbning af Marteilia refringens.

Statussen som sygdomsfri kan kun opretholdes, så længe alle prøver ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for Marteilia refringens, og enhver mistanke om Marteilia refringens er udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

I.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med Marteilia refringens

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår infektion med Marteilia refringens, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at Marteilia refringens er udryddet i brugets miljø

b)

nytilførslen af fisk på alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), inden for de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår infektion med Marteilia refringens

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift eller gjort til genstand for alternative foranstaltninger i henhold til litra a)

d)

der ikke har været bekræftet infektion med Marteilia refringens i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.

II.   Diagnosemetoder og officielle undersøgelser

II.1.   Prøver

Hele dyret skal indsendes til laboratoriet med henblik på udførelse af de diagnostiske test i punkt II.2 og II.3.

II.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringens

De diagnosemetoder, der skal anvendes for at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Marteilia refringens i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 4, er histopatologi, vævsaftryk eller PCR.

II.3.   Officielle undersøgelser og diagnosemetoder med henblik på at bekræfte forekomst af eller udelukke mistanke om infektion med Marteilia refringens

Hvis mistanke om forekomst af infektion med Marteilia refringens skal bekræftes eller udelukkes i henhold til artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:

a)

Den officielle undersøgelse skal omfatte mindst én prøveudtagning af 30 bløddyr af modtagelige arter, hvis mistanken bygger på en rapport om dødelighed, eller, hvis dette ikke er tilfældet, 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Marteilia refringens. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes i perioden, efter at vandtemperaturen overstiger 17 °C.

b)

Prøverne undersøges ved hjælp af diagnosemetoderne i nr. i) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 4, afsnit I:

i)

Forekomst af Marteilia refringens anses for bekræftet, hvis et positivt resultat opnået ved histopatologi, vævsaftryk eller in situ-hybridisering er kombineret med et positivt resultat opnået ved PCR efterfulgt af sekventering.

ii)

Mistanke om infektion med Marteilia refringens kan udelukkes, hvis de undersøgelser, der er omhandlet i nr. i), ikke afslører yderligere tegn på forekomst af Marteilia refringens.

Tabel 4.A

Overvågningsordning for medlemsstater, zoner eller segmenter i kontrolperioden forud for opnåelse af status som sygdomsfri for så vidt angår Marteilia refringens, jf. punkt I.2.1

 

Antal sundhedsinspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal bløddyr i prøven

Akvakulturbrug/områder med opdræt af bløddyr

1

1

150


Tabel 4.B

Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår Marteilia refringens, jf. punkt I.3

Risikoniveau

Antal sundhedsinspektioner

Antal laboratorieundersøgelser

Antal bløddyr i prøven

Højt

1 pr. år

1 hvert 2. år

150

Middel

1 hvert 2. år

1 hvert 2. år

150

Lavt

1 hvert 2. år

1 hvert 4. år

150

DEL 5

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR INFEKTION MED BONAMIA OSTREAE

I.   Krav til overvågnings- eller udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreae

I.1.   Generelle krav

Sundhedsinspektioner og, hvis det er relevant, prøveudtagning på produktionsenheder skal foretages på den tid af året, hvor forekomsten af Bonamia ostreae i medlemsstaten, zonen eller segmentet vides at være størst. Foreligger der ingen sådanne data, skal prøveudtagningen foretages om vinteren eller først på foråret.

Hvis der skal udtages prøver af bløddyr i overensstemmelse med del 5, finder følgende kriterier anvendelse:

a)

Hvis der produceres Ostrea edulis, udtages der en prøve bestående udelukkende af østers af denne art. Hvis der ikke forekommer Ostrea edulis, skal prøven være repræsentativ for alle andre modtagelige arter på stedet.

b)

Hvis der forekommer svage bløddyr, bløddyr med åbne skaller eller nyligt døde bløddyr (som ikke er gået i opløsning), udvælges først og fremmest disse bløddyr. Forekommer der ikke sådanne bløddyr, udvælges de ældste sunde bløddyr.

c)

Ved udtagning af prøver i akvakulturbrug, hvor der anvendes mere end én vandkilde til produktion af bløddyr, skal der indgå bløddyr fra alle vandkilder i prøven, således at alle dele af bruget er proportionalt repræsenteret i prøven.

d)

Ved udtagning af prøver fra områder med opdræt af bløddyr skal prøven omfatte bløddyr fra et tilstrækkeligt antal prøveudtagningssteder. De vigtigste faktorer, der skal tages i betragtning ved udvælgelsen af disse prøveudtagningssteder, er steder, hvor der tidligere er blevet påvist Bonamia ostreae, populationstæthed, vandstrømme, forekomst af modtagelige arter, forekomst af vektorarter, vanddybde og driftspraksis. Naturlige voksesteder i eller i umiddelbar nærhed af områder med opdræt af bløddyr skal indgå i prøveudtagningen.

I.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår Bonamia ostreae

I.2.1.   Overvågningsprogrammer

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III for så vidt angår Bonamia ostreae, kan atter opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende overvågningsprogram, der omfatter sundhedsinspektioner og indsamling af prøver til analyse.

Toårigt overvågningsprogram:

a)

Akvakulturbrugene og områderne med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 5.A i denne del.

b)

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for Bonamia ostreae, og enhver mistanke om Bonamia ostreae skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

c)

Hvis Ostrea edulis fra en medlemsstat, en zone eller et segment med en sundhedsstatus i kategori I skal medtages i prøven, skal de være blevet tilført til akvakulturbruget eller området med opdræt af bløddyr senest det efterår, der går lige forud for den periode, hvor overvågningsprogrammet gennemføres.

I.2.2.   Udryddelsesprogrammer

I de fleste tilfælde anses det for umuligt at udrydde Bonamia ostreae, men hvis medlemsstaten vurderer, at det kan lade sig gøre, skal følgende model for et udryddelsesprogram anvendes:

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår Bonamia ostreae, kan atter opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, når alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende udryddelsesprogram:

a)

De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 3, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal navnlig være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug eller det eller de områder med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af denne listeopførte sygdom, som f.eks.: antal, procentdel, alder og fordeling af bløddyr på det akvakulturbrug eller i det område med opdræt af bløddyr, der er inficeret med Bonamia ostreae, herunder vildtlevende bløddyr, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, herunder vildtlevende bløddyr, nærhed til forarbejdningsvirksomheder, kontaktbrug eller kontaktområder med opdræt af bløddyr, de arter, navnlig modtagelige arter og vektorarter, der findes på akvakulturbrugene eller i områderne med opdræt af bløddyr, opdrætspraksis på/i de berørte og nærmestliggende akvakulturbrug eller områder med opdræt af bløddyr, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug eller et område med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae, og denne beskyttelseszone skal svare til et område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.

ii)

Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til et område omkring beskyttelseszonen fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data.

b)

På alle akvakulturbrug og i alle områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF i beskyttelseszonen, og som ikke officielt er erklæret inficeret med Bonamia ostreae, skal der foretages en officiel undersøgelse, der mindst omfatter indsamling af prøver med henblik på undersøgelse af 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Bonamia ostreae. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes om vinteren eller først på foråret.

c)

Alle akvakulturbrug og områder med opdræt af bløddyr, der officielt er erklæret inficeret med Bonamia ostreae, skal tømmes, udtages af drift og, hvis muligt, rengøres og desinficeres. Det skal være udtaget af drift i mindst seks måneder.

Når alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst fire uger.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug eller områder med opdræt af bløddyr, alt efter hvad der er relevant, inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug eller områder skal være udtaget af drift.

d)

På alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er taget ud af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af bløddyr ske fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår infektion med Bonamia ostreae. Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2, litra c).

e)

Alle akvakulturbrug og områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, skal efterfølgende være omfattet af det overvågningsprogram, der er fastsat i punkt I.2.

I.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår infektion med Bonamia ostreae

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal alle akvakulturbrug eller områder med opdræt af bløddyr, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment underkastes sundhedsinspektioner og prøveudtagning i overensstemmelse med i afsnit II, tabel 5.B, i denne del, idet der tages hensyn til risikoniveauet for akvakulturbruget eller området med opdræt af bløddyr med hensyn til indslæbning af infektion med Bonamia ostreae.

Statussen som sygdomsfri for så vidt angår Bonamia ostreae opretholdes kun, så længe alle prøver ved hjælp af diagnosemetoderne i punkt II.2 har givet negative resultater for Bonamia ostreae, og enhver mistanke om Bonamia ostreae er blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

I.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med Bonamia ostreae.

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår Bonamia ostreae, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at Bonamia ostreae er udryddet i brugets miljø

b)

nytilførslen af bløddyr på alle akvakulturbrug eller i alle områder med opdræt af bløddyr, der officielt er erklæret inficeret, og på alle andre akvakulturbrug eller i alle andre områder med opdræt af bløddyr, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), inden for de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår infektion med Bonamia ostreae

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug eller områder med opdræt af bløddyr, der officielt er erklæret inficeret, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a)

d)

der ikke har været bekræftet infektion med Bonamia ostreae i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), b) og c), og at mistanke i denne periode er blevet udelukket i overensstemmelse med de procedurer, der er fastsat i punkt II.3.

II.   Diagnosemetoder og diagnosekriterier

II.1.   Prøver

Hele dyret skal indsendes til laboratoriet med henblik på udførelse af de diagnostiske test i punkt II.2 og II.3.

II.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreae

De diagnosemetoder, der skal anvendes for opnå eller opretholde status som sygdomsfri for så vidt angår infektion med Bonamia ostreae, er histopatologi, vævsaftryk eller PCR. Ved anvendelsen af disse diagnosemetoder skal de detaljerede metoder og procedurer i bilag II, del 5, følges.

II.3.   Diagnosemetoder med henblik på at bekræfte forekomst af eller udelukke mistanke om infektion med Bonamia ostreae

Hvis mistanke om forekomst af infektion med Bonamia ostreae skal bekræftes eller udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedurer for inspektion, prøveudtagning og undersøgelse overholdes:

Den officielle undersøgelse skal omfatte mindst én prøveudtagning af 30 bløddyr af modtagelige arter, hvis mistanken bygger på en rapport om dødelighed, eller, hvis dette ikke er tilfældet, 150 bløddyr af modtagelige arter efter begyndelsen af overførselsperioden for Bonamia ostreae. Kendes overførselsperioden ikke, skal prøveudtagningen påbegyndes om vinteren eller først på foråret. Prøverne undersøges ved hjælp af diagnosemetoderne i nr. i) i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 5, afsnit I.

i)

Forekomst af Bonamia ostreae anses for bekræftet, hvis et positivt resultat opnået ved histopatologi, vævsaftryk eller in situ-hybridisering er kombineret med et positivt resultat opnået ved PCR efterfulgt af sekventering i overensstemmelse med de godkendte metoder og procedurer i bilag II, del 5.

ii)

En mistanke om forekomst af infektion med Bonamia ostreae anses for udelukket, hvis disse undersøgelser ikke afslører yderligere tegn på forekomst af Bonamia ostreae.

Tabel 5.A

Overvågningsordning for medlemsstater, zoner eller segmenter i kontrolperioden forud for opnåelse af status som sygdomsfri for så vidt angår Bonamia ostreae, jf. punkt I.2.1

 

Antal sundhedsinspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal bløddyr i prøven

Akvakulturbrug/områder med opdræt af bløddyr

1

1

150


Tabel 5.B

Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår Bonamia ostreae, jf. punkt I.3

Risikoniveau

Antal sundhedsinspektioner

Antal laboratorieundersøgelser

Antal bløddyr i prøven

Højt

1 pr. år

1 hvert 2. år

150

Middel

1 hvert 2. år

1 hvert 2. år

150

Lavt

1 hvert 2. år

1 hvert 4. år

150

DEL 6

OVERVÅGNING AF OG BEKÆMPELSESMETODER FOR WHITE SPOT DISEASE (WSD)

I.   Krav til overvågnings- og udryddelsesprogrammer med henblik på at opnå og opretholde status som sygdomsfri for så vidt angår WSD og foranstaltninger mod spredning af infektion med WSSV

I.1.   Generelle krav til inspektioner og prøveudtagning

Prøveudtagning af krebsdyr til laboratorieundersøgelse skal foretages, når vandtemperaturen forventes at være højest. Dette krav til vandtemperaturen gælder også for sundhedsinspektioner, hvor disse er gennemførlige og relevante.

Hvis der skal udtages prøver af opdrættede krebsdyr i overensstemmelse med denne del, finder følgende kriterier anvendelse:

a)

Hvis der forekommer svage eller døende krebsdyr i produktionsenhederne, udvælges først og fremmest disse krebsdyr. Forekommer der ikke sådanne krebsdyr, udvælges krebsdyr i forskellige størrelseskohorter, dvs. yngel og voksne krebsdyr, af de udvalgte modtagelige arter, som skal være proportionalt repræsenteret i prøven

b)

Hvis der anvendes mere end én vandkilde til krebsdyrproduktion, skal der indgå modtagelige krebsdyr fra alle vandkilder i prøven.

Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, skal antallet og den geografiske fordeling af prøveudtagningssteder fastsættes således, at der opnås en rimelig dækning af medlemsstaten, zonen eller segmentet. Prøveudtagningsstederne skal også være repræsentative for de forskellige økosystemer, hvor der findes vildtlevende populationer af modtagelige arter, dvs. hav-, udmundings-, flod- og søsystemer.

Hvis der kræves målrettet overvågning i vildtlevende populationer i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, udvælges krebsdyr til prøveudtagning på følgende måde:

i)

I områder med hav- og udmundingssystemer udvælges en eller flere af følgende arter: Carcinus maenas, Cancer pagurus, Eriocheir sinensis, Liocarcinus depurator, Liocarcinus puber, Crangon crangon, Homarus gammarus, Palaemon adspersus eller rejer af Penaeidae-familien, dvs. Penaeus japonicus, Penaeus kerathurus og Penaeus semisulcatus. Hvis disse arter ikke forekommer, skal prøven være repræsentativ for alle andre modtagelige arter af Decapoda-ordenen på stedet. I betragtning af det store antal forskellige modtagelige værtsarter kan værtsarter udvælges fra slægter eller familier af Decapoda-ordenen, såfremt modtagelighed er påvist eksperimentelt eller naturligt.

ii)

I flod- og søsystemer udvælges en eller flere af følgende arter: Pacifastacus leniusculus, Astacus leptodactylus, Austropotamobius pallipes eller Orconectes limosus. Hvis disse arter ikke forekommer, skal prøven være repræsentativ for andre modtagelige arter af Decapoda-ordenen på stedet. I betragtning af det store antal forskellige modtagelige værtsarter kan værtsarter udvælges fra slægter eller familier af Decapoda-ordenen, såfremt modtagelighed er påvist eksperimentelt eller naturligt.

iii)

Hvis der forekommer svage eller døende krebsdyr, udvælges først og fremmest disse krebsdyr. Forekommer der ikke sådanne krebsdyr, udvælges krebsdyr i forskellige størrelseskohorter, dvs. yngel og voksne krebsdyr, af de udvalgte modtagelige arter, som skal være proportionalt repræsenteret i prøven.

I.2.   Særlige krav vedrørende opnåelse af en sundhedsstatus i kategori I for så vidt angår WSD

I.2.1.   Overvågningsprogrammer

a)

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori III, jf. del B i bilag III til direktiv 2006/88/EF, for så vidt angår WSD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i medlemsstaten, zonen eller segmentet opfylder de relevante krav i bilag V til samme direktiv, og alle disse akvakulturbrug og, hvis det kræves i henhold til del I, punkt 2, andet afsnit, i bilag V til direktiv 2006/88/EF, prøveudtagningsstederne i vildtlevende populationer, der er udvalgt i overensstemmelse med nævnte punkt, har været omfattet af følgende toårige overvågningsprogram, der omfatter sundhedsinspektioner og indsamling af prøver til analyse.

Akvakulturbrugene eller prøveudtagningsstederne skal have været omfattet af sundhedsinspektioner og prøveudtagninger i mindst to på hinanden følgende år som fastsat i tabel 6.A i afsnit II.

I løbet af denne toårige periode skal undersøgelse af alle prøver ved hjælp af diagnosemetoderne i punkt II.2 have givet negative resultater for infektion med WSD, og enhver mistanke om WSD skal være blevet udelukket i overensstemmelse med diagnosemetoderne i punkt II.3.

b)

Hvis det i forbindelse med gennemførelsen af det overvågningsprogram, der er omhandlet i litra a), bekræftes, at der er infektion med WSSV på et akvakulturbrug, der er omfattet af overvågningsprogrammet, og brugets sundhedsstatus i kategori II derfor er blevet trukket tilbage, kan dette akvakulturbrug straks generhverve sin sundhedsstatus i kategori II og fortsætte gennemførelsen af overvågningsprogrammet med henblik på at opnå status som sygdomsfri uden at gennemføre et udryddelsesprogram som fastsat i punkt I.2.2, forudsat at bruget opfylder følgende betingelser:

i)

Det er et indlandsbrug, hvis sundhedsstatus vedrørende WSD er uafhængig af sundhedsstatussen i de omkringliggende naturlige vandområder for så vidt angår denne listeopførte sygdom i overensstemmelse med del II, punkt 3, i bilag V til direktiv 2006/88/EF.

ii)

Det er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

iii)

Nytilførslen af krebsdyr er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD.

I.2.2.   Udryddelsesprogrammer

I.2.2.1.   Generelle krav

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår WSD, kan opnå en sundhedsstatus i kategori I for så vidt angår denne listeopførte sygdom, hvis alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i medlemsstaten, zonen eller segmentet har været omfattet af mindst følgende udryddelsesprogram:

a)

De minimumsbekæmpelsesforanstaltninger, der er fastsat i kapitel V, afdeling 4, i direktiv 2006/88/EF, skal være blevet effektivt anvendt, og der skal være blevet oprettet en afspærringszone, jf. artikel 32, litra b), i samme direktiv, som omfatter en beskyttelseszone og en overvågningszone, i nærheden af det eller de akvakulturbrug, der officielt er erklæret inficeret med WSD.

Afspærringszonen skal være blevet fastlagt fra sag til sag under hensyntagen til faktorer, der påvirker risiciene for spredning af WSD til opdrættede og vildtlevende krebsdyr som f.eks.: antal, procentdel og fordeling af døde krebsdyr på det akvakulturbrug, der er inficeret med WSD, afstanden til og tætheden mellem de nærmestliggende akvakulturbrug, kontaktbrug, arter på akvakulturbrugene, opdrætspraksis på de berørte og på de nærmestliggende akvakulturbrug, de hydrodynamiske betingelser og andre faktorer af epidemiologisk signifikans.

Ved oprettelsen af beskyttelses- og overvågningszonerne gælder følgende minimumskrav:

i)

Der skal oprettes en beskyttelseszone i umiddelbar nærhed af et akvakulturbrug, der officielt er erklæret inficeret med WSD, og den skal svare til:

1)

i hav- og udmundingsområder: et område i en cirkel med en radius, der mindst svarer til en tidevandsbevægelse eller mindst er på 5 km, alt efter hvad der er størst, med centrum i det akvakulturbrug, der officielt er erklæret inficeret med WSD, eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller

2)

i ferskvand: hele afvandingsområdet for det akvakulturbrug, der officielt er erklæret inficeret med WSD; den kompetente myndighed kan begrænse beskyttelseszonens udstrækning til dele af afvandingsområdet, forudsat at dette ikke forringer forebyggelsen af spredningen af WSD.

ii)

Der skal oprettes en overvågningszone uden om beskyttelseszonen, som skal svare til:

1)

i havområder: et område omkring beskyttelseszonen omfattende overlappende tidevandsudbredelser eller et område i en cirkel omkring beskyttelseszonen med en radius på 10 km fra beskyttelseszonens centrum eller et tilsvarende område fastlagt på grundlag af passende hydrodynamiske eller epidemiologiske data eller

2)

i ferskvand: et udvidet område uden om den oprettede beskyttelseszone.

b)

På alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF inden for beskyttelseszonen, og som ikke officielt er erklæret inficeret med WSD, skal der foretages en officiel undersøgelse, der mindst omfatter følgende:

i)

indsamling af prøver med henblik på undersøgelse af 10 krebsdyr, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion på WSD, eller 150 krebsdyr, hvis der ikke konstateres kliniske tegn eller obduktionsfund, og

ii)

én sundhedsinspektion; på de akvakulturbrug, hvor de undersøgelser, der er omhandlet i nr. i), har givet negative resultater, skal der fortsat foretages sundhedsinspektioner én gang om måneden på den årstid, hvor vandtemperaturen forventes at være højest, indtil beskyttelseszonen er blevet ophævet i overensstemmelse med punkt I.2.2.1, litra c).

c)

Alle akvakulturbrug, der officielt er erklæret inficeret med WSD, skal tømmes, rengøres, desinficeres og udtages af drift. De skal være udtaget af drift i mindst seks uger. Når alle akvakulturbrug, der officielt er erklæret inficeret, er tømt, skal de være udtaget af drift samtidigt i mindst tre uger. Dette afsnit finder også anvendelse på nye akvakulturbrug, der officielt erklæres inficeret i forbindelse med gennemførelsen af udryddelsesprogrammet.

Når de akvakulturbrug, der officielt er erklæret inficeret, udtages af drift, skal beskyttelseszonerne omdannes til overvågningszoner.

Den kompetente myndighed kan beslutte, at andre akvakulturbrug inden for de oprettede beskyttelses- og overvågningszoner skal tømmes, rengøres, desinficeres og udtages af drift. På grundlag af en risikoanalyse i hvert enkelt tilfælde afgør den kompetente myndighed, hvor længe disse brug skal være udtaget af drift.

d)

På alle akvakulturbrug, der officielt er erklæret inficeret, og på alle andre akvakulturbrug, der er udtaget af drift inden for de oprettede beskyttelses- og overvågningszoner, skal nytilførslen af krebsdyr:

i)

ske med krebsdyr fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD eller

ii)

i en overgangsperiode indtil 31. december 2020 ske med krebsdyr fra medlemsstater, zoner eller segmenter med et godkendt WSD-overvågningsprogram.

Nytilførslen må først finde sted, når alle akvakulturbrug, der officielt er erklæret inficeret med WSD, er blevet tømt, rengjort, desinficeret og udtaget af drift i overensstemmelse med punkt I.2.2.1, litra c).

e)

Alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til direktiv 2006/88/EF, i den medlemsstat, den zone eller det segment, der er omfattet af udryddelsesprogrammet, og, hvis der kræves overvågning i vildtlevende populationer, prøveudtagningssteder udvalgt i overensstemmelse med del I, punkt 2, andet afsnit, i bilag V til samme direktiv skal efterfølgende være omfattet af mindst det program, der er fastsat i punkt I.2.1.

I.2.2.2.   Krav vedrørende generhvervelse af status som sygdomsfri for så vidt angår WSD for indlandssegmenter, der omfatter et enkelt akvakulturbrug, der tidligere officielt har været erklæret frit for WSD

Et indlandssegment, der omfatter et enkelt akvakulturbrug, som har en sundhedsstatus i kategori I for så vidt angår WSD, og hvis sundhedsstatus for så vidt angår denne listeopførte sygdom er uafhængig af de omkringliggende naturlige vandområder, jf. del II, punkt 3, i bilag V til direktiv 2006/88/EF, og hvis sundhedsstatus i kategori I er blevet trukket tilbage i henhold til artikel 53, stk. 3, i samme direktiv, kan generhverve sin sundhedsstatus i kategori I, umiddelbart efter at den kompetente myndighed har bekræftet, at bruget har opfyldt følgende betingelser:

a)

Akvakulturbruget med WSD er blevet tømt, rengjort, desinficeret og udtaget af drift; det har været udtaget af drift i mindst seks uger.

b)

Nytilførslen af krebsdyr på akvakulturbruget med WSD er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I for så vidt angår WSD.

I.3.   Særlige krav vedrørende opretholdelse af status som sygdomsfri (kategori I) for så vidt angår WSD

Hvis der kræves målrettet overvågning for at opretholde en sundhedsstatus i kategori I, jf. artikel 52 i direktiv 2006/88/EF, skal der på alle akvakulturbrug, der holder modtagelige arter opført i del II i bilag IV til samme direktiv, i den/det berørte medlemsstat, zone eller segment foretages en sundhedsinspektion og udtages prøver i overensstemmelse med tabel 6.B i afsnit II, idet der tages hensyn til brugets risikoniveau med hensyn til indslæbning af WSD.

I medlemsstater, zoner eller segmenter, i hvilke der er et begrænset antal akvakulturbrug, og målrettet overvågning på disse akvakulturbrug ikke giver tilstrækkelige epidemiologiske data, skal overvågningsprogrammerne med henblik på opretholdelse af status som sygdomsfri omfatte prøveudtagningssteder udvalgt i overensstemmelse med kravene i punkt I.1.

Disse prøveudtagningssteder skal underkastes inspektioner og prøveudtagninger efter en rotationsordning (50 % af prøveudtagningsstederne pr. år). Prøveudtagningen skal foretages i overensstemmelse med tabel 6.B. i afsnit II. Prøverne skal udvælges, præpareres og undersøges i overensstemmelse med diagnose- og prøveudtagningsmetoderne i afsnit II, og laboratorieundersøgelserne skal have givet negative resultater med hensyn til WSD-agens.

Statussen som sygdomsfri opretholdes kun, så længe alle prøver ved hjælp af diagnose- og prøveudtagningsmetoderne i punkt II.2 giver negative resultater for WSD, og enhver mistanke om WSD er blevet udelukket i overensstemmelse med de officielle undersøgelses- og diagnosemetoder i punkt II.3.

I.4.   Krav vedrørende ophævelse af foranstaltninger mod spredning af sygdom, jf. artikel 39 i direktiv 2006/88/EF (ændring af sundhedsstatus fra kategori V til kategori III), for så vidt angår infektion med WSD

En medlemsstat, en zone eller et segment, der har en sundhedsstatus i kategori V for så vidt angår WSD, kan opnå en sundhedsstatus i kategori III for så vidt angår denne listeopførte sygdom, forudsat at:

a)

de krav, der er fastsat i punkt I.2.2.1, litra a), b) og c), er opfyldt. Hvis udtagning af drift ikke er teknisk mulig, skal akvakulturbrugene gøres til genstand for en alternativ foranstaltning, som giver næsten samme garanti for, at WSSV er udryddet i akvakulturbrugets miljø

b)

nytilførslen af krebsdyr på alle akvakulturbrug, der officielt er erklæret inficeret med WSD, og på alle andre brug, der er udtaget af drift/har været genstand for alternative foranstaltninger i henhold til litra a), i de oprettede beskyttelses- og overvågningszoner er sket fra medlemsstater, zoner eller segmenter med en sundhedsstatus i kategori I, II eller III for så vidt angår WSD

c)

nytilførslen først har fundet sted, efter at alle akvakulturbrug, der officielt er erklæret inficeret med WSD, er blevet tømt, rengjort, desinficeret og udtaget af drift/gjort til genstand for alternative foranstaltninger i henhold til litra a).

d)

der ikke har været påvist WSD i løbet af den toårige periode, der følger efter afslutningen af de foranstaltninger, der er omhandlet i litra a), og b), og at mistanke i denne periode er blevet udelukket i henhold til de procedurer, der er fastsat i punkt II.3.

II.   Diagnose- og prøveudtagningsmetoder

II.1.   Prøver

Prøver af integumentær epidermis, enten dissekeret eller indeholdt i det undersøgte dyrs gangben, pleopoder, munddele eller gæller, skal fikseres i 95 % ethanol inden præparation af prøverne til totrins-PCR.

Andre prøver, der er fikseret med henblik på histologi og transmissionselektronmikroskopi, kan indsamles til støtte for diagnostiske data fra PCR.

II.2.   Diagnosemetoder med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår WSD

Den diagnosemetode, der skal anvendes for opnå eller opretholde status som sygdomsfri for så vidt angår WSD i overensstemmelse med de detaljerede diagnosemetoder og -procedurer i bilag II, del 6, er totrins-PCR.

Hvis totrins-PCR giver et positivt resultat, skal resultatet bekræftes ved sekventering af amplikon inden gennemførelsen af de indledende bekæmpelsesforanstaltninger, jf. artikel 28 i direktiv 2006/88/EF, hvis det er praktisk muligt ved påvisning af patognomoniske tegn på WSD i de udvalgte modtagelige værter via histologi og transmissionselektronmikroskopi.

II.3.   Officielle undersøgelses- og diagnosemetoder med henblik på at udelukke mistanke om eller bekræfte forekomst af infektion med WSD

Hvis forekomst af infektion med WSD skal bekræftes eller mistanke om en sådan infektion udelukkes i overensstemmelse med artikel 28 i direktiv 2006/88/EF, skal følgende procedure for inspektion, prøveudtagning og undersøgelse overholdes:

a)

Den officielle undersøgelse skal omfatte mindst én sundhedsinspektion og én prøveudtagning af 10 krebsdyr, hvis der konstateres kliniske tegn eller obduktionsfund, der tyder på infektion med WSD, eller 150 krebsdyr, hvis der ikke konstateres kliniske tegn eller obduktionsfund. Prøverne undersøges ved hjælp af diagnosemetoderne i punkt II.2 (totrins-PCR).

b)

Forekomst af WSD anses for bekræftet, hvis totrins-PCR efterfulgt af sekventering i overensstemmelse med de detaljerede metoder og procedurer i bilag II, del 6, er positiv for WSSV, og hvis der forekommer patognomoniske tegn på WSD i de udvalgte værter.

Mistanke om forekomst af WSD kan udelukkes, hvis disse undersøgelser ikke afslører yderligere tegn på forekomst af WSD.

Tabel 6.A

Overvågningsordning for medlemsstater, zoner og segmenter i den toårige kontrolperiode forud for opnåelse af status som sygdomsfri for så vidt angår WSD, jf. punkt I.2.1

 

Antal kliniske inspektioner pr. år

Antal laboratorieundersøgelser pr. år

Antal krebsdyr i prøven

Akvakulturbrug/prøveudtagningssteder

1

1

150


Tabel 6.B

Overvågningsordning for medlemsstater, zoner eller segmenter med henblik på at opretholde status som sygdomsfri for så vidt angår WSD, jf. punkt I.3

Risikoniveau

Antal sundhedsinspektioner

Antal laboratorieundersøgelser

Antal krebsdyr i prøven

Højt

1 pr. år

1 hvert 2. år

150

Middel

1 hvert 2. år

1 hvert 2. år

150

Lavt

1 hvert 2. år

1 hvert 4. år

150


(1)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.

(2)  Ovarie- eller sædvæske fra gydebestande indsamles på modningstidspunktet i forbindelse med strygning.

(3)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 5 %.

(4)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.

(5)  Ovarie- eller sædvæske fra gydebestande indsamles på modningstidspunktet i forbindelse med strygning.

(6)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 10 %.

(7)  Prøverne skal udtages tidligst tre uger efter overførsel af fisk fra ferskvand til saltvand.

(8)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af VHSV eller IHNV med en konfidens på 95 % ved en udgangsprævalens på 10 %.

(9)  Hver sundhedsinspektion skal som minimum omfatte én prøve.

(10)  Der skal udtages prøver fra det antal fisk, der sikrer påvisning af KHV med en konfidens på 95 % ved en udgangsprævalens på 5 %.

(11)  Gælder ikke for akvakulturbrug, der kun opdrætter regnbueørred (Onchorhynchus mykiss) eller havørred (Salmo trutta) eller begge, og hvor vandforsyningen udelukkende er baseret på ferskvandskilder, der ikke huser atlantisk laks (Salmo salar).

(12)  Prøver skal indsamles og opbevares samt undersøges i løbet af to årlige undersøgelsesperioder af en måneds varighed hver (dvs. forår og efterår), eller når det er hensigtsmæssigt ud fra praktiske overvejelser.

(13)  Maksimalt antal fisk pr. samleprøve: 5.

(14)  Prøver skal indsamles og undersøges i løbet af to årlige undersøgelsesperioder af en måneds varighed hver (dvs. forår og efterår), eller når det er hensigtsmæssigt ud fra praktiske overvejelser.

(15)  Gælder ikke for akvakulturbrug, der kun opdrætter regnbueørred (Onchorhynchus mykiss) eller havørred (Salmo trutta) eller begge, og hvor vandforsyningen udelukkende er baseret på ferskvandskilder, der ikke huser atlantisk laks (Salmo salar).


BILAG II

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER

I.   Indledning

I dette bilag fastsættes der detaljerede procedurer for de diagnosemetoder, der skal anvendes i forbindelse med laboratorieundersøgelserne i de udryddelses- og overvågningsprogrammer, der er fastsat i bilag I til denne afgørelse, for at bekræfte eller udelukke mistanke om forekomst af følgende ikke-eksotiske sygdomme, der er opført i del II i bilag IV til direktiv 2006/88/EF (»listeopførte sygdomme«), i overensstemmelse med artikel 57, litra b), i samme direktiv:

1.

Viral hæmoragisk septikæmi (VHS)

Del 1

2.

Infektiøs hæmatopoietisk nekrose (IHN)

Del 1

3.

Koi-herpesvirus-sygdom (KHV)

Del 2

4.

Infektiøs lakseanæmi (ISA)

Del 3

5.

Infektion med Marteilia refringens

Del 4

6.

Infektion med Bonamia ostreae

Del 5

7.

White spot disease (WSD)

Del 6

II.   Definitioner

I dette bilag forstås ved »transportmedium«: et cellekulturmedium med 10 % kalveserum og med 200 iu penicillin, 200 μg streptomycin og 200 μg kanamycin pr. ml eller med andre dokumenteret effektive antibiotika.

DEL 1

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF IHN OG VHS

I.   Diagnosemetoder og -procedurer for overvågning af VHS og IHN

Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde status som sygdomsfri for så vidt angår IHN eller VHS som fastsat i bilag I, del 1, afsnit I, ved hjælp af diagnosemetoderne i del 1, punkt II.1 og II.2, i samme bilag, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1-l I.6 nedenfor.

I.1.   Præparation og forsendelse af fiskeprøver

I.1.1.   Væv til virologisk undersøgelse i cellekultur

Inden prøverne sendes eller overføres til laboratoriet, fjernes stykker af de organer, som skal undersøges, fra fisken med sterile dissektionsredskaber og overføres til sterile plastrør indeholdende transportmedium.

Den mængde fiskemateriale, der er egnet til virologisk undersøgelse i cellekultur og ved hjælp af RT-qPCR, afhænger af fiskestørrelsen. Det væv, der skal udtages prøver af, er hel fiskeyngel (længde < 4 cm), indvolde inklusive nyre (4 cm < længde < 6 cm) eller, for større fisk, nyre, milt, hjerte og/eller hjerne samt ovarievæske fra gydefisk på gydetidspunktet.

Ovarie- eller sædvæske eller organstykker fra højst 10 fisk kan indsamles i et sterilt rør indeholdende mindst 4 ml transportmedium og udgøre en samleprøve. Vævet i hver prøve skal veje mindst 0,5 g.

Den virologiske undersøgelse i cellekultur skal påbegyndes hurtigst muligt og senest 48 timer efter prøveudtagningen. I undtagelsestilfælde kan den virologiske undersøgelse påbegyndes senest 72 timer efter indsamlingen af materialet, hvis materialet er beskyttet af transportmedium, og kravene til transporttemperaturen kan overholdes.

I.1.2.   Prøver til analyse ved revers transkriptase-polymerasekædereaktion (RT-PCR eller RT-qPCR)

Prøver udtages fra fisken i overensstemmelse med den procedure, der er beskrevet i punkt I.1.1, med et sterilt instrument og overføres til et sterilt plastrør indeholdende transportmedium. Væv fra 10 fisk kan samles i ét rør og udgøre en samleprøve. Hvis mængden af inokulum er lille, kan væv fra op til fem fisk dog anvendes. Alternativt kan prøver samles i RNA-stabiliseringsreagens, f.eks. 0,2 g væv/ml reagens i henhold til fabrikanternes anbefaling, idet hver fisk dog skal behandles særskilt og ikke må samles med andre fisk i prøverne på grund af den lille mængde materiale, der skal anvendes til ekstraktion.

Der kan også sendes hele fisk til laboratoriet.

I.2.   Forsendelse af fiskeprøver

Rør med fiskevæv i transportmedium til celledyrkning eller RT-PCR/RT-qPCR-analyse skal placeres i isolerede beholdere, f.eks. tykvæggede polystyren-kasser, sammen med tilstrækkeligt med is eller et alternativt kølemiddel med tilsvarende køleeffekt, så det sikres, at prøverne opbevares køligt under transporten til laboratoriet. Dog bør nedfrysning af prøverne undgås. En prøves temperatur under forsendelsen bør aldrig overstige 10 °C, og der skal stadig være is tilbage i transportkassen, eller en eller flere af fryseblokkene skal fortsat være delvis eller helt frosset, ved kassens ankomst.

Der kan sendes hele fisk til laboratoriet, hvis kravene til transporttemperaturen, jf. første afsnit, kan overholdes. Hele fisk skal indpakkes i absorberende papir og skal derefter forsendes i en plastpose. Der kan også forsendes levende fisk.

I.3.   Indsamling af supplerende diagnostisk materiale

Med det diagnostiske laboratoriums godkendelse kan også andet fiskevæv indsamles og præpareres til supplerende undersøgelser.

I.4.   Præparation af prøver til cellekulturundersøgelse og RT-qPCR

I.4.1.   Frysning i undtagelsestilfælde

Hvis der opstår praktiske vanskeligheder, som gør det umuligt at behandle prøverne senest 48 timer efter indsamlingen af fiskevævet, kan vævsprøverne nedfryses til – 20 °C eller lavere temperatur i et transportmedium, og den virologiske undersøgelse foretages inden for 14 dage. Fiskevævet må dog kun fryses og optøs én gang, inden det undersøges. Der skal føres et register med nærmere oplysninger om grunden til hver enkelt nedfrysning af vævsprøver.

I.4.2.   Homogenisering af organer

På laboratoriet skal fiskevævet i rørene homogeniseres fuldstændigt, enten med stomacher, blender eller morter og pistil med sterilt sand, og derefter opslæmmes i det oprindelige transportmedium.

Hvis prøven består af en hel fisk på under 4 cm, findeles den ved hjælp af en steril saks eller skalpel efter fjernelse af kroppen bag gatåbningen. Hvis prøven består af en hel fisk på 4-6 cm, indsamles indvoldene, herunder nyre. Hvis prøven består af en hel fisk på over 6 cm, indsamles vævsprøverne som beskrevet i punkt I.1. Vævsprøverne findeles ved hjælp af en steril saks eller skalpel, homogeniseres som beskrevet i første afsnit og opslæmmes i transportmedium.

Det endelige forhold mellem vævsmateriale og transportmedium skal på laboratoriet justeres til 1:10.

I.4.3.   Centrifugering af homogenatet

Homogenatet centrifugeres i en kølecentrifuge ved 2-5 °C og 2 000-4 000 × g i 15 minutter, hvorefter supernatanten opsamles og kan behandles enten i 4 timer ved 15 °C eller natten over ved 4-8 °C med antibiotika. Hvis prøven er blevet sendt i et transportmedium, kan behandling af supernatanten med antibiotika udelades.

Hvis der opstår praktiske vanskeligheder, f.eks. at varmeskabet går i stykker, eller at der opstår problemer med cellekulturer, som gør det umuligt at pode celler senest 48 timer efter indsamlingen af fiskevævsprøverne, kan supernatanten fryses ved – 80 °C, og den virologiske undersøgelse foretages inden for 14 dage.

Hvis den opsamlede supernatant opbevares ved en temperatur på – 80 °C senest 48 timer efter prøveudtagningen, kan den, dog kun én gang, genanvendes til virologisk undersøgelse.

Inden supernatanten podes på cellerne, blandes den med en tilsvarende mængde passende fortyndet pool af antisera mod de indigene serotyper af infektiøs pankreasnekrose-virus (IPN-virus) og inkuberes hermed i mindst 1 time ved 15 °C eller i højst 18 timer ved 4 °C. Antiserumtiteren skal være mindst 1/2 000 i en 50 % pladeneutraliseringsprøve.

Formålet med at behandle alle inokula med antiserum mod IPN-virus er at hindre, at der udvikles cytopatisk effekt (CPE) som følge af IPN-virus i podede cellekulturer. Det vil nedsætte de virologiske undersøgelsers varighed og antallet af tilfælde, hvor forekomst af CPE ellers måtte opfattes som en potentiel indikation af VHSV eller IHNV.

Når prøverne kommer fra produktionsenheder, der anses for at være frie for IPN, kan behandling af inokula med antiserum mod IPN-virus undlades.

I.4.4.   Præparation af prøver til overvågningsprogrammer på basis af RT-PCR og RT-qPCR

Hvis prøverne blev opsamlet i et transportmedium, gennemføres proceduren i punkt I.4.2 og I.4.3. Efter centrifugering opsamles supernatanten, og RNA ekstraheres. Hvis der ikke skal foretages yderligere undersøgelser direkte efter centrifugering, fryses prøverne straks ved – 20 °C eller derunder.

Til analyse af fiskevævsprøver, der er konserveret i RNA-stabiliseringsreagens, skal det efterfølgende arbejde foretages inden for følgende tidsfrister for prøver opbevaret ved forskellige temperaturer:

 

prøver opbevaret ved 37 °C: en dag

 

prøver opbevaret ved 25 °C: en uge

 

prøver opbevaret ved 4 °C: en måned

 

prøver opbevaret ved – 20 °C: tidsubegrænset.

Samleprøver i RNA-stabiliseringsreagens behandles som enkeltprøver i RNA-stabiliseringsreagens. For prøver, der samles i RNA-stabiliseringsreagens, må prøvemængden ikke overstige den af fabrikanten anbefalede for ekstraktion med RNA-kit som f.eks. RNeasy Mini kit (Qiagen) eller tilsvarende. Hvis større prøver samles, skal ekstraktionskittene eller -metoderne afspejle denne samling.

Prøver, der opsamles i RNA-stabiliseringsreagens, må ikke anvendes til celledyrkning.

I.4.5.   Samling af prøver til RT-qPCR

Da de givne RT-qPCR-protokoller har en sensitivitet, der svarer til eller er højere end celledyrkningsmetodernes, kan der til PCR anvendes supernatant fra homogeniseret fiskevævsmateriale af organer fra op til ti fisk samlet i cellekulturmedium. Eftersom der anvendes en meget mindre mængde inokulum til PCR end til celledyrkning, skal alt fiskevæv dog homogeniseres omhyggeligt, inden materialet samles til ekstraktion.

Samme princip gælder, hvis prøverne indsamles i RNA-stabiliseringsreagens. I dette tilfælde er det imidlertid vanskeligt at samle repræsentativt materiale fra op til ti fisk i ét rør, og antallet af fisk pr. samleprøve skal derfor indskrænkes til 2-5.

I.5.   Virologisk undersøgelse i cellekultur

I.5.1.   Cellekulturer og medier

Celler af enten cellelinjen Bluegill fry – 2 (BF-2) eller cellelinjen Rainbow trout gonad – 2 (RTG-2) og enten cellelinjen Epithelioma papulosum cyprini (EPC) eller Fathead minnow (FHM) skal dyrkes ved 20-30 °C i et egnet medium, dvs. Eagle's Minimum essential medium (MEM) eller modifikationer heraf, tilsat 10 % føtalt kvægserum og antibiotika i standardkoncentrationer.

Når cellerne dyrkes i lukkede glas, benyttes bicarbonat som buffer til mediet. Til det medie, der anvendes til dyrkning af celler i åbne enheder, kan tris(hydroxymethyl)aminomethan-HCl (Tris-HCl) (23 mM) og natriumbicarbonat (6 mM) benyttes som buffer. pH-værdien skal ligge på 7,6 ± 0,2.

De cellekulturer, der skal anvendes til podning med fiskevævsmateriale, skal være unge, normalt en dag gamle cellekulturer i monolag, hvis det er muligt; cellekulturer, som er 4-48 timer gamle, kan dog accepteres. Cellerne skal være aktivt voksende ved podningen.

I.5.2.   Podning af cellekulturer

En antibiotikabehandlet organopslæmning podes på cellekulturer i to fortyndinger, dvs. primærfortyndingen og derudover en fortynding på 1:10 heraf, så der fremkommer slutfortyndinger af vævsmateriale i cellekulturmediet på henholdsvis 1:100 og 1:1 000, idet formålet er at hindre homolog interferens. Mindst to cellelinjer skal podes i overensstemmelse med punkt I.5.1. Mængdeforholdet mellem inokulum og cellekulturmedium skal være ca. 1:10.

For hver fortynding og hver cellelinje anvendes et celleområde på mindst ca. 2 cm2 svarende til én brønd på en cellekulturplade med 24 brønde. Der anvendes cellekulturplader, hvis det er muligt.

I.5.3.   Inkubation af cellekulturer

De podede cellekulturer inkuberes ved 15 °C i 7-10 dage. Hvis cellekulturmediet ændrer farve fra rød til gul, som er tegn på forsuring af mediet, skal pH-værdien justeres med steril bicarbonatopløsning eller tilsvarende stoffer for at sikre, at cellematerialet er modtageligt for virusinfektion.

Der foretages mindst hver sjette måned, eller når der er mistanke om, at cellerne er mindre modtagelige, titrering af frosne lagre af VHSV og IHNV for at fastslå, om cellekulturerne er modtagelige for infektion. Proceduren i afsnit III anvendes, hvis det er muligt.

I.5.4.   Mikroskopi

Podede cellekulturer skal undersøges jævnligt (mindst tre gange om ugen) for forekomst af CPE ved ca. 40-150 × forstørrelse. Hvis der konstateres tydelig CPE, skal der omgående anvendes procedurer for virusidentifikation i overensstemmelse med punkt I.6.

I.5.5.   Subkultivering

Er der ingen udvikling af CPE efter primærinkubationen i 7-10 dage, gennemføres der subkultivering med friske cellekulturer på et celleareal af samme størrelse som primærkulturens.

Aliquoter af medium (supernatant) fra alle kulturer eller brønde, som udgør primærkulturen, samles pr. cellelinje 7-10 dage efter podning, og podes derefter på homologe cellekulturer, der er ufortyndet og fortyndet 1:10 (som giver slutfortyndinger af supernatanten på henholdsvis 1:10 og 1:100), som beskrevet i punkt I.5.2. Alternativt podes aliquoter på 10 % af det medium, som udgør primærkulturen, direkte i en brønd med frisk cellekultur (brønd-til-brønd-subkultivering). Inden podningen kan der foretages inkubation af fortyndingerne med antiserum mod IPN-virus i en passende fortynding som beskrevet i punkt I.4.3.

De podede kulturer inkuberes derefter i 7-10 dage ved 15 °C og undersøges i overensstemmelse med punkt I.5.4.

Hvis der forekommer toksisk CPE i løbet af de første tre inkubationsdage, foretages subkultivering på det stadium, men cellerne skal i så fald inkuberes i syv dage og subkultiveres igen med yderligere syv dages inkubation. Hvis der udvikler sig toksisk CPE efter tre dage, subkultiveres cellerne én gang og inkuberes, således at man kommer op på de i alt 14 dage fra primærpodningen. Der må ikke være noget tegn på toksicitet i de sidste syv inkubationsdage.

Hvis der trods antibiotikabehandling optræder bakteriekontamination, skal supernatanten inden subkultivering centrifugeres ved 2 000-4 000 × g i 15-30 minutter ved 2-5 °C og/eller filtreres gennem et 0,45 μm filter (svagt proteinbindende membranfilter). Derudover er procedurerne for subkultivering de samme som dem, der er beskrevet for toksisk CPE i fjerde afsnit.

Hvis der ikke forekommer CPE, kan testen erklæres for negativ.

I.6.   Virusidentifikation

Hvis der er observeret tegn på CPE i en cellekultur, indsamles mediet (supernatanten) og undersøges efter én eller flere af følgende metoder: enzymbundet immunosorbent assay (ELISA), immunfluorescens (IF), neutralisationstest, RT-PCR eller RT-qPCR. Hvis sådanne test ikke i løbet af en uge har ført til en definitiv identifikation af virusset, skal supernatanten sendes til det nationale referencelaboratorium eller til EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF, med henblik på øjeblikkelig identifikation.

I.6.1.   ELISA

Der foretages en dobbelt-antistof-sandwich-ELISA for at identificere virusisolatet. Mikrotiterplader dækkes med 50 μl/brønd (0,9 pg) protein-A-rensede immunglobuliner (Ig) af dokumenteret kvalitet fra kaninantiserum mod IHNV eller VSHV opløst i carbonatbuffer (pH 9,6) indeholdende 15 mM natriumazid og inkuberes i 18 timer til 2 uger ved 4 °C.

På en fortyndingsplade skal hver prøve, der indeholder 1 % Triton X-100, og de positive kontroller fortyndes med en bufferopløsning (dvs. phosphat-bufferet saltopløsning (PBS)-T-BSA, 1 % BSA) i en 4-fold-fortynding: ufortyndet, 1:4, 1:16, 1:64. ELISA-pladerne vaskes med PBS indeholdende 0,05 % Tween-20 (PBS-T), og 50 μl af hver fortynding overføres fra fortyndingspladen til den vaskede og belagte ELISA-plade.

Derefter inkuberes ELISA-pladerne i 30 minutter ved 37 °C. Efterfølgende vaskes pladerne og inkuberes i 30 minutter ved 37 °C med specifikke monoklonale antistoffer (dvs. henholdsvis MAb IP5B11 til VHSV-identifikation og Hyb 136-3 til IHNV). Kanin-anti-mus-antistoffer fortyndet 1:1 000 i PBS-T-BSA konjugeret med 50μl peberrodsperoxidase (HRP) overføres til ELISA-pladen.

Endelig startes reaktionerne, efter endnu en vaskning, ved at tilsætte 50 μl/brønd orthophenylendiamin (OPD). ELISA-pladerne inkuberes mørkt i 20 minutter ved rumtemperatur, og reaktionen stoppes ved at tilsætte 100 μl/brønd 0,5 M H2SO4.

Absorbansen måles ved en bølgelængde på 492 og 620 nm i en ELISA-læser. Prøverne betegnes som positive eller negative, efter at testresultaterne er blevet sammenlignet med absorbansværdierne for de positive og negative kontroller. Generelt anses prøver med kombineret absorbans (A) < 0,5 for ufortyndet materiale for negative, prøver med A-værdier mellem 0,5 og 1,0 anses for mistænkelige, og prøver med A-værdier > 1,0 anses for positive.

Der kan anvendes andre ELISA-versioner med dokumenteret tilsvarende effektivitet i stedet for dem, der er omhandlet i dette punkt.

I.6.2.   Immunfluorescens (IF)

De listeopførte patogener VHSV og IHNV identificeres ved at inficere celler i 96-brønds »Black«-plader, konventionelle 24-brøndsplader eller på dækglas i 24-brøndsplader. Når IHNV eller VHSV eller begge er identificeret ved at inficere celler på dækglas, anvendes følgende protokol:

a)

På dækglassene udstryges der celler med en tæthed, der giver 60-90 % sammenflydning efter 24 timers dyrkning. Om muligt anvendes EPC-celler, fordi de klæber stærkt til glasoverflader, men der kan også anvendes andre cellelinjer såsom BF-2, RTG-2 eller FHM. 150 μl cellekultursupernatant i to forskellige fortyndinger (1:10 og 1:1 000) podes i duplikat på en dag gamle monolag og inkuberes ved 15 °C i 24 timer.

b)

Derefter fjernes cellekulturmediet, og de inficerede cellemonolag fikseres med 0,5 ml iskold, vandig acetoneopløsning (80 % v/v). Fikseringen foretages i et stinkskab i 15 minutter ved rumtemperatur, derefter fjernes acetoneopløsningen, og dækglassene lufttørres i mindst 30 minutter. På dette trin skal pladerne enten behandles med det samme eller opbevares ved – 20 °C med henblik på videre anvendelse.

c)

Specifikke monoklonale antistoffer (dvs. henholdsvis MAb IP5B11 til VHSV-identifikation og Hyb 136-3 til IHNV) opløses i 0,01 M PBST med en pH-værdi på 7,2 i den af leverandøren af MAb anbefalede fortynding; 50-100 μl/brønd tilsættes til det fikserede monolag, og pladerne inkuberes i en time ved 37 °C i et fugtkammer.

d)

Dækglassene vaskes forsigtigt tre gange med PBS indeholdende 0,05 % Tween-20 (PBS-T), og bufferen fjernes helt efter sidste vaskning. Cellerne inkuberes derefter i en time ved 37 °C med fluoresceinisothiocyanat (FITC) — eller tetramethylrhodamin-5-(og-6-)isothiocyanat (TRITC)-konjugerede antistoffer mod museimmunglobulin anvendt som det primære antistof, fortyndet i henhold til leverandørens anvisninger, vaskles endnu en gang i PBS-T og tørres. Farvede kulturer monteres på objektglas med glycerolsaltopløsning og undersøges under indfaldende UV-lys. Der anvendes okularer, der forstørrer 10 × eller 12 ×, og × 25 – eller × 40-objektiver med en blænde på henholdsvis > 0,7 og > 1,3.

Andre IF-metoder (mht. cellekulturer, fiksering og antistoffer af referencekvalitet) med dokumenteret tilsvarende effektivitet kan anvendes.

I.6.3.   Neutralisation

Cellerne fra den opsamlede supernatant fjernes ved centrifugering (2 000-4 000 × g) eller membranfiltrering (0,45 μm) gennem et svagt proteinbindende membranfilter, og supernatanten fortyndes 1:100 og 1:10 000 i celledyrkningsmedium.

Aliquoter af mindst to supernatantfortyndinger blandes og inkuberes i 60 minutter ved 15 °C med lige dele af følgende reagenser hver for sig:

a)

serum indeholdende gruppespecifikt antistof mod VHSV fortyndet i forholdet 1:50 v/v

b)

serum indeholdende gruppespecifikt antistof mod IHNV fortyndet i forholdet 1:50 v/v

c)

blanding af antisera mod indigene serotyper af IPNV fortyndet i forholdet 1:50 v/v

d)

medium alene (positiv kontrol).

Der skal fra hver virussupernatant-serum-blanding podes mindst to cellekulturer med 50 μl hver, som derefter inkuberes ved 15 °C. Udviklingen af CPE kontrolleres som beskrevet i punkt I.5.4.

VHSV-stammer og -isolater, som ikke reagerer i neutralisationstest, identificeres ved IF eller ELISA.

Andre neutralisationstest med dokumenteret tilsvarende effektivitet kan også anvendes.

I.6.4.   RT-PCR/RT-qPCR

I.6.4.1.   Forberedelse af viralt RNA

Alt arbejde med RNA skal udføres på is, og der skal anvendes handsker.

RNA ekstraheres efter phenolchloroformmetoden eller med kolonner til oprensning af RNA (RNA affinity spin columns) i henhold til fabrikantens anvisninger. Der kan anvendes kommercielt tilgængelige RNA-ekstraktionskit, der giver RNA af høj kvalitet, som er egnet til anvendelse med de RT-PCR-protokoller, der beskrives i det følgende.

RNA skal genopslæmmes i destilleret RNAse-frit vand (dvs. vand, der er behandlet med 0,1 % diethylpyrocarbonat) eller en passende elueringsbuffer.

I.6.4.2.   RT-PCR

Der anvendes følgende primere til påvisning af IHNV:

 

Forward primer 5′-AGA-GAT-CCC-TAC-ACC-AGA-GAC-3′

 

Reverse Primer 5′-GGT-GGT-GTT-GTT-TCC-GTG-CAA-3′.

Der anvendes følgende cyklusser (ettrins-RT-PCR): 1 cyklus: 50 °C i 30 minutter; 1 cyklus: 95 °C i 2 minutter; 30 cyklusser: 95 °C i 30 sekunder, 50 °C i 30 sekunder, 72 °C i 60 sekunder; 1 cyklus: 72 °C i 7 minutter og udblødning ved 4 °C.

Der anvendes følgende primere til påvisning af VHSV:

 

VN For 5′-ATG-GAA-GGA-GGA-ATT-CGT-GAA-GCG-3′

 

VN Rev 5′-GCG-GTG-AAG-TGC-TGC-AGT-TCC-C-3′.

Der anvendes følgende cyklusser (ettrins-RT-PCR): 50 °C i 30 minutter, 95 °C i 15 minutter, 35 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 68 °C i 60 sekunder. Reaktionen skal derefter holdes ved 68 °C i 7 minutter.

RT-PCR-reaktionernes kvantitet og specificitet skal evalueres ved gelelektroforese i 1,5 % agarosegel med ethidiumbromid og observeres ved hjælp af UV-gennemlysning. Et PCR-amplikon på 693 bp kan observeres for IHNV. For VHSV skal størrelsen være 505 bp.

Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Passende positive og negative kontroller og sekventeret amplikon skal derfor anvendes for at undgå enhver tvivl. For så vidt angår VHSV-primerne skal der udvises særlig forsigtighed, når der anvendes BF-2-celler, da primerne kan reagere med cellelinjens DNA/RNA og give falsk positive resultater af lignende størrelse. Når supernatant fra BF-2-celler testes, skal alle amplificerede PCR-fragmenter sekventeres.

I.6.4.3.   RT-qPCR til VHSV

For VHSV skal amplificering foretages med følgende primere og probe:

 

Forward primer: 5′-AAA-CTC-GCA-GGA-TGT-GTG-CGT-CC-3′

 

Reverse primer: 5′-TCT-GCG-ATC-TCA-GTC-AGG-ATG-AA-3′

 

og probe: 5′-FAM-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

Ettrins-RT-qPCR:

Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser: 50 °C i 3 minutter, 95 °C i 15 minutter, 40 cyklusser ved 94 °C i 15 sekunder, 60 °C i 40 sekunder og 72 °C i 20 sekunder. Justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.

I.6.4.4.   RT-qPCR til IHNV

For IHNV skal amplificering foretages med følgende primere og probe:

 

Forward primer: 5′- AGA-GCC-AAG-GCA-CTG-TGC-G-3′

 

Reverse primer: 5′- TTCTTTGCGGCTTGGTTGA — 3′

 

og probe: 5′ 6FAM-TGAGACTGAGCGGGACA-NFQ/MGB.

Totrins-RT-qPCR:

Da følgende analyse afhænger af en totrins-amplificering, skal der for at undgå kontaminering udvises særlig stor forsigtighed ved håndtering af rør mellem første og anden reaktion.

Cyklusbetingelser (efter RT-trinnet): 50 °C i 2 minutter, 95 °C i 10 minutter efterfulgt af 40 cyklusser ved 95 °C i 15 sekunder og 60 °C i 1 minut; om nødvendigt foretages justeringer.

Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.

II.   Detaljerede diagnosemetoder og -procedurer for at bekræfte eller udelukke mistanke om VHS eller IHN eller begge ved mistanke om udbrud

Hvis der i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF kræves laboratorieundersøgelser for at bekræfte eller udelukke forekomst af IHN eller VHS eller begge ved hjælp af diagnosemetoderne i bilag I, del 1, punkt II.3, anvendes følgende detaljerede diagnosemetoder og -procedurer:

a)

konventionel virusisolation med efterfølgende seroneutralisation, immunkemisk eller molekylær virusidentifikation

b)

viruspåvisning ved hjælp af RT-PCR eller RT-qPCR

c)

andre diagnoseteknikker som f.eks. IFAT, ELISA, RT-PCR eller IHC.

II.1.   Konventionel virusisolation med efterfølgende virusidentifikation

II.1.1.   Udvælgelse af prøver

Der udvælges mindst 10 fisk med typiske symptomer på IHN eller VHS til undersøgelse.

II.1.2.   Præparation og forsendelse af fiskeprøver

Præparation og forsendelse med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.2.

II.1.3.   Indsamling af supplerende diagnostisk materiale

Indsamling af supplerende materiale med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.3.

II.1.4.   Præparation af prøver til cellekulturundersøgelse

Præparation af prøver til cellekulturundersøgelse henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.4.

II.1.5.   Virologisk undersøgelse i cellekultur

Den virologiske undersøgelse med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.5.

II.1.6.   Virusidentifikation

Virusidentifikation med henblik på konventionel virusisolation skal følge de metoder og procedurer, der er fastsat i punkt I.6.

II.2.   Viruspåvisning ved hjælp af RT-qPCR

II.2.1.   Udvælgelse af prøver

Udvælgelse af prøver med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.1.2.

II.2.2.   Præparation og forsendelse af fiskeprøver

Præparation og forsendelse med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.2.

II.2.3.   Indsamling af supplerende diagnostisk materiale

Indsamling af supplerende diagnostisk materiale med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.3.

II.2.4.   Præparation af prøver til RT-qPCR

Præparation af prøver med henblik på viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.6.4.1.

II.2.5.   RT-qPCR

Viruspåvisning ved hjælp af RT-qPCR skal følge de metoder og procedurer, der er fastsat i punkt I.6.4.1, I.6.4.3 og I.6.4.4.

II.3.   Andre diagnosemetoder

Supernatanten, præpareret som beskrevet i punkt I.4.3, kan analyseres ved ELISA, IFAT eller RT-PCR i overensstemmelse med henholdsvis punkt I.6.1, punkt I.6.2 eller punkt I.6.4. Vævsmateriale kan analyseres efter andre diagnosticeringsmetoder såsom IFAT på frysesnit eller immunhistokemi på formalinfikseret vævsmateriale. Disse hurtige teknikker skal suppleres med en virologisk undersøgelse i overensstemmelse med enten punkt II, litra a), eller punkt II, litra b), senest 48 timer efter prøveudtagningen, hvis:

a)

resultatet er negativt, eller

b)

resultatet er positivt med materiale fra det første tilfælde af IHN eller VHS.

III.   Titreringsprocedure til kontrol af cellekulturers modtagelighed for infektion

Når titreringen til kontrol af cellekulturers modtagelighed for infektion, jf. punkt I.5.3, foretages, skal procedurerne i følgende afsnit følges.

Der anvendes mindst to VHSV-isolater og ét IHNV-isolat. Isolaterne skal repræsentere den vigtigste virusgruppe i Den Europæiske Union, dvs. for VHSV ét patogent isolat fra regnbueørred i ferskvand og ét marint isolat, der er patogent for pighvar, og for IHNV en EU-stamme, som er patogen for regnbueørred. Der anvendes veldefinerede isolater fra medlemsstaterne. Batcher af virus i cellekulturer med lavt passagetal dyrkes i celledyrkningsglas på BF-2- eller RTG-2-celler for VHSV og på EPC- eller FHM-celler for IHNV. Der anvendes celledyrkningsmedium med mindst 10 % serum. Der anvendes en lav MOI til podning (< 1).

Ved fuld CPE skal der høstes virus ved centrifugering af cellekultursupernatanten ved 2 000 × g i 15 minutter; derefter filtersteriliseres det gennem et 0,45 μm membranfilter og fordeles i mærkede fryserør. Virusset skal opbevares ved – 80 °C.

En uge efter frysning optøs tre glas med hvert virus i koldt vand, og det titreres på deres respektive cellelinjer. Mindst hver sjette måned, eller hvis der er mistanke om, at cellelinjernes modtagelighed for infektion er mindsket, optøs og titreres hvert virusisolat.

Titreringsprocedurerne skal nøje beskrives, og der anvendes samme metode hver gang.

Titrering indtil fortyndingsslutpunktet gentages seks gange på hvert fortyndingstrin. Titerne sammenlignes med tidligere titere. Hvis titeren af et af de tre virusisolater er mindst to logaritmer lavere end den oprindelige titer, må cellelinjen ikke længere anvendes til overvågningsformål.

Hvis der anvendes flere cellelinjer i laboratoriet, skal hver cellelinje undersøges for sig.

Data og optegnelser skal opbevares i mindst 10 år.

DEL 2

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF KOI-HERPESVIRUS-SYGDOM (KHV)

I.   Detaljerede diagnosemetoder og -procedurer for at bekræfte forekomst af eller udelukke mistanke om KHV

Hvis der i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF kræves laboratorieundersøgelser for at bekræfte forekomst af eller udelukke mistanke om KHV ved hjælp af diagnosemetoderne i bilag I, del 2, afsnit III, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1-I.2 nedenfor.

I.1.   Præparation af fiskeprøver

Til diagnostiske formål kan fisken (sendt levende eller død og pakket separat i forseglede aseptiske beholdere) eller alternativt frosne organer eller stykker af organer konserveret i 80 % til absolut ethanol eller transportmedium til virus (skal behandles senest 48 timer efter indsamlingen) anvendes til undersøgelse med konventionel PCR eller qPCR-baserede metoder.

Til påvisning af KHV indsamles gæller og nyre; desuden kan milt, hjerne og tarm indgå i en yderligere separat prøve. I akutte tilfælde kan vævsmateriale fra op til fem fisk udgøre en samleprøve.

Endvidere kan prøver, der kan udtages uden at slå dyret ihjel, som f.eks. blod, svaberprøver fra gæller, biopsi fra gæller og skrab fra slimhinder, anvendes i visse tilfælde (således at der kan anvendes meget værdifulde fisk i tilfælde af mistanke om forekomst af KHV).

I.1.1.   DNA-ekstraktion

DNA skal ekstraheres i henhold til standardprocedurerne.

Der kan anvendes kommercielt tilgængelige DNA-ekstraktionskit, der giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er omhandlet i punkt I.2.

I.2.   Agenspåvisning og -identifikation med metoder, der er baseret på polymerasekædereaktion (PCR)

I.2.1.   qPCR til påvisning af KHV

Til qPCR-påvisning af KHV skal følgende qPCR-analyse anvendes:

 

Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′

 

Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′

 

og probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Cyklusbetingelser: 1 cyklus ved 95 °C i 15 minutter efterfulgt af 40 cyklusser ved 94 °C i 15 sekunder og 60 °C i 60 sekunder. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre qPCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.

I.2.2.   Konventionel PCR til påvisning af KHV

Der skal anvendes den i dette punkt beskrevne analyse, som er målrettet thyminkinase-genet (TK) i KHV. Andre PCR-analyser med dokumenteret sensitivitet og specificitet svarende til den beskrevne analyses kan dog også anvendes.

 

Forward primer (KHV-TKf): 5′-GGGTTACCTGTAC GAG-3′

 

Reverse primer (KHV-TKr): 5′-CACCCAGTAGATTA TGC-3′.

Cyklusbetingelser: 1 cyklus ved 95 °C i 5 minutter efterfulgt af 35 cyklusser ved 95 °C i 30 sekunder, 52 °C i 30 sekunder, 72 °C i et minut og 1 cyklus ved 72 °C i 10 minutter. Der anvendes en produktstørrelse på 409 bp.

Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller kontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre PCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.

Den første påvisning i et område skal bekræftes ved sekventering eller sendes til et nationalt referencelaboratorium eller til EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF, med henblik på øjeblikkelig identifikation.

II.   Detaljerede diagnosemetoder og -procedurer for overvågning af KHVD

Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde en bestemt sundhedsstatus for så vidt angår KHVD som fastsat i bilag I, del 2, afsnit I, ved hjælp af diagnosemetoderne i del 2, afsnit II og III, i samme bilag, anvendes de detaljerede diagnosemetoder og -procedurer i følgende punkt II.1 og II.2.

II.1.   Præparation af fiskeprøver

Hvis det er muligt, skal der udtages prøver af fisk, der i en længere periode har været holdt ved temperaturer, ved hvilke virus udvikler sig (dvs. to til tre uger ved 15-26 °C). Hvis det er muligt, skal der udtages prøver 24 timer, og senest 72 timer, efter driftspraksis, der kan reaktivere virusset i fisk med status som virusbærer, f.eks. brug af net eller transport, for at forbedre chancen for at påvise KHV.

Med henblik på overvågning af KHVD kan fisken (sendt levende eller død og pakket separat i forseglede aseptiske beholdere) eller alternativt frosne organer eller stykker af organer konserveret i 80-100 % alkohol eller transportmedium til virus (skal behandles senest 48 timer efter indsamlingen) anvendes til undersøgelse med PCR-baserede metoder. Med henblik på overvågning af KHVD udtages væv fra gæller og nyre.

Med henblik på overvågning af KHVD undgås så vidt muligt samling af prøverne. Hvis samling af prøver er nødvendig, kan vævsmateriale fra højst to fisk udgøre en samleprøve. Større prøver skal homogeniseres med morter og pistil eller stomacher, og delprøver skal udtages til DNA-ekstraktion inden klaring. Alternativt kan delprøver udtages fra hvert væv, som indgår i prøven, og anbringes i »lysisrør«.

II.1.1.   DNA-ekstraktion

DNA skal ekstraheres i henhold til standardprocedurerne. Der kan anvendes kommercielt tilgængelige DNA-ekstraktionskit, der giver DNA af høj kvalitet, som er egnet til anvendelse med PCR-protokollerne i punkt II.2.

Det acceptable forhold mellem væv og medium er 1:9 w/v. I prøverne skal indgå 20-25 mg vævsmateriale.

II.2.   Overvågning af KHVD med PCR-baserede metoder

Til overvågning af KHV anvendes qPCR. Hvis der forekommer positive prøver i et område, der ikke tidligere er bekræftet positivt, skal undersøgelsesresultaterne bekræftes enten:

a)

ved sekventering af et PCR-produkt eller et nested PCR-produkt fra prøverne.

Der skal mindst være 98 % match mellem den opnåede rene konsensussekvens og disse referencesekvenser

b)

eller alternativt ved at sende prøverne til et nationalt referencelaboratorium med henblik på bekræftelse af resultaterne.

II.2.1.   qPCR til påvisning af KHV

Følgende qPCR skal anvendes:

 

Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′

 

Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′

 

og probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Cyklusbetingelser: 1 cyklus ved 95 °C i 15 minutter efterfulgt af 50 cyklusser ved 94 °C i 15 sekunder og 60 °C i 60 sekunder.

Resultaterne af qPCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre qPCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.

II.2.2.   Konventionel PCR til bekræftelse af KHV-påvisning

Til bekræftelse af forekomst af infektion med KHV skal den generiske nested PCR, som er beskrevet i tabel 2.1, anvendes efterfulgt af sekventering af det amplificerede produkt.

Tabel 2.1

Primere og betingelser for nested PCR-analysen, der er målrettet alle cyprinidherpesvirus (CyHV-1, CyHV-2 og CyHV-3)

Primernavn

Sekvens

Cyklusbetingelser

Produktstørrelse

CyHVpol-forward

5′-CCAGCAACATGTGCGACGG-3′

Første runde PCR

1 cyklus:

95 °C i 2 minutter

40 cyklusser:

 

95 °C i 30 sekunder

 

55 °C i 30 sekunder

 

72 °C i 45 sekunder

1 cyklus:

72 °C i 10 minutter.

362 bp

CyHVpol-reverse

5′-CCGTARTGAGAGTTGGCGCA-3′

CyHVpol-internal forward

5′-CGACGGVGGYATCAGCCC-3′

Anden runde PCR

1 cyklus:

95 °C i 2 minutter

40 cyklusser:

 

95 °C i 30 sekunder

 

55 °C i 30 sekunder

 

72 °C i 45 sekunder

1 cyklus:

72 °C i 10 minutter

339 bp

CyHVpol-internal reverse

5′-GAGTTGGCGCAYACYTTCATC-3′

Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. PCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.

Sekventering kan foretages af laboratoriet eller hos eksterne specialiserede sekventeringsvirksomheder. Sekventeringsresultaterne skal analyseres ved at sammenligne sekvenserne med kendte referencesekvenser af KHV (GenBank, stammesamlingsnummer AP008984, DQ657948 og DQ177346). Der skal mindst være 98 % match mellem den opnåede rene konsensussekvens og disse referencesekvenser

DEL 3

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTIØS LAKSEANÆMI (ISA)

I.   Prøveudtagningsprocedurer for overvågning og bekæmpelse af ISA

Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på overvågnings- eller udryddelsesprogrammerne i bilag I, del 3, eller for at bekræfte eller udelukke forekomst af ISA i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF, anvendes de detaljerede metoder og procedurer i punkt I.1, I.2 og I.3.

I.1.   Præparation af fiskeprøver

Fiskeprøver til laboratorieundersøgelser for forekomst af ISA må, hvis muligt, ikke samles. I forbindelse med overvågning af ISA må 2-5 fisk dog gerne samles i en prøve.

Prøver til revers transkriptase-polymerasekædereaktion (RT-PCR) skal udtages af alle de af prøven omfattede fisk. Et stykke af mellemnyren fjernes fra fisken med et sterilt instrument og overføres til et mikrocentrifugeglas med 1 ml RNA-konserveringsvæske af dokumenteret effektivitet. Væv fra op til fem fisk kan samles i et rør med transportopløsning og udgøre en samleprøve. Vægten af vævet i en prøve skal være 0,5 g. Hvis fisken er for lille til, at der kan opnås en prøve af den krævede vægt, kan der tages stykker af nyre, hjerte, milt, lever eller blindtarm i nævnte rækkefølge, indtil der opnås 0,5 g.

Prøver til histologisk undersøgelse må kun udtages fra nyligt aflivede fisk med normal konstitution, der udviser kliniske tegn eller tegn ved obduktion, som tyder på forekomst af ISA. Alle ydre eller indre læsioner skal medtages i prøven, og der skal under alle omstændigheder udtages prøver af mellemnyre, hjerte, lever, bugspytkirtel, tarm, gæller og milt, som fjernes fra de enkelte fisk ved hjælp af en skalpel og overføres til en 8-10 % (v/v) bufferet formaldehyd/saltopløsning. Forholdet mellem fikseringsvæske og væv skal mindst være 20:1 for at sikre en tilfredsstillende konservering af vævet. Til immunhistokemi (IHC) skal der udtages prøver fra mellemnyre og hjerte.

Til virologisk undersøgelse i cellekultur udtages der væv af alle de af prøven omfattede fisk. Stykker af lever, for- eller mellemnyre, hjerte og milt fjernes fra fisken med et sterilt instrument og overføres til plastrør med 9 ml transportmedium. Væv fra op til fem fisk kan samles i et rør med transportopløsning og udgøre en samleprøve. Vægten af vævet i en prøve skal være 1,0 ± 0,5 g.

I.2.   Forsendelse af fiskeprøver

Hele fisk kan transporteres til laboratoriet, hvis de i tredje afsnit i dette punkt beskrevne krav til transporttemperaturen kan overholdes. Hele fisk skal indpakkes i absorberende papir og sendes i en plastpose, der køles som beskrevet i nævnte afsnit.

Der kan også sendes levende fisk, men kun under tilsyn af det nationale referencelaboratorium for fiskesygdomme, og idet der tages hensyn til de yderligere desinficerings- og biosikkerhedsaspekter i forbindelse med transport af levende fisk.

Blodprøver og rør med fiskevæv til virologisk undersøgelse eller RT-PCR-analyse placeres i isolerede beholdere, f.eks. tykvæggede polystyren-kasser, sammen med tilstrækkeligt med is eller fryseblokke, så det sikres, at prøverne opbevares køligt under transporten til laboratoriet. Frysning skal undgås, og ved modtagelsen skal der stadig være is i transportbeholderen, eller en eller flere af fryseblokkene skal stadig være helt eller delvis frosset. Under ekstraordinære omstændigheder kan RT-PCR-prøver og prøver til virologisk undersøgelse lynfryses og transporteres til laboratoriet ved – 20 °C eller derunder.

Til RT-PCR-analyse af væv konserveret i ribonukleinsyre(RNA)later skal RNA-ekstraktion foretages inden for følgende tidsfrister afhængigt af den temperatur, som prøverne opbevares ved:

 

prøver opbevaret ved 37 °C: en dag

 

prøver opbevaret ved 25 °C: en uge

 

prøver opbevaret ved 4 °C: en måned

 

prøver opbevaret ved – 20 °C: tidsubegrænset.

Hvis fiskevæv transporteres i fikseringsvæske til histologisk undersøgelse, skal det forsendes i lækagesikre rør i stødsikre beholdere. Nedfrysning af disse prøver skal undgås.

Den virologiske undersøgelse i cellekultur skal påbegyndes hurtigst muligt og senest 48 timer efter prøveudtagningen. I undtagelsestilfælde kan den virologiske undersøgelse påbegyndes senest 72 timer efter indsamlingen af materialet, hvis materialet er beskyttet af transportmedium, og kravene til transporttemperaturen kan overholdes.

I.3.   Indsamling af supplerende diagnostisk materiale

Under forudsætning af det diagnostiske laboratoriums godkendelse kan andet fiskevæv end det i punkt I.1 omhandlede indsamles og præpareres til supplerende undersøgelser.

II.   Detaljerede diagnosemetoder og -procedurer for overvågning af og for at bekræfte forekomst af eller for at udelukke mistanke om ISA

Hvis der foretages laboratorieundersøgelser for at opnå eller opretholde en bestemt sundhedsstatus med hensyn til ISA, jf. bilag I, del 3, afsnit I, eller for at bekræfte forekomst af eller udelukke mistanke om ISA i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 3, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt II.1-II.5 nedenfor.

II.1.   Undersøgelse af prøver ved hjælp af RT-PCR

Den diagnosemetode, der skal anvendes til screening for ISAV, skal være RT-qPCR. Da resultaterne af RT-qPCR kan variere afhængigt af de betingelser, den foretages under, skal der anvendes passende negative og positive kontroller samt amplikon for at undgå enhver tvivl.

II.1.1.   Total RNA-ekstraktion

Alt arbejde med RNA skal udføres på is, og der skal anvendes handsker.

RNA ekstraheres efter phenolchloroformmetoden eller med kolonner til oprensning af RNA i henhold til fabrikantens anvisninger.

RNA skal genopslæmmes i destilleret RNAse-frit vand (dvs. vand, der er behandlet med 0,1 % diethylpyrocarbonat).

Det ekstraherede DNA's koncentration og renhed skal bestemmes ved at måle den optiske densitet ved 260 nm og ved 280 nm. En alternativ fremgangsmåde kan være at inkludere interne kontroller, der er målrettet virusgenomet, jf. punkt II.1.3.

II.1.2.   RT-PCR til ISAV-påvisning

Der kan anvendes flere RT-PCR-metoder til ISAV-genomamplificering. Der kan foretages en totrins-RT-PCR, hvor RT- og PCR-reaktionstrinnene køres i to separate rør. Der kan dog også foretages en ettrins-reaktion, hvor de to reaktioner køres i ét rør. Hvor det er muligt, skal ettrins-metoden anvendes, da risikoen for krydskontaminering mindskes, idet indholdet ikke skal overføres, og denne metode anses for at være lige så sensitiv som totrins-metoden.

Der skal anvendes de primere og analyser, der er beskrevet i dette punkt, dvs. primerparret ILA1 eller ILA2, der er målrettet segment 8, og som er fundet egnet til påvisning af ISAV ved udbrud og hos fisk, der er bærere. Den reverse primer ILA2 matcher ikke isolater fra Nordamerika, og der skal i sådanne tilfælde anvendes et alternativt primersæt.

 

Forward primer (ILA1): 5′-GGCTATCTACCATGAACGAATC-3′

 

Reverse primer (ILA2): 5′-GCCAAGTGTAAGTAGCACTCC-3′.

Cyklusbetingelser: 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 94 °C i 15 minutter, 40 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 72 °C i 60 sekunder; 1 cyklus ved 72 °C i 5 minutter. Produktstørrelse: 155 bp.

Resultaterne af PCR kan variere afhængigt af de betingelser, den udføres under, dvs. der kan være brug for at optimere de termiske protokoller afhængigt af den anvendte termocykler. Endvidere kan der forekomme falsk positive resultater på grund af falsk hybridisering af primer eller laboratoriekontaminering. Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Andre RT-PCR-versioner med dokumenteret tilsvarende effektivitet kan dog også anvendes.

II.1.3.   RT-qPCR til ISAV-påvisning

Anvendelsen af RT-qPCR kan øge specificiteten og muligvis også sensitiviteten. Metoden kan udføres hurtigere, da der ikke kræves gelelektroforese, og den mindsker risikoen for krydskontaminering, da det er muligt at estimere mængden af viralt genomisk RNA i prøverøret. En ulempe ved RT-qPCR-analyse er, at det ofte ikke er muligt at sekventere de amplificerede produkter. Hersker der imidlertid tvivl om det amplificerede produkts specificitet, skal der køres en anden ISAV-specifik analyse for at verificere resultatet.

Den i dette punkt beskrevne analyse, som er en analyse, der er målrettet segment 8, skal anvendes. Denne analyse skal omfatte isolater fra Den Europæiske Union, Den Europæiske Frihandelssammenslutning og Nordamerika. Hvor det er muligt, skal ettrins-metoden anvendes, da metoden med ét rør mindsker risikoen for krydskontaminering.

 

Forward primer: 5′- CTACACAGCAGGATGCAGATGT -3′

 

Reverse primer: 5′- CAGGATGCCGGAAGTCGAT -3′

 

og probe: 5′-FAM- CATCGTCGCTGCAGTTC — MGBNFQ-3′.

Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser: 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 95 °C i 15 minutter, 40 cyklusser ved 94 °C i 15 sekunder, 60 °C i 60 sekunder; justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.

II.1.4.   Sekventering af amplificerede PCR-produkter

 

Forward primer (ILAs6-3F): 5′-ATGAGGGAGGTAGCATTGCA -3′

 

Reverse primer (ILAs6-2R): 5′-CATGCTTTCCAACCTGCTAGGA -3′.

Negative template-kontroller og positive kontroller skal indgå for hver kørsel. Cyklusbetingelser (ettrins-RT-PCR): 1 cyklus ved 50 °C i 30 minutter, 1 cyklus ved 94 °C i 15 minutter, 40 cyklusser ved 94 °C i 30 sekunder, 55 °C i 30 sekunder og 72 °C i 60 sekunder, 1 cyklus ved 72° i 5 minutter; justeres om nødvendigt. Andre RT-PCR- eller RT-qPCR-versioner med dokumenteret tilsvarende effektivitet kan også anvendes.

Alternativt kan følgende metode til sekventering af HPR i segment 6 anvendes:

 

Forward primer: 5′-GAC-CAG-ACA-AGC-TTA-GGT-AAC-ACA-GA-3′

 

Reverse primer: 5′-GAT-GGT-GGA-ATT-CTA-CCT-CTA-GAC-TTG-TA-3′

 

Produktstørrelse: 304 nt hvis HPR0.

RT-PCR-analyser med samme sensitivitet og specificitet som den analyse, der er beskrevet i dette punkt, kan også anvendes.

Det amplificerede RT-PCR-produkts renhed skal kontrolleres ved gelelektroforese inden sekventering. Hvis der kun forekommer ét rent fragment, skal det renses direkte fra PCR-reaktionen. Hvis der forekommer flere amplificerede fragmenter, skal det relevante fragment renses ved gelelektroforese. PCR-fragmenterne skal renses for opløsninger eller agarosegeler ved hjælp af kolonner til oprensning af PCR-fragmenter i henhold til fabrikantens anvisninger.

Sekventering skal foretages med amplificeringsprimere hos eksterne specialiserede sekventeringsvirksomheder. Sekventeringsresultaterne skal analyseres ved hjælp af søgeværktøjet BLAST, og sekvenserne skal sammenlignes med andre kendte sekvenser i nucleotiddatabasen i det amerikanske »National Centre for Biotechnical Information« (NCBI).

Sekventering skal fjerne al tvivl om et amplificeret RT-PCR-produkts specificitet.

II.2.   ISAV-isolation i cellekulturer

II.2.1.   Præparation af prøver

Vævet kan opbevares ved – 80 °C. Vævet må kun fryses og optøs én gang, inden det undersøges. I forbindelse med overvågning og kontrol skal undersøgelsen foretages så hurtigt som muligt.

Hver prøve (samlet vævsprøve i transportvæske) skal homogeniseres fuldstændigt ved hjælp af en valideret homogenisator, centrifugeres ved 2 000 til 4 000 × g i 15 minutter ved 0-6 °C, og supernatanten skal filtreres (0,45 μm) og inkuberes med en tilsvarende mængde passende fortyndet blanding af antiserum mod de indigene serotyper af IPNV. Antiserumtiteren skal være mindst 1:2 000 i en 50 % pladeneutraliseringsprøve. Blandingen inkuberes i 1 time ved 15 °C. Derved opnås inokulummet.

Formålet med at behandle alle inokula med antiserum mod IPN-virus (et virus, som i nogle dele af Europa forekommer i 50 % af alle fiskeprøver) er at hindre, at der udvikles cytopatisk effekt (CPE) som følge af IPN-virus i podede cellekulturer. En sådan behandling kan gennemføres for at nedsætte de virologiske undersøgelsers varighed og antallet af tilfælde, hvor forekomst af CPE ellers måtte opfattes som en potentiel indikation af ISAV. Når prøverne kommer fra produktionsenheder, der anses for at være frie for IPN, kan behandling af inokula med antiserum mod IPN-virus undlades.

II.2.2.   Podning i cellekulturer

Atlantic salmon kidney-celler (ASK-celler) skal anvendes til primær ISAV-isolation. Andre cellelinjer af dokumenteret effektivitet og sensitivitet ved isolation af ISAV kan anvendes under hensyntagen til stammevariabilitet og de forskellige stammers evne til replikation i forskellige cellelinjer. ASK-cellerne synes at støtte isolation og vækst af de hidtil kendte virusisolater, så længe der anvendes et lavt passageniveau. Der kan forekomme en tydeligere cytopatisk effekt i ASK-celler end i andre modtagelige cellelinjer som f.eks. SHK-1 (Salmon Head Kidney-1).

ASK-celler (passage 65 eller derunder) skal dyrkes i et L-15-medium indeholdende 10 % føtalt kvægserum, 2 % (v/v) 200 mM L-glutamin og 0,08 % (v/v) 50 mM 2-mercaptoethanol i multibrøndplader. Antiserumbehandlet organopslæmning podes på unge aktivt voksende cellekulturer, så der fremkommer en slutopløsning af vævsmateriale i dyrkningssubstrat på 1:1 000. For hvert organ tilsættes en opslæmning af 40 μl podemateriale til én brønd med 2 ml dyrkningsmedium. For at mindske risikoen for krydskontaminering skal der anvendes separate plader med 12 eller 24 brønde til prøver fra forskellige akvakulturbrug.

En plade lades upodet, så den kan bruges som negativ kontrol. En separat plade til positiv kontrol podes med et referenceisolat af ISAV på følgende måde: 100 μl af et stampræparat af ISAV (minimumstiter 107 50 % Tissue Culture Infective Dose (TCID50 ml– 1)) podes i den første brønd og omrøres. En mængde af dette materiale overføres fra den første brønd til den anden brønd, så der opnås en fortynding på 1:10, og omrøres. Dette gentages hen over pladen, så der opnås seks ti-fold-fortyndinger. ISAV-stampræparatet kan opbevares ved – 80 °C i mindst to år, men når det er optøet, skal det anvendes i løbet af tre dage. Det skal forhindres, at prøvepladerne krydskontamineres med positivt kontrolmateriale. For at undgå denne risiko skal positive kontroller opstilles og behandles adskilt fra prøvepladerne. Hvis ASK-cellerne gennemgår en sensitivitetstest mod ISAV-isolater hver sjette måned, kan dette erstatte anvendelsen af en positiv kontrol ved hver podning.

Prøverne inkuberes ved 15 ± 2 °C i op til 15 dage. Cellekulturerne skal ved hjælp af et mikroskop undersøges for CPE to gange, nemlig 5-7 dage og 12-14 dage efter podningen. Hvis der i en samleprøve konstateres CPE, skal der straks foretages virusidentifikation i overensstemmelse med punkt II.2.4. Hvis der den 14. dag ikke er konstateret CPE, skal der foretages en IFAT, en hæmadsorptionstest eller en RT-PCR.

II.2.3.   Subkultivering

Subkultivering foretages fra dag 13-15. Cellekulturens supernatant tilsættes til brønde indeholdende friske aktivt voksende celler i passende opløsning (1/10) i multibrøndplader og inkuberes ved 14 ± 2 °C i op til 18 dage. Cellekulturerne skal ved hjælp af et mikroskop undersøges for CPE to gange, nemlig 5-7 dage og 14-18 dage efter podningen. Hvis der i en samleprøve konstateres CPE, skal der straks foretages virusidentifikation i overensstemmelse med punkt II.2.4. Hvis der i perioden fra dag 14 til dag 18 ikke konstateres CPE, skal der foretages en hæmadsorptionstest eller en RT-PCR.

Hvis der inden for de første syv inkubationsdage optræder cytotoksicitet, skal der på dette tidspunkt foretages subkultivering, og cellerne inkuberes i 14-18 dage og subkultiveres igen med yderligere inkubation i 14-18 dage. Hvis der optræder cytotoksicitet efter den syvende dag, skal der foretages subkultivering én gang, og cellerne inkuberes, indtil den samlede inkubationsperiode fra primærpodningen er på 28-36 dage.

Hvis der optræder bakteriekontamination i primærkulturen, skal testen foretages på ny under anvendelse af det ved – 80 °C opbevarede vævshomogenat. Inden podningen centrifugeres vævshomogenatet ved 4 000 × g i 15-30 minutter ved 0-6 °C, og supernatanten filtreres gennem et 0,22 μm filter. Hvis bakteriekontaminationen optræder under subkultiveringen, filtreres supernatanten gennem et 0,22 μm filter, podes på friske celler og inkuberes i yderligere 14-18 dage.

II.2.4.   Virusidentifikationstest

Hvis der på noget tidspunkt konstateres tegn på CPE, eller hvis en hæmadsorptionstest er positiv, skal der foretages virusidentifikation. De metoder, der vælges til identifikation af ISAV, skal være RT-PCR i overensstemmelse med punkt II.1 og immunfluorescens (IF) i overensstemmelse med punkt II.2.6. Hvis det formodes, at andre virus kan være til stede, skal der foretages supplerende virusidentifikationstest. Hvis sådanne test ikke i løbet af en uge har ført til en definitiv identifikation af virusset, skal supernatanten sendes til et af følgende laboratorier med henblik på øjeblikkelig identifikation:

a)

OIE's (Verdensorganisationen for Dyresundhed) referencelaboratorium for ISA eller

b)

et nationalt referencelaboratorium eller EU-referencelaboratoriet for fiskesygdomme, jf. bilag VI til direktiv 2006/88/EF.

II.2.5.   Hæmadsorption

Da replikation af ISAV i cellekulturer ikke altid resulterer i CPE, skal hver brønd underkastes en RT-PCR-test eller en hæmadsorptionstest i overensstemmelse med nærværende punkt eller en IF-test i overensstemmelse med punkt II.2.6.

Celledyrkningsmediet fjernes fra hver brønd, også fra dem til positiv og negativ kontrol, og anbringes i sterile mærkede rør. 500 μl af en 0,2 % (v/v) opløsning af vaskede røde blodlegemer fra kanin eller hest eller en 0,05 % (v/v) opløsning af vaskede røde blodlegemer fra regnbueørred eller atlantisk laks tilsættes i hver brønd og inkuberes ved rumtemperatur i 45 minutter. Derefter fjernes de røde blodlegemer, og hver brønd vaskes to gange med L-15-medium. Hver brønd undersøges ved hjælp af et mikroskop.

Forekomst af ansamlinger af røde blodlegemer på overfladen af ASK-celler tages som tegn på en formodet infektion med en orthomyxovirus. Hvis en hæmadsorptionstest er positiv, skal der straks foretages en virusidentifikationstest i overensstemmelse med punkt II.2.4.

II.2.6.   Immunfluorescens (IF)

ASK-celler (passage 65 eller derunder) dyrkes i L-15-medium indeholdende 10 % føtalt kvægserum, 2 % (v/v) 200 mM L-glutamin og 0,08 % (v/v) 50 mM 2-mercaptoethanol i multibrøndplader med mere end 50 % sammenflydning. Andre cellelinjer eller vækstmedium af dokumenteret effektivitet kan også anvendes. 225 μl supernatant af den kultur, der formodes inficeret med virus, tilsættes til hver af to brønde og omrøres, hvorefter 225 μl overføres til to yderligere brønde (en fortynding på 1:5). To yderligere brønde lades upodede, så de kan fungere som kontroller. Prøver fra de enkelte akvakulturbrug skal behandles på separate plader, og det samme gælder viruskontrollen. Der etableres en viruskontrol ved hjælp af et referenceisolat af ISAV.

Pladerne inkuberes ved 14 ± 2 °C og undersøges mikroskopisk i op til syv dage. Hvis tidlig CPE konstateres, eller hvis der ikke i løbet af syv dage konstateres CPE, er næste skridt fiksering. Brøndene vaskes med phosphat-bufferet saltopløsning (PBS) og fikseres ved inkubation med 80 % acetone i 20 minutter ved rumtemperatur. Pladerne lufttørres og farves med det samme eller efter højst 24 timers opbevaring ved 0-6 °C.

Replikationsbrønde farves med en blanding af monoklonale antistoffer (MAb) 3H6F8 og 1OC9F5 mod ISAV eller et andet MAb af dokumenteret effektivitet og specificitet, opløst i PBS, og inkuberes ved 37 ± 4 °C i 30 minutter. MAb fjernes, og pladerne vaskes tre gange med 0,05 % Tween 20 i PBS. Et anti-muse-IgG-FITC-konjugat opløst i PBS tilsættes til hver brønd og inkuberes ved 37 ± 4 °C i 30 minutter. Opløsningerne af forskellige batcher af MAb og FITC-konjugat optimeres i hvert laboratorium. Antistoffet fjernes, og pladerne vaskes tre gange med 0,05 % Tween 20 i PBS.

Brøndene undersøges straks ved hjælp af et inverteret mikroskop forberedt til fluorescensmikroskopi med et filter egnet til excitering af FITC. En test betragtes som positiv, hvis der iagttages fluorescerende celler. For at en test er gyldig, skal de positive kontroller give positivt resultat og de negative kontroller give negativt resultat.

II.3.   Undersøgelse af andet væv

Den i punkt II.2.6 omhandlede metode kan anvendes for andet fiskevæv såsom lever, milt og hjerte, forudsat at en rimelig mængde endoteliale celler, leukocytter eller lymfocytter kan anbringes på objektglasset. Farvningsmetoden er den samme for alt væv, idet det dog for nogle former for væv kan være at foretrække at undgå farvning med propidiumjodid og i stedet anvende fasebelysning ved identifikationen af de celletyper, der forekommer i aftrykket.

II.4.   Histologi

De i paraffin indstøbte snit skæres i 5 μm tynde skiver og farves med hæmatoxylin og eosin.

De histologiske ændringer i klinisk syg atlantisk laks varierer, men de kan omfatte følgende:

a)

talrige erytrocytter i den centrale venøse sinus og gællernes lamellære kapillærer, hvor der også kan dannes tromber af erytrocytter

b)

multifokale til sammenflydende petekkier eller nekrose af hepatocytter eller begge dele i nogen afstand fra de større blodkar i leveren; multifokal akkumulering af erytrocytter i dilaterede sinusoider i leveren

c)

akkumulering af erytrocytter i blodkarrene i tarmens lamina propria, eventuelt resulterende i blødninger i lamina propria

d)

miltens stroma udspilet på grund af akkumulering af erytrocytter

e)

let multifokal til meget udbredt interstitiel blødning med tubulær nekrose i de blødende områder og akkumulering af erytrocytter i glomeruli i nyren

f)

erytrofagocytose i milten og sekundære blødninger i lever og nyre.

II.5.   Immunhistokemi (IHC)

Polyklonale antistoffer mod ISAV-nukleoprotein anvendes på paraffinsnit fra formalinfikseret væv. De organer, som skal undersøges, er mellemnyre og hjerte (overgangsområde inklusive alle tre kamre og klapper). Mistanke som følge af patologiske tegn skal verificeres med en positiv IHC. Histologiske snit skal præpareres i overensstemmelse med standardmetoder.

1)

Præparation af vævssnit

Væv fikseres i neutral phosphat-bufferet 10 % formalin i mindst 1 dag, dehydreres i ethanol i stigende koncentrationer, klares i xylen og indstøbes i paraffin i henhold til standardprotokollerne. Ca. 5 μm tykke snit (for IHC anbragt på poly-L-lysin-belagte objektglas) opvarmes ved 56-58 °C (højst 60 °C) i 20 minutter, voksen fjernes i xylen, snittene rehydreres i ethanol i faldende koncentrationer og farves med hæmatoxylin og eosin med henblik på patomorfologi og IHC i overensstemmelse med nr. 2).

2)

Farvningsmetode for IHC

Alle inkubationer foretages ved rumtemperatur på et vippebord, medmindre andet er fastsat i denne afgørelse:

a)

Udtræk af antigen foretages ved at koge snittene i 0,1 M citratbuffer (pH 6,0) i 2 × 6 minutter efterfulgt af blokering med 5 % fedtfri tørmælk og 2 % gedeserum i 50 mM TBS (TBS; Tris/HCl 50 mM, NaCl 150 mM, pH 7,6) i 20 minutter.

b)

Derefter inkuberes snittene natten over med primært antistof (monospecifikt kaninantistof mod ISAV-nukleoprotein) opløst i TBS med 1 % fedtfri tørmælk efterfulgt af tre skylninger med TBS med 0,1 % Tween 20.

c)

Til påvisning af bundne antistoffer skal snittene inkuberes med antistoffer mod kanin-IgG, der er konjugeret med alkalisk phosphatase, i 60 minutter. Efter en sidste vaskning tilsættes Fast Red (1 mg ml– 1) og naphthol-AS-MX-phosphat (0,2 mg ml– 1) med 1 mM levamisol i 0,1 M TBS (pH 8,2); lad det udvikle sig i 20 minutter. Derefter vaskes snittene i ledningsvand inden kontrastfarvning med Harris-hæmatoxylin og monteres i vandigt monteringsmedium. ISAV-positive og ISAV-negative vævssnit skal indgå som kontroller ved hver udførelse.

3)

Fortolkning af resultaterne af IHC

Resultaterne af IHC-testen fortolkes som anført i litra a) og b):

a)

Kontrolsnittene anses for positive, når det konstateres, at kontrolsnittene har en klart synlig rød (rødlig) cytoplasmatisk og intranukleær farvning af endotelcellerne i endokardiets blodkar. Et prøvesnit anses kun for positivt, hvis der forekommer en sådan klar intranukleær rødfarvning af endotelcellerne.

b)

Kontrolsnit anses for negative, hvis de ikke har nogen markante farvereaktioner.

Da den intranukleære placering er specifik for orthomyxovirussets nukleoprotein i en fase af virusreplikationen, mens samtidig cytoplasmisk farvning ofte er dominerende, skal cytoplasmiske og andre farvningsmønstre uden intranukleær placering anses for ikkespecifikke eller inkonklusive.

De stærkeste positive farvningsreaktioner opnås normalt i endotelceller fra hjerte og nyre. Ved meget omfattende hæmoragiske læsioner kan endotel-farvningsreaktionerne være svage eller fraværende, muligvis på grund af lysis af inficerede endotelceller.

DEL 4

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTION MED MARTEILIA REFRINGENS

I.   Detaljerede diagnosemetoder og -procedurer for diagnose af infektion med Marteilia refringens

Hvis der foretages prøveudtagning og laboratorieundersøgelse med henblik på at opnå eller opretholde en sundhedsstatus med hensyn til infektion med Marteilia refringens, jf. bilag I, del 4, afsnit I, eller for at bekræfte eller udelukke forekomst af denne listeopførte sygdom i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 4, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1, I.2 og I.3.

I.1.   Prøveudtagningsprocedure

Bløddyr med åbne skaller eller nyligt døde bløddyr skal prioriteres ved prøveudtagningen for at øge chancerne for at finde inficerede dyr.

De indsamlede østers eller muslinger opbevares ved 4 °C eller på køleis i højst 24 timer, hvis der er bløddyr med åbne skaller, og højst 72 timer, hvis dette ikke er tilfældet; de skal opbevares i en plastpose med en etiket med oplysninger om østernes eller muslingernes art og oprindelse. Bløddyr med åbne skaller eller nyligt døde bløddyr skal opbevares adskilt fra andre bløddyr.

Et 3-5 mm tykt vævssnit, der omfatter væv fra hjerte og gæller, skal anvendes til diagnosticering af Marteilia refringens ved hjælp af histologi. Et stykke af fordøjelseskirtlen skal anvendes til visse test, bl.a. aftryk og polymerasekædereaktion (PCR).

I.2.   Mikroskopiske teknikker

I.2.1.   Cytologi (aftrykscytologi)

Efter tørring af væv fra fordøjelseskirtlen på absorberende papir skal der tages en række aftryk på et objektglas. Objektglassene skal lufttørres, fikseres i methanol eller i absolut ethanol og farves med et kommercielt tilgængeligt kit til farvning af blod, f.eks. Diff-Quick®/Hemacolor®, i henhold til fabrikantens anvisninger. Efter skylning i ledningsvand og tørring skal objektglassene monteres med dækglas ved hjælp af en egnet syntetisk harpiks. Dækglassene observeres først ved 200 × forstørrelse og derefter i immersionsolie ved 1 000 × forstørrelse.

Et positivt resultat er iagttagelse af celler i størrelser på op til 30-40 μm. Cytoplasmaet farves basofilt, mens cellekernen farves eosinofilt. Der observeres lyse haloer rundt om store stærkt farvede (lysbrydende) granula og celler intracellulært i større celler.

Teknikken er ikke artsspecifik for parasitter.

I.2.2.   Histologi

Vævssnit, som omfatter gæller, fordøjelseskirtel, kappe og gonade, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin og farvning, f.eks. med hæmatoxylin og eosin. Der foretages observationer ved stadig kraftigere forstørrelse op til 1 000 ×.

Et positivt resultat er iagttagelse af celler i størrelser på 4-40 μm. De tidlige stadier består af multinukleære celler, som er sfæriske til aflange. Disse findes først og fremmest i epitel fra spiserør og mave og undertiden fra læbeflige. Sporedannelse omfatter celledelinger inden i celler og foregår i fordøjelseskirtlens tubuli og ducti. Lysbrydende granula forekommer i forbindelse med sporedannelsen, men observeres ikke i de tidlige stadier. I infektionens sene stadier iagttages der frie sporangia i lumen i fordøjelseskanalen. Cytoplasmaet farves basofilt, mens cellekernen farves eosinofil. Farvningen af granula kan gå fra dybt orange til dybrød.

Teknikken er ikke artsspecifik for parasitter.

I.3.   Molekylære teknikker

I.3.1.   DNA-ekstraktion

DNA skal ekstraheres i henhold til standardprocedurerne.

Der kan anvendes DNA-ekstraktionskit, der er kommercielt tilgængelige og normalt giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er beskrevet i punkt I.3.2.

I.3.2.   Polymerasekædereaktion (PCR)

Der er udarbejdet og offentliggjort en række PCR-protokoller.

Der skal anvendes PCR-primere, der er målrettet ITS1-regionen (ITS = internal transcribed spacer), da de er i stand til kun at amplificere M. refringens.

PCR skal foretages i en mængde på 50 μl. PCR-blandinger skal indeholde buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 ved 25 °C] og 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward og reverse primere, 0,02 enheder μl– 1 Taq DNA-polymerase og 10-100 ng ekstraheret DNA. Efter denaturering af DNA ved 94 °C i fem minutter, skal der køres 30 cyklusser som følger: denaturering ved 94 °C i ét minut, hybridisering ved 55 °C i ét minut og elongering ved 72 °C i ét minut pr. kilobasepar. Der foretages en endelig elongering i 10 minutter ved 72 °C. Til påvisning af M. refringens foretages der PCR med primere, der er målrettet ITS1-regionen (5′-CCG-CAC-ACG-TTC-TTC-ACT-CC-3′ og 5′-CTC-GCG-AGT-TTC-GAC-AGA-CG-3′).

Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen.

Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA.

Et positivt resultat er positiv PCR-amplificering i den forventede størrelse (412 bp), idet alle negative kontroller skal være negative, og alle positive kontroller positive.

I.3.3.   In-situ-hybridisering (ISH)

Der er udarbejdet og offentliggjort en række ISH-protokoller.

Der skal anvendes den probe, der er målrettet rRNA-genkompleksets SSU, fordi det er valideret i forhold til histologi.

Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin. Snit på 5 μm skæres og anbringes på aminoalkylsilan-belagte objektglas, som derefter opvarmes natten over i en ovn ved 40 °C. Voksen fjernes ved at nedsænke snittene i xylen i 10 minutter. Dette trin skal gentages én gang, og derefter skal opløsningsmidlet fjernes ved nedsænkning i to på hinanden følgende bade med absolut ethanol af 10 minutters varighed hver. Derefter dehydreres snittene ved nedsænkning i ethanol i stigende koncentrationer. Snittene behandles med proteinase K (100 μg ml–1) i TE-buffer (Tris [50 mM], EDTA [10 mM]) ved 37 °C i 30 minutter. Objektglassene dehydreres ved nedsænkning i ethanol i stigende koncentrationer og lufttørres derefter. Snittene inkuberes med 100 μl hybridiseringsbuffer (4 × SSC [standardsaltcitrat], 50 % formamid, 1 × Denhardts opløsning, 250 μg ml–1 gær-tRNA, 10 % dextransulphat) indeholdende 10 ng (1 μl af de PCR-reaktanter, der er præpareret som beskrevet i punkt I.3.2 ved hjælp af primerne CCG-GTG-CCA-GGT-ATA-TCT-CG og TTC-GGG-TGG-TCT-TGA-AAG-GC) af den digoxigenin-mærkede probe. Snittene dækkes med in-situ-dækglas af plast og anbringes på en varmeblok ved 95 °C i fem minutter. Objektglassene afkøles derefter på is i ét minut inden hybridisering natten over ved 42 °C i et fugtkammer. Snittene vaskes 2 × 5 minutter i 2 × SSC ved rumtemperatur og 1 × 10 minutter i 0,4 × SSC ved 42 °C. Påvisningen skal udføres i henhold til fabrikantens anvisninger. Objektglassene skylles derefter i sterilt destilleret vand (dH2O). Snittene kontrastfarves med Bismarck Brown Yellow og skylles i dH2O, og dækglassene placeres ved hjælp af et vandigt monteringsmedium.

Positive og negative kontroller skal være snit fra henholdsvis kendte inficerede og kendte ikkeinficerede værter.

Et positivt resultat vises ved sort-lilla mærkning af M. refringens-celler i kendte målvæv, idet alle negative kontroller skal være negative, og alle positive kontroller positive.

I.3.4.   Sekventering

Sekventering foretages som et af de sidste trin ved diagnosebekræftelse. Målregioner er SSU rDNA og ITS1.

II.   Detaljerede diagnosemetoder og -procedurer for overvågning og bekræftelse af infektion med Marteilia refringens

I forbindelse med overvågningsprogrammer og for at bekræfte forekomst af infektion med Marteilia refringens eller for at udelukke mistanke om denne listeopførte sygdom i overensstemmelse med kravene i bilag I, del 4, afsnit II, skal de diagnosemetoder og tilhørende procedurer, der skal anvendes, følge de retningslinjer, der er fastsat i tabel 4.1.

Tabel 4.1

Retningslinjer for anvendelse af diagnosemetoder for overvågningsprogrammerne og til bekræftelse eller udelukkelse af infektion med Marteilia refringens

Metode

Målrettet overvågning

Sandsynlig diagnose

Bekræftende diagnose

Aftryk af fordøjelseskirtel

X

X

X eller

Histopatologi

X

 

X eller

In situ-hybridisering

 

 

X og

PCR

X

X

X og

Sekventering

 

 

X

DEL 5

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF INFEKTION MED BONAMIA OSTREAE

I.   Procedurer for diagnose af infektion med Bonamia ostreae

Hvis der foretages prøveudtagning og laboratorieundersøgelse for at opnå eller opretholde en bestemt sundhedsstatus med hensyn til Bonamia ostreae, jf. bilag I, del 5, afsnit I, eller for at bekræfte eller udelukke forekomst af denne listeopførte sygdom i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 5, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt I.1, I.2 og I.3 nedenfor.

I.1.   Prøveudtagningsprocedure

Bløddyr med åbne skaller eller nyligt døde bløddyr skal prioriteres ved prøveudtagningen for at øge chancerne for at finde inficerede dyr.

De indsamlede østers opbevares ved 4 °C eller på køleis i højst 24 timer, hvis der er bløddyr med åbne skaller, og 72 timer, hvis dette ikke er tilfældet; de skal opbevares i en plastpose med en etiket med oplysninger om østernes art og oprindelse. Bløddyr med åbne skaller eller nyligt døde bløddyr skal opbevares adskilt fra andre bløddyr.

Et 3-5 mm tykt vævssnit, der omfatter væv fra hjerte og gæller, skal anvendes til diagnosticering af Bonamia ostreae ved hjælp af histologi. Et stykke af fordøjelseskirtlen skal anvendes til visse test, bl.a. aftryk og polymerasekædereaktion (PCR).

I.2.   Mikroskopiske teknikker

I.2.1.   Cytologi (aftrykscytologi)

Efter tørring af væv fra gæller eller hjerte på absorberende papir skal der tages en række aftryk på et objektglas. Objektglassene skal lufttørres, fikseres i methanol eller i absolut ethanol og farves med et kommercielt tilgængeligt kit til farvning af blod (f.eks. Diff-Quick®/Hemacolor®) i henhold til fabrikantens anvisninger. Efter skylning i ledningsvand og tørring skal objektglassene monteres med dækglas ved hjælp af en egnet syntetisk harpiks. Dækglassene observeres først ved 200 × forstørrelse og derefter i immersionsolie ved 1 000 × forstørrelse.

Et positiv resultat er forekomst af små sfæriske eller ovoide organismer (2-5 μm brede) inden i hæmocytterne. Parasitten kan dog også forekomme ekstracellulært. Disse organismer har et basofilt cytoplasma og en eosinofil cellekerne (farverne kan variere afhængigt af den anvendte farve), og fordi de spredes ud på objektglasset, kan de virke bredere på aftryk end ved histologisk undersøgelse. Der kan iagttages multinukleære celler. Teknikken er ikke artsspecifik for parasitter.

I.2.2.   Histologi

Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin og farvning, f.eks. med hæmatoxylin og eosin. Der foretages observationer ved stadig kraftigere forstørrelse op til 1 000 ×.

Et positivt resultat er forekomst af parasitter som meget små celler, der er 2-5 μm brede, inden i hæmocytterne eller frie i bindevævet eller sinus i gæller, tarm og kappeepitel, hvilket ofte kædes sammen med en intensiv inflammatorisk reaktion. For at undgå enhver tvivl skal parasitten iagttages inden i hæmocytten med henblik på en positiv diagnose. Teknikken er ikke artsspecifik for parasitter.

I.3.   Molekylære teknikker

I.3.1.   DNA-ekstraktion

DNA skal ekstraheres i henhold til standardprocedurerne.

Der kan anvendes DNA-ekstraktionskit, der er kommercielt tilgængelige og normalt giver DNA af høj kvalitet, som er egnet til anvendelse med de PCR-protokoller, der er beskrevet nedenfor.

I.3.2.   Polymerasekædereaktion (PCR)

Der er udarbejdet og offentliggjort en række PCR-protokoller.

Der kan anvendes to PCR-protokoller, der er målrettet den lille underenhed (SSU) af rDNA:

a)

Den første er en konventionel PCR, der amplificerer adskillige medlemmer af Haplosporidia, herunder Bonamia spp. Primerne, som betegnes Bo og Boas, er henholdsvis 5′-CAT-TTA-ATT-GGT-CGG-GCC-GC-3′ og 5′-CTG-ATC-GTC-TTC-GAT-CCC-CC-3′ og amplificerer et produkt på 300 bp. PCR-blandinger indeholder buffer (500 mM KCl, 100 mM Tris/HCl [pH 9,0 ved 25 °C] og 1 % Triton® X-100), 2,5 mM MgCl2, 0,2 mM dNTP mix, 1 μM forward og reverse primere, 0,02 enheder μl–1 Taq DNA-polymerase og 0,2 ng μl–1 af DNA-templatet i en samlet mængde på 50 μl. Prøverne denatureres i en thermocykler i fem minutter ved 94 °C efterfulgt af 30 cyklusser (94 °C i ét minut, 55 °C i et minut, 72 °C i ét minut) med en afsluttende elongering i 10 minutter ved 72 °C.

Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen.

Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA.

Et positivt resultat er positiv PCR-amplificering i den forventede størrelse (dvs. 300 bp), idet alle negative kontroller skal være negative, og alle positive kontroller positive.

b)

Den anden PCR-protokol er en SYBR® Green realtids-PCR-metode. Den gør det muligt at påvise B. ostreae (beskrevet nedenfor) og kan kombineres med en SYBR® Green realtids-PCR-analyse, som gør det muligt at påvise B. exitiosa (Ramilo et al. 2013).

Primerne BOSTRE-F (5′- TTACGTCCCTGCCCTTTGTA-3′) og BOSTRE-R (5′- TCGCGGTTGAATTTTATCGT-3′) amplificerer et produkt på 208 bp. PCR-blandinger indeholder SYBR® Green Master Mix (1X), 0,3 μM forward og reverse primere og 200 ng ekstraheret DNA. Prøverne denatureres i et Real Time Detection System i 10 minutter ved 95 °C efterfulgt af 35 cyklusser (95 °C i 30 sekunder, 55 °C i 45 sekunder og 72 °C i ét minut). Kurven over smeltetemperaturen skal analyseres med temperaturstigninger på 0,5 °C/s begyndende ved 55 °C og indtil 95 °C, idet fluorescens registreres ved hver temperaturændring.

Positive kontroller skal bestå af genomisk DNA fra en stærkt inficeret vært eller plasmid-DNA inklusive målregionen.

Negative kontroller skal bestå af genomisk DNA fra ikkeinficerede værter og PCR-reagenser uden mål-DNA.

Et positivt resultat er positiv PCR-amplificering med en unik maksimal smeltetemperatur (78,25 ± 0,25 °C under de betingelser, som er publiceret af Ramilo et al. 2013), idet alle negative kontroller er negative, og alle positive kontroller positive.

I.3.3.   In-situ-hybridisering (ISH)

Der er udarbejdet og offentliggjort række ISH-protokoller.

Der skal anvendes en probe målrettet rDNA-genkompleksets SSU, selv om den har vist sig at krydsreagere med visse andre medlemmer af Haplosporidia-familien.

Vævssnit, som omfatter gæller og fordøjelseskirtel, fikseres i mindst 24 timer i Davidsons fikseringsmiddel efterfulgt af normal behandling for histologi med paraffin. Snit på 5 μm skæres og anbringes på aminoalkylsilan-belagte objektglas, som derefter opvarmes natten over i en ovn ved 40 °C. Voksen fjernes ved at nedsænke snittene i xylen i 10 minutter. Dette trin skal gentages én gang, og derefter skal opløsningsmidlet fjernes ved nedsænkning i to på hinanden følgende bade med absolut ethanol af 10 minutters varighed hver. Derefter dehydreres snittene ved nedsænkning i ethanol i stigende koncentrationer. Snittene behandles med proteinase K (100 μg ml– 1) i TE-buffer (Tris [50 mM], EDTA [10 mM]) ved 37 °C i 30 minutter. Objektglassene dehydreres ved nedsænkning i ethanol i stigende koncentrationer og lufttørres derefter. Snittene inkuberes med 100 μl af hybridiseringsbuffer (4 × SSC [standardsaltcitrat], 50 % formamid, 1 × Denhardts opløsning, 250 μg ml– 1 gær-tRNA, 10 % dextransulphat) indeholdende 20 ng (2 μl af PCR-reaktionen, der er præpareret som beskrevet i punkt I.3.2 ved hjælp af primerne Bo og Boas) af den digoxigenin-mærkede probe. Snittene dækkes med in-situ-dækglas af plastik og anbringes på en varmeblok ved 95 °C i fem minutter. Objektglassene afkøles derefter på is i ét minut inden hybridisering natten over ved 42 °C i et fugtkammer. Snittene vaskes 2 × 5 minutter i 2 × SSC ved rumtemperatur og 1 × 10 minutter i 0,4 × SSC ved 42 °C. Påvisningen skal udføres i henhold til fabrikantens anvisninger. Objektglassene skylles derefter i sterilt destilleret vand (dH2O). Snittene kontrastfarves med Bismarck Brown Yellow og skylles i dH2O, og dækglassene placeres ved hjælp af et vandigt monteringsmedium.

Positive og negative kontroller skal være snit fra henholdsvis kendte inficerede og kendte ikkeinficerede værter.

Et positivt resultat skal svare til de mærkede parasitter inden i hæmocytterne, idet alle negative kontroller skal være negative, og alle positive kontroller positive.

I.3.4.   Sekventering

Sekventering foretages som et af de sidste trin ved diagnosebekræftelse. Målregioner er SSU rDNA og ITS1.

II.   Procedurer for overvågning og bekræftelse af infektion med Bonamia ostreae

I forbindelse med overvågning og bekræftelse af forekomst af eller for at udelukke mistanke om infektion med Bonamia ostreae i overensstemmelse med kravene i bilag I, del 5, afsnit II, skal de diagnosemetoder og tilhørende procedurer, der skal anvendes, følge de retningslinjer, der er fastsat i tabel 5.1.

Tabel 5.1

Retningslinjer for anvendelse af diagnosemetoder for overvågningsprogrammerne og til udelukkelse eller bekræftelse af infektion med Bonamia ostreae

Metode

Målrettet overvågning

Sandsynlig diagnose

Bekræftende diagnose

Aftryk af hjerte eller gæller

X

X

X eller

Histopatologi

X

 

X eller

In situ-hybridisering

 

 

X og

PCR

X

X

X og

Sekventering

 

 

X

DEL 6

DETALJEREDE DIAGNOSEMETODER OG -PROCEDURER FOR OVERVÅGNING OG BEKRÆFTELSE AF WHITE SPOT DISEASE (WSD)

1.   Diagnoseprocedurer for påvisning af WSSV

Hvis der foretages prøveudtagning og laboratorieundersøgelse i forbindelse med overvågnings- og udryddelsesprogrammerne i bilag I, del 6, afsnit I, for at bekræfte forekomst af eller udelukke mistanke om infektion med WSSV i overensstemmelse med artikel 57, litra b), i direktiv 2006/88/EF ved hjælp af diagnosemetoderne i bilag I, del 6, afsnit II, anvendes de detaljerede diagnosemetoder og -procedurer i punkt 2-7 nedenfor.

De metoder og procedurer, der er beskrevet i denne del af bilag II, er udarbejdet på grundlag af ISO 17025-akkrediterede test, som anvendes på EU-referencelaboratoriet for krebsdyrsygdomme. Der kan anvendes alternative tilgange, hvor der bruges tilsvarende betingelser eller kit, som er produceret af forskellige fabrikanter, men som giver en sensitivitet og specificitet svarende til dem, der er beskrevet i denne del. Det PCR-amplificerede produkt skal altid sekventeres for at bekræfte WSSV.

2.   Prøveudtagningsprocedure

Væv (pleopoder og gæller) indeholdende WSSV fra krebsdyr kan opbevares i ethanol eller RNAlater eller lynfryses ved – 80 °C. Følgende trin kræves for at identificere WSSV fra vævsprøver: homogenisering af vævet, ekstraktion af DNA'et, specifik amplificering af WSSV-DNA'et ved hjælp af PCR, visualisering af det amplificerede produkt på en gel, rensning af DNA'et og sekventering for at bekræfte patogenets identitet.

3.   Vævshomogenisering

Findeling af væv og tilberedning af et homogenat i en passende buffer foretages ved hjælp af Fast Prep-vævshomogenisator og Lysing Matrix A-rør (MP Biomedicals). Vævet vejes, anbringes i Lysing Matrix A-rør, fortyndes 1:10 w/v eller i henhold til fabrikantens anvisninger i en passende buffer (G2 og 10 μl proteinase K til anvendelse med DNA Tissue kit (Qiagen)) og homogeniseres med Fast Prep 24-homogenisator i to minutter. Homogeniserede prøver skal inkuberes ved 56 °C i mindst fire timer eller natten over. Prøverne vortexes og centrifugeres ved 9 000 rpm i to minutter, og 50 μl supernatant eller en mængde svarende til 5 mg væv (den vævsvægt, som er optimal for ekstraktionskittet) tilsættes til et prøverør til DNA-ekstraktion, og der fyldes op med G2 buffer til en volumen på i alt 200 μl.

4.   DNA-ekstraktion

Det totale DNA skal ekstraheres med et DNA-ekstraktionskit til væv og EZ1 Advanced XL Biorobot (Qiagen) i henhold til fabrikantens anvisninger. For hver batch af prøver medtages en ekstraktionskontrol (kalvethymus-DNA) og en negativ kontrol (G2-buffer). DNA elueres i en mængde på 50 μl. For at sikre, at ekstraktionen er lykkedes, skal DNA-koncentrationen for alle prøver og kontroller bestemmes ved hjælp af en Nano Drop-maskine. Ekstraheret DNA fryses ved – 20 °C, hvis det ikke skal anvendes med det samme.

5.   WSSV-polymerasekædereaktion (PCR)

Den metode, der skal anvendes til påvisning af WSSV, er protokollen for påvisning af WSSV ved hjælp af nested PCR, som beskrives i de følgende afsnit, og som amplificerer 18s rRNA-genets 1 447 bp- og 848 bp-amplikon i henholdsvis første og anden PCR-runde.

Den første PCR-reaktionsrunde udføres i en volumen på 50 μl, som indeholder endelige koncentrationer af 1 × GoTaq Buffer (Promega), 5 mM MgCl2, 1 pmol/μl WSSV 146 F1 primer, 1 pmol/μl WSSV 146 R1 primer (tabel 1), 0,25 mM dNTPs, 1,25U Taq polymerase og 2,5 μl DNA. Hver prøve køres i duplikat sammen med en negativ ekstraktionskontrol, en negativ PCR-kontrol (tilsat 2,5 μl H2O i stedet for DNA) og en positiv kontrol. Den positive kontrol skal være fortyndet WSSV-plasmid, der er fremstillet og valideret til brug i laboratoriet (fås hos EU-referencelaboratoriet).

Anden WSSV-PCR-reaktionsrunde udføres på samme måde som første runde, men med WSSV 146 F2/R2-primersættet og med yderligere en positiv kontrol for at tjekke, om dette trin i PCR har virket.

Primer

Sekvens

WSSV 146 F1

ACTACTAACTTCAGCCTATCTAG

WSSV 146 R1

TAATGCGGGTGTAATGTTCTTACGA

WSSV 146 F2

GTAACTGCCCCTTCCATCTCCA

WSSV 146 R2

TACGGCAGCTGCTGCACCTTGT

Både første og anden PCR-runde udføres under følgende cyklusbetingelser på en DNA Engine Tetrad 2 Peltier-thermocykler (eller tilsvarende). En første denaturering ved 94 °C i to minutter efterfulgt af 94 °C i 30 sekunder, 62 °C i 30 sekunder, 72 °C i 30 sekunder gentaget 30 gange, en elongering ved 72 °C i to minutter og fastholdes ved 4 °C.

6.   Gelelektroforese

Amplificerede PCR-produkter fra både første og anden PCR-runde skal visualiseres på 2 % agarosegel med TAE-buffer. 15 μl af hver prøve køres ved 120 volt i ca. 20 minutter og undersøges under UV-lys. Positive prøver vil give et bånd på 1 447 bp i første PCR-runde og 848 bp i anden PCR-runde. Prøver af denne størrelse skal udskæres og anbringes i et 1,5 ml mikrocentrifugeglas. Det DNA, som findes i gelstykkerne, renses med Promega Wizard® SV Gel og PCR Clean-Up System i henhold til fabrikantens anvisninger. DNA-koncentrationen bestemmes ved hjælp af en NanoDrop-maskine. Det rensede DNA skal fryses ved 20 °C, hvis det ikke skal anvendes med det samme.

7.   Sekventering af PCR-produkter

DNA sekventeres med BigDye Terminator Kit v3,1 (Applied Biosystems). Den samlede volumen i hver reaktion er 20 μl, idet de endelige koncentrationer er 1 × BigDye Terminator, 1 × sekventeringsbuffer, 10 pmol/μl forward eller reverse primer og 10 μl renset DNA (fortyndet til ca. 10 ng/μl); følgende cyklusbetingelser anvendes på en DNA Engine Tetrad 2 Peltier Thermal Cycler (eller tilsvarende): 94 °C i 30 sekunder efterfulgt af 96 °C i 10 sekunder, 50 °C i 10 sekunder og 60 °C i fire minutter, idet de sidste tre trin gentages 30 gange.

PCR-produkterne udfældes ved hjælp af en natriumacetatmetode, hvor 20 μl DNA tilsættes til 10 μl NaAc, 70 μl H2O og 250 μl ethanol, vortexes og centrifugeres ved 13 000 rpm i 20 minutter, supernatanten fjernes, og pelleten vaskes med 200 μl absolut ethanol efterfulgt af centrifugering ved 13 000 rpm i fem minutter. Pelleten tørres i 5 minutter ved 37 °C. Pelleterne tilsættes 25 μl Hi-Di-formamid, opvarmes til 95 °C i to minutter og vortexes grundigt. Prøverne sekventeres ved hjælp af ABI 3130xl Avant Genetic Analyzer i henhold til fabrikantens anvisninger. Sekventeringsresultaterne skal analyseres med Sequencher-software, og sekvenserne skal ved hjælp af BLAST-funktionen matches med sekvenser i NCBI-databasen.


Top